ID: 1189011362

View in Genome Browser
Species Human (GRCh38)
Location X:37048816-37048838
Sequence GAAGTCTGCAAGGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189011356_1189011362 21 Left 1189011356 X:37048772-37048794 CCTAAACTTCAGAGGATGTATGG No data
Right 1189011362 X:37048816-37048838 GAAGTCTGCAAGGCTGCTGCAGG No data
1189011355_1189011362 27 Left 1189011355 X:37048766-37048788 CCTCTGCCTAAACTTCAGAGGAT No data
Right 1189011362 X:37048816-37048838 GAAGTCTGCAAGGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189011362 Original CRISPR GAAGTCTGCAAGGCTGCTGC AGG Intergenic
No off target data available for this crispr