ID: 1189012797

View in Genome Browser
Species Human (GRCh38)
Location X:37063330-37063352
Sequence CAGGATCTACTGGGGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189012797_1189012813 8 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012813 X:37063361-37063383 CCACGTAGGGCAGGGGTGGGTGG No data
1189012797_1189012811 5 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012811 X:37063358-37063380 CATCCACGTAGGGCAGGGGTGGG No data
1189012797_1189012805 -5 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012805 X:37063348-37063370 TCCTGAAGTACATCCACGTAGGG No data
1189012797_1189012808 0 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012808 X:37063353-37063375 AAGTACATCCACGTAGGGCAGGG No data
1189012797_1189012804 -6 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012804 X:37063347-37063369 ATCCTGAAGTACATCCACGTAGG No data
1189012797_1189012810 4 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012810 X:37063357-37063379 ACATCCACGTAGGGCAGGGGTGG No data
1189012797_1189012814 20 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012814 X:37063373-37063395 GGGGTGGGTGGAGAGACTGCTGG No data
1189012797_1189012809 1 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012809 X:37063354-37063376 AGTACATCCACGTAGGGCAGGGG No data
1189012797_1189012807 -1 Left 1189012797 X:37063330-37063352 CCCCTCCACCCCAGTAGATCCTG No data
Right 1189012807 X:37063352-37063374 GAAGTACATCCACGTAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189012797 Original CRISPR CAGGATCTACTGGGGTGGAG GGG (reversed) Intergenic
No off target data available for this crispr