ID: 1189014490

View in Genome Browser
Species Human (GRCh38)
Location X:37082415-37082437
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189014487_1189014490 -7 Left 1189014487 X:37082399-37082421 CCTAAACTCCTTTGCTTTCTATA No data
Right 1189014490 X:37082415-37082437 TTCTATAAACTATAGATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189014490 Original CRISPR TTCTATAAACTATAGATTGG AGG Intergenic
No off target data available for this crispr