ID: 1189015754

View in Genome Browser
Species Human (GRCh38)
Location X:37094865-37094887
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189015754_1189015761 27 Left 1189015754 X:37094865-37094887 CCTCCTAGCTAAATCTGTGTATA 0: 2
1: 0
2: 0
3: 12
4: 134
Right 1189015761 X:37094915-37094937 CTCTTAGAAGTGGAATTTCTGGG No data
1189015754_1189015760 26 Left 1189015754 X:37094865-37094887 CCTCCTAGCTAAATCTGTGTATA 0: 2
1: 0
2: 0
3: 12
4: 134
Right 1189015760 X:37094914-37094936 ACTCTTAGAAGTGGAATTTCTGG No data
1189015754_1189015759 17 Left 1189015754 X:37094865-37094887 CCTCCTAGCTAAATCTGTGTATA 0: 2
1: 0
2: 0
3: 12
4: 134
Right 1189015759 X:37094905-37094927 TTAGCTTCAACTCTTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189015754 Original CRISPR TATACACAGATTTAGCTAGG AGG (reversed) Intergenic
901345050 1:8532750-8532772 AATACAAAAATTTAGCTAGGTGG - Intronic
904728311 1:32567414-32567436 AATACACAAAAATAGCTAGGTGG - Intronic
905045867 1:35000393-35000415 AATACAAAAAATTAGCTAGGTGG - Intronic
909090865 1:71223792-71223814 TATACACAGATGTTCCTAGTTGG - Intergenic
912068984 1:105783399-105783421 TATACACATCTTTAGTTTGGGGG + Intergenic
913115141 1:115690053-115690075 AATACACTGATTTAGCCATGAGG - Intronic
914956550 1:152167694-152167716 TACACCAAGATTTTGCTAGGTGG - Intergenic
921925324 1:220706214-220706236 GATGCCCAGATTCAGCTAGGTGG - Intergenic
922358965 1:224803581-224803603 TAGATACAGATTTAGCTAACTGG - Intergenic
923962025 1:239096583-239096605 TAAACACAACTTTAGCCAGGTGG + Intergenic
1062887900 10:1033119-1033141 AATACAAAAATTTAGCCAGGCGG - Intergenic
1064797408 10:19028757-19028779 GAAACACAGATTTAGGCAGGTGG - Intergenic
1065988189 10:30978313-30978335 TATACACTGATTTATCTAAATGG + Intronic
1068291748 10:55011508-55011530 GATACACAGATTTATATAGAAGG + Intronic
1068729126 10:60336596-60336618 TATTTACATATTTAGCTAGCTGG + Intronic
1069835453 10:71305115-71305137 TATGCACAGATCTTCCTAGGAGG - Intergenic
1071952551 10:90721690-90721712 TATAGACACATATAGCTATGTGG - Intergenic
1072896966 10:99375775-99375797 TTAACACAGATTTAGCTCAGGGG - Intronic
1074167626 10:110898448-110898470 TATACAAAGCTTTATTTAGGGGG + Exonic
1076216699 10:128700311-128700333 GATGGAAAGATTTAGCTAGGGGG + Intergenic
1078112260 11:8405723-8405745 TGTGTACAGTTTTAGCTAGGGGG + Intronic
1083090905 11:60200196-60200218 GATACACAAATTTAGCTTAGTGG + Intergenic
1087977907 11:104573015-104573037 TATAGACACATTTATCTAGTTGG + Intergenic
1091513539 12:1154399-1154421 TATACAAAAATTAACCTAGGTGG + Intronic
1092506154 12:9102370-9102392 TATACAAAAAATTAGCTGGGTGG - Intronic
1096279907 12:50244071-50244093 AATACAAAAATTTAGCTGGGCGG - Intronic
1096773040 12:53948592-53948614 TATACCCAGATTTATTTTGGAGG + Intergenic
1100588730 12:96004313-96004335 TATACAAAGATAAAGCTAGGGGG - Intronic
1101907856 12:108841005-108841027 TAAACACAGATCTAGATTGGTGG + Intronic
1102707870 12:114897710-114897732 TATACACGGAATTTGCTATGTGG + Intergenic
1103861724 12:124020643-124020665 CATACACATTTTTAGCTTGGAGG - Intronic
1106014798 13:25858497-25858519 TATCCACAGATTTACCTGGCTGG + Intronic
1106267218 13:28121171-28121193 AATACAAAAAATTAGCTAGGTGG - Intergenic
1106782599 13:33074533-33074555 TATACACAGAATTGGTTATGCGG - Intergenic
1107136353 13:36948088-36948110 TAAGCACAGATTTACCTAAGAGG - Intergenic
1109177409 13:59173442-59173464 TAGACACAGGATGAGCTAGGAGG + Intergenic
1110639694 13:77808382-77808404 TATATACAGAGTTAGTGAGGGGG + Intergenic
1110727170 13:78838982-78839004 AATACAAAGATTCAGTTAGGAGG - Intergenic
1110849774 13:80231937-80231959 AATACAAAAATTTAGCTGGGTGG + Intergenic
1111066345 13:83097692-83097714 TATACACATATTCAGCAACGTGG + Intergenic
1112984237 13:105427330-105427352 TACACACACATTTAGATATGAGG - Intergenic
1115464196 14:33696670-33696692 TACATAGAGATTTAGTTAGGTGG - Intronic
1118084009 14:62394714-62394736 TATACACAGATTTTGGTACCCGG - Intergenic
1119365588 14:74088965-74088987 CATTCACAGATTTAGCTGGGAGG + Intronic
1119839706 14:77782936-77782958 AATAAACAAAATTAGCTAGGTGG + Intergenic
1127230079 15:56981636-56981658 TATACAGAGATTTTGCTGTGTGG - Intronic
1130264288 15:82385356-82385378 AATACAAAAAATTAGCTAGGTGG - Intergenic
1130474547 15:84252596-84252618 AATACAAACAATTAGCTAGGTGG - Intergenic
1130481962 15:84366650-84366672 AATACAAACAATTAGCTAGGTGG - Intergenic
1130812792 15:87398678-87398700 TATACACAGGGTTAGGTAAGAGG + Intergenic
1131455129 15:92577502-92577524 TATGCAAAGATTTAGCCAGAAGG + Intergenic
1139338668 16:66252037-66252059 CAAACACAAATTTAGCTAAGAGG - Intergenic
1140319335 16:73933234-73933256 TATACACACATTTAGGTTTGGGG - Intergenic
1141280934 16:82628767-82628789 TATACCCCAATTTAGCAAGGCGG + Intronic
1141780865 16:86159863-86159885 TATCCATAGCTTGAGCTAGGTGG - Intergenic
1141938910 16:87261340-87261362 GGCACACAGATTTAGCTTGGTGG - Intronic
1144416405 17:15051620-15051642 AATACCCAGATTTAGAAAGGTGG - Intergenic
1148567178 17:48640427-48640449 TATAGGCAGCTTTAGTTAGGAGG + Intergenic
1152373474 17:79905103-79905125 TATGCACAGTCTTAGCTAGGGGG + Intergenic
1153840342 18:9001667-9001689 AATACAAATAATTAGCTAGGTGG + Intergenic
1156944900 18:42816795-42816817 AAGACCCTGATTTAGCTAGGAGG + Intronic
1157366073 18:47065417-47065439 TATGCACAGATTTTGGTATGGGG + Intronic
1157366691 18:47071373-47071395 TATGCACAGATTTTGGTACGGGG + Intronic
1159391511 18:67798944-67798966 TATACACATATTTAGTTAATTGG + Intergenic
1160482626 18:79256365-79256387 TATAAACAGCATTAGCTAGGTGG + Intronic
1166663716 19:44664364-44664386 TAAAAAGAGATTTAGCCAGGTGG - Intronic
1166875093 19:45892075-45892097 AATACAAAAATTTAGCCAGGCGG - Intronic
925753526 2:7110998-7111020 AATACACAAAATTAGCTGGGTGG - Intergenic
928849830 2:35732400-35732422 TATAAACAGATTGATCTAGGGGG + Intergenic
931701095 2:64909692-64909714 AATACAAAAAATTAGCTAGGCGG + Intergenic
931715478 2:65025408-65025430 AATACAAAAATTTAGCCAGGTGG + Intergenic
935632305 2:105222161-105222183 TTTACAAAGATTTAGCTACAGGG - Intergenic
936903599 2:117511733-117511755 TATACAGAGATTTAGCACAGAGG - Intergenic
937475982 2:122215725-122215747 TATACACAGATTCAGCTCCAGGG - Intergenic
943618341 2:190119259-190119281 TATACAGAGATAGAGCGAGGCGG + Intronic
946243288 2:218369966-218369988 TATGCAAAGATTTAGCTACAAGG - Intergenic
946456331 2:219829578-219829600 TATACAAAGGATTAGCTAGCCGG + Intergenic
947804979 2:232960242-232960264 TATACATATATTTAGCAATGTGG + Intronic
1169457929 20:5768670-5768692 TATAGATAGATAAAGCTAGGAGG - Intronic
1182684694 22:32112764-32112786 GATACAAAGGTTTAGTTAGGTGG + Exonic
949132860 3:526566-526588 TATGCACAGATTCAGTTAGGAGG + Intergenic
952067122 3:29583980-29584002 AAGAAACAGATTTAGCTAGCAGG - Intronic
954057856 3:48042886-48042908 TATACACAGATTAATATAGTAGG - Intronic
955567613 3:60265255-60265277 TATAGACATATTTAGCAAGCAGG + Intronic
962742443 3:138371768-138371790 TAAACACAGGTGCAGCTAGGGGG - Intronic
966524912 3:180910327-180910349 AATACAAAGATTAGGCTAGGCGG + Intronic
967604504 3:191429268-191429290 TACACAAATATTTAGCTAGAGGG - Intergenic
970334162 4:15016232-15016254 TATACACATATGTAACTGGGTGG + Intronic
973077674 4:45950199-45950221 TATACACATATTTCACTAGAAGG + Intergenic
973573846 4:52266239-52266261 CAGACACAGATTTGGCTAGCAGG + Intergenic
975200311 4:71580555-71580577 TATACACAGATTTATACTGGAGG - Intergenic
976393542 4:84531312-84531334 TATACACTGAAGTATCTAGGGGG + Intergenic
980239489 4:130155106-130155128 TAAAAACAGATTTAGCCAAGAGG + Intergenic
985276068 4:188239148-188239170 TATACAAAAAATTAGCCAGGCGG + Intergenic
990207935 5:53450419-53450441 TCCACAAAGGTTTAGCTAGGAGG - Intergenic
996719565 5:126616902-126616924 TATTCACTGACTTAGCCAGGTGG + Intronic
999158025 5:149472392-149472414 TATACAAAAAATTAGCCAGGCGG - Intergenic
1000880286 5:166689590-166689612 TATACACAAATTTATTGAGGAGG - Intergenic
1002703188 5:181141877-181141899 TATACACAGTTTCAGTTAGGAGG - Intergenic
1002932383 6:1643559-1643581 GATACACACCTATAGCTAGGTGG + Intronic
1005645479 6:27833850-27833872 TATACAAAAAATTAGCCAGGTGG + Intergenic
1008022219 6:46592489-46592511 TATACAAGGATTTAGCTAAAAGG + Intronic
1010455331 6:76048175-76048197 TATACAAAGATTCAGGTAAGGGG - Intronic
1010600538 6:77820421-77820443 AATACACAAAATTAGCCAGGGGG - Intronic
1010880349 6:81160632-81160654 TATAGATAGATATAGCTAGATGG - Intergenic
1011903633 6:92333631-92333653 GATACAAAGGTTTAGTTAGGTGG - Intergenic
1014161871 6:118179026-118179048 TATACATAGATTTAACTCAGGGG - Intronic
1014601238 6:123415922-123415944 AATAGACATATTTACCTAGGAGG + Intronic
1016963330 6:149694207-149694229 TGTACAAAGATTTAGCTATAAGG + Intronic
1017320346 6:153084674-153084696 GACAGACAGCTTTAGCTAGGAGG + Intronic
1018042618 6:159938292-159938314 AATACACAAAATTAGCCAGGTGG + Intergenic
1018466121 6:164047118-164047140 AATACAAAGATTCAGTTAGGTGG - Intergenic
1021491956 7:21228608-21228630 TATACAGAGAATTACCTAGGAGG - Intergenic
1022483875 7:30762908-30762930 GATATACAGATTTAGCCAGTAGG + Intronic
1022531794 7:31071417-31071439 TATACACAGATGGAGCCATGAGG + Intronic
1023639530 7:42243321-42243343 TATACAGAGAATTTGGTAGGTGG + Intergenic
1028268055 7:88752677-88752699 GATACAGAGTTTTAGATAGGAGG + Intergenic
1028496793 7:91470435-91470457 TATAGACAGAATTAGGTATGAGG + Intergenic
1032242979 7:130180056-130180078 TATACAAAGATTTAGGTAAGAGG + Intronic
1032907389 7:136385834-136385856 TATCTACAAATTAAGCTAGGAGG + Intergenic
1033496595 7:141903610-141903632 TATACACACATTTATATATGAGG - Intergenic
1033894522 7:146054485-146054507 TATACCCAGATTTGGCTTGGTGG - Intergenic
1034209020 7:149346091-149346113 TTTACAAATCTTTAGCTAGGTGG + Intergenic
1035850724 8:2916555-2916577 TTTACACAGATCCAGGTAGGTGG + Intergenic
1037505669 8:19527014-19527036 TATAGATAGATATAGATAGGTGG - Intronic
1037598284 8:20372893-20372915 TATATATAGATATAGATAGGTGG + Intergenic
1038294732 8:26280689-26280711 TACACACAGTCTTAGCTATGGGG - Intergenic
1038384142 8:27125409-27125431 TAAACACACAGTTAGATAGGAGG - Intergenic
1038763172 8:30403626-30403648 TATACACAGATTTAGCTAGGAGG - Intronic
1043799728 8:84592906-84592928 TATACACATATTTAGCTTGAAGG + Intronic
1044132500 8:88542547-88542569 TATTCACAGATGTAAGTAGGAGG + Intergenic
1044537378 8:93372960-93372982 TAAGCACATATCTAGCTAGGTGG - Intergenic
1047472503 8:125191026-125191048 AATACAAAAAATTAGCTAGGTGG - Intronic
1048252653 8:132879567-132879589 TATATACAGAATTAGCAAGAAGG + Intronic
1054841120 9:69741302-69741324 GAGAAACAGATTTAGGTAGGCGG - Intronic
1056653704 9:88491588-88491610 TATAGAAAGATTTAGCTACATGG + Intergenic
1058020776 9:100085425-100085447 TATAAACAGATTTAGCTTAAGGG + Intronic
1061342747 9:129996290-129996312 GATACACAGAATTAGCAAAGAGG + Intronic
1189015754 X:37094865-37094887 TATACACAGATTTAGCTAGGAGG - Intergenic
1189911151 X:45811554-45811576 AAGGCACAGATGTAGCTAGGAGG - Intergenic
1193591200 X:83390652-83390674 TATAGACAAGTTTAGTTAGGTGG - Intergenic
1193606841 X:83579501-83579523 TTTACTCAGATCTAGCCAGGTGG + Intergenic
1193945415 X:87727938-87727960 TATACACAGTGATAGCTGGGGGG + Intergenic
1195477882 X:105307427-105307449 TATACACATATTTAGAGAGAGGG - Intronic
1197078560 X:122383292-122383314 TGTATACAGATTTTGCTAGTGGG - Intergenic
1199845575 X:151690574-151690596 GAGACACAGATGTAGGTAGGTGG - Intergenic
1202376445 Y:24242273-24242295 AATACAAACAATTAGCTAGGTGG + Intergenic
1202494335 Y:25427846-25427868 AATACAAACAATTAGCTAGGTGG - Intergenic