ID: 1189015756

View in Genome Browser
Species Human (GRCh38)
Location X:37094890-37094912
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 2, 1: 0, 2: 0, 3: 21, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189015756_1189015760 1 Left 1189015756 X:37094890-37094912 CCCTTAGTGATTTCCTTAGCTTC 0: 2
1: 0
2: 0
3: 21
4: 228
Right 1189015760 X:37094914-37094936 ACTCTTAGAAGTGGAATTTCTGG No data
1189015756_1189015762 9 Left 1189015756 X:37094890-37094912 CCCTTAGTGATTTCCTTAGCTTC 0: 2
1: 0
2: 0
3: 21
4: 228
Right 1189015762 X:37094922-37094944 AAGTGGAATTTCTGGGTCAAAGG 0: 9
1: 37
2: 244
3: 755
4: 1897
1189015756_1189015759 -8 Left 1189015756 X:37094890-37094912 CCCTTAGTGATTTCCTTAGCTTC 0: 2
1: 0
2: 0
3: 21
4: 228
Right 1189015759 X:37094905-37094927 TTAGCTTCAACTCTTAGAAGTGG No data
1189015756_1189015761 2 Left 1189015756 X:37094890-37094912 CCCTTAGTGATTTCCTTAGCTTC 0: 2
1: 0
2: 0
3: 21
4: 228
Right 1189015761 X:37094915-37094937 CTCTTAGAAGTGGAATTTCTGGG No data
1189015756_1189015763 10 Left 1189015756 X:37094890-37094912 CCCTTAGTGATTTCCTTAGCTTC 0: 2
1: 0
2: 0
3: 21
4: 228
Right 1189015763 X:37094923-37094945 AGTGGAATTTCTGGGTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189015756 Original CRISPR GAAGCTAAGGAAATCACTAA GGG (reversed) Intergenic
902530502 1:17087735-17087757 GAAGGCAGGCAAATCACTAAAGG - Intronic
903511174 1:23875948-23875970 GAAGCAAGGGAAATCCCAAAAGG + Intronic
905475705 1:38226255-38226277 GATTCTCTGGAAATCACTAAGGG - Intergenic
907552941 1:55319534-55319556 TAAGCTGAGGATATCACTGAGGG + Intergenic
908271836 1:62429956-62429978 GAAACTAAGGAATTGACTATTGG + Intergenic
908985037 1:70007214-70007236 GATGCTAATGAAATGACTTATGG - Intronic
909109757 1:71459824-71459846 AAGGATAAGGAAATCACTATGGG - Intronic
909998167 1:82307082-82307104 GAAGCTAAGGCAATCCCGGAAGG - Intergenic
910228288 1:84959676-84959698 GCAGCTGAAGAAATCACTTAGGG - Intronic
911658608 1:100474647-100474669 GAAGCCAAGAAAATCACTACAGG - Intronic
916400325 1:164440540-164440562 GAAACCTAGGAAATCAGTAAAGG - Intergenic
917457122 1:175194478-175194500 GAAGCTAAGGAAGTTCCTCAAGG + Intergenic
920978862 1:210812822-210812844 GAAGCCAAGCAAATCCCTATAGG + Intronic
920980260 1:210827770-210827792 GAAGCCAAGGCAATGACTATTGG - Intronic
922091450 1:222399262-222399284 GAAGCAGAGGTAATCACTCAGGG + Intergenic
1063856180 10:10256806-10256828 GAGGCTAAGGGAAGCTCTAAGGG + Intergenic
1063996325 10:11623391-11623413 AAACCTAAGAAAAGCACTAACGG - Intergenic
1065201858 10:23320285-23320307 GAGTCTAAGAAAACCACTAAAGG + Intronic
1067793430 10:49304325-49304347 GAGGTTAAGGAACTCACTTAAGG - Intronic
1067900349 10:50234088-50234110 TAAGATAAGTAAATCACTAAAGG + Intronic
1069118876 10:64543454-64543476 GAAGATATGGAAATGGCTAAGGG + Intergenic
1072655534 10:97327656-97327678 GGAGCTGAGGAAAACACTGATGG + Intergenic
1073808794 10:107129854-107129876 GAAGTTAAGGAAATGATCAATGG - Intronic
1075750463 10:124766331-124766353 GCAGCTTACGAAATTACTAATGG + Intronic
1079122110 11:17693529-17693551 GAGACTTAGGAAATTACTAATGG + Intergenic
1080226020 11:29961322-29961344 GGAGATATGGAAATCAATAATGG - Intergenic
1080818947 11:35786993-35787015 GCACTTAAGGAAATCACAAAAGG - Intronic
1083703375 11:64496027-64496049 GTAGCTAATGAATTCACTGATGG - Intergenic
1085113507 11:73909639-73909661 GAAACTAAGGCAATCACTGAAGG - Intronic
1085703535 11:78766126-78766148 GAAGTTAAGTACATCACTCAAGG + Intronic
1087393229 11:97566125-97566147 GAAGCTGAGCAAACCACAAATGG + Intergenic
1088442139 11:109882537-109882559 GAAGCTTATGAAATCATTGAGGG - Intergenic
1093128886 12:15365438-15365460 GTAGCAAAGAAAATCAATAAAGG + Intronic
1093472535 12:19518458-19518480 TAAACTACTGAAATCACTAAAGG - Intronic
1095223358 12:39646717-39646739 AAACCTAAGTAAATCACTACAGG - Intronic
1095331307 12:40968096-40968118 GAGGCTAAGTTAATCACTAAAGG + Intronic
1096545340 12:52335171-52335193 GAAGCAAAGGAAAGCACTCGGGG + Intergenic
1098721508 12:73904619-73904641 GAAGATAAGAAAATCAAGAAAGG - Intergenic
1100107855 12:91199042-91199064 ACAGCTAAGGAAATAATTAATGG - Intergenic
1103870184 12:124085726-124085748 GAGGGGAAGGAAGTCACTAAGGG - Intronic
1105276659 13:18934990-18935012 GGACCTTAGGGAATCACTAAAGG - Intergenic
1106900748 13:34352675-34352697 GAAGTTAAGGAAATTGCTCAAGG - Intergenic
1107320643 13:39183572-39183594 AAATGTAAGGAAATCAATAAAGG + Intergenic
1107807032 13:44163083-44163105 GAAGCCAAGGAAATGGCTAGGGG - Intergenic
1108006282 13:45949959-45949981 GAAGTTATGGAAAACACTATTGG + Intergenic
1108691379 13:52862236-52862258 GAAGCTGAGGAGATAACTAGGGG + Intergenic
1108761314 13:53569074-53569096 CAAGCTAACAAAATAACTAAAGG - Intergenic
1109195653 13:59375250-59375272 GAAGCTGAGGGAATGACAAATGG + Intergenic
1109243906 13:59929006-59929028 GTAGATATGTAAATCACTAAAGG + Intronic
1109931885 13:69226525-69226547 AAAGCAAAGGAAATAAATAAAGG - Intergenic
1110139309 13:72107821-72107843 GACAGTAAAGAAATCACTAAGGG - Intergenic
1110617102 13:77553548-77553570 GAAGGTAAAGAAATACCTAAAGG - Intronic
1111219419 13:85184106-85184128 GAAGCAGAGAAAATCACTGAAGG + Intergenic
1111530783 13:89534976-89534998 GAAGCTAAGAACATCACTCATGG - Intergenic
1112263167 13:97897032-97897054 CAAGCTCAAGAAACCACTAAAGG - Intergenic
1115913571 14:38284010-38284032 GAAGCTAAGGATAGAACTTATGG + Intergenic
1118520500 14:66577721-66577743 AAAGCAAAGGAAAGAACTAAAGG + Intronic
1121188770 14:92003904-92003926 AGAGCTAAGAAAATCACTACAGG - Exonic
1121811314 14:96893442-96893464 GAAGCTACAGAAATCAGGAACGG - Intronic
1125043210 15:35215828-35215850 GAAGTCAAGTAAATCACTCAAGG + Intergenic
1125132469 15:36299748-36299770 GAAGCTTGGGAAATGACTATTGG - Intergenic
1126345430 15:47688915-47688937 GAGGCAAAGGAAATGACTCATGG + Intronic
1126391908 15:48166430-48166452 GAATTCAAGGAAATAACTAAAGG + Intronic
1126441921 15:48698667-48698689 GAAGAGAAGGGAATTACTAATGG - Intergenic
1128777911 15:70337715-70337737 GAAGCAAAAGAAATCAATTAAGG - Intergenic
1133724167 16:8522119-8522141 GAAGCTAAAGCCATGACTAAAGG - Intergenic
1133824566 16:9266625-9266647 GAAGCAAGGGAAATCTCCAAGGG - Intergenic
1135539246 16:23317318-23317340 GCAGTTAAGGGAATCACTCAGGG + Intronic
1135755576 16:25094814-25094836 GAAGCTGAGAAAATCACTGCAGG + Intergenic
1136952826 16:34742985-34743007 GAATCGAAGGGAATCACGAATGG - Intergenic
1136954013 16:34758677-34758699 GAATCGAAGGGAATCACTAATGG - Intergenic
1136966252 16:34914358-34914380 GAATCGAAGGGAATCACGAATGG - Intergenic
1136966407 16:34916385-34916407 GAATCAAAGGGAATCACGAATGG - Intergenic
1137542222 16:49372570-49372592 GGAGCAAAGGAAAACAATAAAGG - Intergenic
1137928811 16:52567151-52567173 GAAGGAAAGGAAGTCACTGAAGG + Intergenic
1138245543 16:55464338-55464360 GAAGTTAAGAAACTCACTCAAGG - Intronic
1138953180 16:61939021-61939043 GAAGATGAGGAAATCAACAAGGG + Intronic
1141380630 16:83573428-83573450 GAAGGTAAGGAAACTACTAGAGG + Intronic
1142252733 16:89000041-89000063 CAAGATAAGGAACTCACTGACGG + Intergenic
1145973879 17:28973197-28973219 GAAGCTAAGGAACTTGCAAAAGG + Intronic
1147392805 17:40121153-40121175 GAAGCAAAGGAAATCTCTGAAGG - Intergenic
1147903088 17:43803337-43803359 GAACTTAAGTAAATCTCTAATGG + Intronic
1149418712 17:56487474-56487496 AAAGCCAAGGAAATCAACAAAGG - Intronic
1150000946 17:61439574-61439596 GAAGCTAAGTAGATCACCCAAGG + Intergenic
1152997133 18:418114-418136 GAGGTTAAGCAAATCACTTAAGG - Intronic
1153254015 18:3152256-3152278 GAAGACAAAGAAGTCACTAATGG - Intronic
1154236680 18:12612458-12612480 GAAACTATTGAAATCACCAAGGG - Intronic
1154351565 18:13587802-13587824 AAAGCTAAGGAAATAAACAAAGG - Intronic
1155391295 18:25339937-25339959 GAAGCCATGGACATCACTAAAGG + Intronic
1155791641 18:29977921-29977943 GAAACTAGGGAAATCATTAGAGG - Intergenic
1156825923 18:41429996-41430018 GCAGCTGATGAAATCTCTAAAGG + Intergenic
1158616385 18:58991603-58991625 GAAGGTCAGGAAATGACTCATGG - Intergenic
1158865766 18:61636416-61636438 GAAGCCAGGGAAATCTCTTAAGG - Intergenic
1159306621 18:66651790-66651812 ACAGCTGAGGAAATGACTAATGG + Intergenic
1159810220 18:73010027-73010049 AAGGCTAAGAATATCACTAAGGG + Intergenic
1164779405 19:30880447-30880469 GAAGAGAAGGAAACCACTCAAGG + Intergenic
1164889733 19:31812933-31812955 TAAGCTAAGGAAAGCAAAAATGG + Intergenic
927970482 2:27303076-27303098 GAAGCAAAGGAAATCAGTGGGGG + Intronic
928256202 2:29725117-29725139 GAAGGTAACCAAATCCCTAAGGG - Intronic
928332222 2:30366498-30366520 CAGGCTAAGGAAGTCAGTAAAGG - Intergenic
930200219 2:48545598-48545620 GCAGATGAGGAAACCACTAAAGG - Intronic
931553174 2:63469723-63469745 GGAGCAAAAGAAATCACTACTGG + Intronic
932502799 2:72199037-72199059 GAAGCAACAGAATTCACTAAGGG + Intronic
932884143 2:75532771-75532793 GAAGCTGAGCAAATCTCAAATGG + Intronic
933192214 2:79347348-79347370 AAAGCTAAGTAAATCACCCAAGG - Intronic
933417342 2:82002947-82002969 GAAGGAAAGGAAAACACAAAGGG - Intergenic
935188150 2:100753044-100753066 GAAGCTAAGTAACTAACTTAAGG + Intergenic
938982324 2:136538588-136538610 AAAGCTACGGAAGTCACTAAAGG + Intergenic
939297820 2:140292524-140292546 GAAGCTAAGGAGATGAGAAAGGG - Intronic
940173570 2:150854238-150854260 TAAGCAAAGGAATTCACTGATGG - Intergenic
940823937 2:158388436-158388458 GAAGCTAAGGAACTTGCCAAGGG - Intronic
941079485 2:161043947-161043969 GAAGTTAAGCAGATCACTTAAGG + Intergenic
944394799 2:199254447-199254469 GAAGTTAAATAAATTACTAAAGG + Intergenic
944706388 2:202293311-202293333 GAAACTAAGGTAATCAATCAAGG - Intronic
946026538 2:216675075-216675097 GAAGCTAAGGAAATTTCTATTGG + Exonic
946373199 2:219293081-219293103 GAAGCCAAGGAACTTACTCAGGG + Intronic
946530857 2:220568912-220568934 GGAGCTAAGGAAATCTCTTTTGG + Intergenic
1169070791 20:2728668-2728690 GAAGCTGAGGGGATCACAAAAGG - Intronic
1170345365 20:15380399-15380421 GAAGATTAGGAAATAACTTAGGG + Intronic
1174048519 20:47750884-47750906 GAAGGTAAGGAAACCAGTCAAGG - Intronic
1176938441 21:14894638-14894660 GATGCTAAGTAATTCACTCAAGG - Intergenic
1202726687 2_KI270716v1_random:6941-6963 GAATCGAAGGGAATCACGAATGG - Intergenic
950236467 3:11325721-11325743 GAAGTTAAGTAAATTGCTAAAGG + Intronic
951131790 3:19055467-19055489 CTAGCTGAGTAAATCACTAAAGG - Intergenic
951524484 3:23640533-23640555 AAAGCTAAGAAAGTCATTAAGGG + Intergenic
951887744 3:27540504-27540526 GAAGCTAAAGATTTCACTGAGGG + Intergenic
952005269 3:28836137-28836159 GCAGCTTTGCAAATCACTAATGG - Intergenic
952174899 3:30851574-30851596 GCAGCCAAGGCAATCTCTAAAGG - Intronic
952398787 3:32944814-32944836 GAAACTGAGGAAAGCAATAAGGG - Intergenic
952712563 3:36446052-36446074 GAAGCTAAGAAAATTAGAAATGG - Intronic
952934642 3:38387137-38387159 GAAGCTCAGTGAATCACAAAGGG - Intronic
953122161 3:40055148-40055170 GGTGCTAAGGAAATGCCTAAAGG - Intronic
956673458 3:71713291-71713313 GAAGAGCAGGAAATCACAAATGG - Intronic
956835675 3:73094450-73094472 GAAGCACAGGAAATGACTCATGG - Intergenic
956952819 3:74301802-74301824 GAACCTAAGGAAGGCACAAATGG + Exonic
957019072 3:75103748-75103770 GAAATTAAGGAAAACACAAATGG - Intergenic
961058108 3:123805763-123805785 GAAGTTAAGTAAATCACCCACGG - Intronic
961376837 3:126472828-126472850 GAACCTAAGGAAATTGCGAAAGG - Intronic
961838497 3:129685678-129685700 TATGCCAAGGATATCACTAAAGG + Intronic
962065182 3:131972200-131972222 GAAGCCAATGAAAATACTAAGGG + Intronic
962578079 3:136772880-136772902 GTAGCTAAGGCAATCCCTGAAGG - Intergenic
962881886 3:139586247-139586269 GAAGCAGAGAAAATAACTAATGG + Intronic
963724187 3:148900911-148900933 GAAGCAAAGAAAATGACAAAAGG + Intergenic
964087228 3:152833343-152833365 GAAGCAAAGAAAACCATTAAGGG - Intergenic
965309141 3:167107217-167107239 GAAGCTGAGCAGAGCACTAATGG + Intergenic
966989605 3:185216288-185216310 GAATCTAGGGAAATCACTTAAGG + Intronic
967324594 3:188226587-188226609 AAAGCTGAGGAAATTAGTAAGGG + Intronic
967353620 3:188543257-188543279 GATGCTCTGAAAATCACTAAAGG - Intronic
967358916 3:188607950-188607972 GAGGCTTAGAAAATGACTAATGG - Intronic
971134314 4:23850788-23850810 GAAGCTAAGTAACTCATTAAAGG + Intronic
972588398 4:40460243-40460265 GAAGCTAAGCATATCAGTTAAGG - Intronic
977076987 4:92466597-92466619 GAAACCAAGGAAATGAGTAATGG - Intronic
978039618 4:104043199-104043221 GTATCTACGGAAATAACTAAGGG + Intergenic
980281036 4:130720117-130720139 GAAGCTAAGTAATTCTCTAGGGG - Intergenic
980753639 4:137126520-137126542 TAAACTAAGGAAGTCACCAAAGG - Intergenic
982283697 4:153712771-153712793 GAAGCTAAGTAAATTCCTCAGGG - Intronic
982371540 4:154638898-154638920 GCAGCTAAGGAGATAACAAATGG + Intronic
983318948 4:166169975-166169997 GAAGATAATGAATTCAATAAGGG - Intergenic
983812742 4:172083545-172083567 GGAGCTACGGAAATATCTAAGGG - Intronic
987831081 5:23095964-23095986 GAAGCTGAAGAAATCACAAAAGG - Intergenic
987929196 5:24381707-24381729 GAGGTTAAGGAAATGGCTAAAGG + Intergenic
988207947 5:28164378-28164400 GAAGCTAAGGAAATAAAATAGGG + Intergenic
989255422 5:39361595-39361617 GAAGTTAAGGAATTTACTTAAGG + Intronic
990175564 5:53104069-53104091 GAAGTTAAGGAACTCACTCAAGG + Intronic
996089569 5:119337827-119337849 GAAGCTGGGGAAATCAGTTAGGG - Intronic
996707580 5:126512984-126513006 GAAGGTTAGGAGATCACCAATGG - Intergenic
998625522 5:143841532-143841554 GAAGTTAAGGAATTTACTCAAGG + Intergenic
999286919 5:150399637-150399659 GAAGCTAAACTAAACACTAAAGG + Intronic
999300512 5:150487146-150487168 GAAGGTAAGGAACCCACTCAAGG - Intronic
999521346 5:152353652-152353674 TAACCTAAGGAAATCCCTAGAGG + Intergenic
1000385350 5:160669978-160670000 GAAGTTAAGGAATACACAAATGG + Intronic
1000453849 5:161424201-161424223 GTAGCTAAGGTAATCAATGAAGG + Intronic
1002489802 5:179567104-179567126 GAAGCTTATAAAATCTCTAAGGG - Intronic
1002668370 5:180844814-180844836 GAAGTCAAGGAAATCCCTCAAGG - Intergenic
1004251385 6:14025754-14025776 GAAGCTGCAGAAATCACGAAGGG - Intergenic
1005171641 6:22992641-22992663 GGAGCTAAGGGAATCCCAAATGG - Intergenic
1008087658 6:47261445-47261467 GAAGCTAATGAGATGACGAATGG - Intronic
1008626667 6:53323948-53323970 GAATTTAAGGAAATCAGTTATGG + Intronic
1009520376 6:64674922-64674944 GAAAATAAAGAAATCCCTAATGG - Intronic
1010659295 6:78550273-78550295 GAAGAAGAGGAAGTCACTAAAGG + Intergenic
1010917725 6:81641521-81641543 GCAGCTAATGAGATCACTTAGGG + Intronic
1014016967 6:116543215-116543237 GAAGCAAAGGAAGTCATTAGAGG + Intronic
1016115812 6:140284399-140284421 AAAGCTAAAGTAATCACTATTGG - Intergenic
1017816011 6:158017209-158017231 GAAGAAAAGGAAGTCATTAAAGG + Exonic
1018464293 6:164029193-164029215 GAAGCGAGGGAGAACACTAAGGG - Intergenic
1021312864 7:19114596-19114618 GAAGTTAAGTAAAACAATAATGG - Intronic
1022493793 7:30840467-30840489 GAAGCCAAGGACATCACCATAGG - Intronic
1022780232 7:33574458-33574480 GAAGCTAAGTAACTCATTCAAGG + Intronic
1024306113 7:47931011-47931033 GAAGATACTAAAATCACTAACGG + Intronic
1024382549 7:48714826-48714848 GACACTAAAGAAATTACTAAAGG - Intergenic
1025317074 7:58044985-58045007 GAATCGAAGGGAATCACGAATGG + Intergenic
1026428981 7:70325161-70325183 GAAGCTTAAGAAATCATTACAGG + Intronic
1027439225 7:78200082-78200104 TAAGCTTAGCAAATCACTTAAGG - Intronic
1027487156 7:78775760-78775782 AAATCTAAAGAATTCACTAAAGG + Intronic
1028251978 7:88547513-88547535 GAAGCAAATCAAATCAATAATGG - Intergenic
1028505072 7:91561581-91561603 GAAGGGAAGGAAATCAACAAAGG + Intergenic
1028808397 7:95055595-95055617 TAAGCTATGGGGATCACTAAAGG - Intronic
1029693465 7:102197830-102197852 AATGCTAAACAAATCACTAATGG - Intronic
1029701572 7:102249496-102249518 GAACCTGTGGAAATCACTTAGGG - Exonic
1030459610 7:109816217-109816239 GAAGCTAAGCAAATTACAAAAGG - Intergenic
1031503511 7:122552380-122552402 AAAGCTCAGGAACTCACTGAAGG - Intronic
1032862118 7:135890323-135890345 GAAACTAATGAAATCAATTATGG - Intergenic
1034675133 7:152887423-152887445 GATGCTAAGGAATTGACTCACGG - Intergenic
1034964051 7:155380791-155380813 AAAGCAAACGAAATCACTCAAGG + Intergenic
1038704069 8:29877706-29877728 GAAGAGAAGGAAATCTATAATGG + Intergenic
1038763174 8:30403651-30403673 GAAGCTAAGGAAATCACTAAGGG - Intronic
1039323318 8:36457131-36457153 AAAGTTAAGGAAATAACAAAAGG + Intergenic
1039394177 8:37208971-37208993 GAAGCTAAGGAAACCACAGATGG + Intergenic
1040815197 8:51500360-51500382 GAAGCTTAGGAAATAACTCCTGG - Intronic
1042524453 8:69749837-69749859 GGTGCTAAGGAGAACACTAAAGG + Intronic
1043589900 8:81817976-81817998 GCAGATAAGGAAATCACCTATGG + Intronic
1044293721 8:90503017-90503039 AAAGCTGGGGAAATAACTAATGG + Intergenic
1046303070 8:112323711-112323733 GAAGGTAAGGAACACACTATAGG - Intronic
1046720985 8:117618895-117618917 GAAGGTAAGTAGATCACAAATGG - Intergenic
1047174440 8:122527192-122527214 GGGGTTAAGGAAATCAATAAAGG - Intergenic
1048116912 8:131533488-131533510 GAAGCTAAAGAAATCTAAAAAGG + Intergenic
1048124448 8:131617386-131617408 GAAACTAAGGAAGTGATTAAAGG - Intergenic
1050063502 9:1734843-1734865 GAAGCTGAAGAAATCCCTGAGGG + Intergenic
1054935239 9:70680211-70680233 GAAGTTAAGTAATTCGCTAAAGG - Intronic
1055552079 9:77440698-77440720 GAAACAAAGGAAATTGCTAAGGG - Intronic
1055905328 9:81287014-81287036 TAAGCTAAGGAACTCAGGAATGG - Intergenic
1056729374 9:89152058-89152080 GAAGCTACTCAAATCACTAGGGG - Intronic
1060913441 9:127369438-127369460 GAAACTAAAGAAATTACCAAAGG + Intronic
1186918478 X:14249527-14249549 GGGGCTAAGGAAATGACTAATGG - Intergenic
1186974554 X:14887463-14887485 GAAGCTAAGCAAGTCACTCTAGG - Intronic
1188055383 X:25535134-25535156 GAAGCTCAGGAAAAAAGTAAAGG - Intergenic
1188225792 X:27595513-27595535 AAATCTAAGGAAATCAGAAAGGG - Intronic
1188671123 X:32883174-32883196 GAACCCAAGGAAATCAGAAAGGG + Intronic
1188943003 X:36263486-36263508 GAAGGTAAGCAAATAACTATGGG - Intronic
1189015756 X:37094890-37094912 GAAGCTAAGGAAATCACTAAGGG - Intergenic
1189260143 X:39672701-39672723 GAAGATAAGGAAATTAATAAAGG - Intergenic
1189264097 X:39700338-39700360 GAAGGGAAGGCAGTCACTAATGG + Intergenic
1190076973 X:47324077-47324099 GAAGCTAAGGAAATTTCTCAAGG - Intergenic
1190601655 X:52098998-52099020 GAAACTAGGGAAATAACTACAGG + Intergenic
1190700671 X:52987164-52987186 GAAGCTAATGAAAGAAATAAAGG + Intronic
1191128703 X:56985352-56985374 GCAGCTGAGGCAATCTCTAATGG - Intronic
1191641517 X:63433004-63433026 AAAGATAAAGAAATCACTCAAGG - Intergenic
1191677245 X:63804304-63804326 GAAGAGAAGGAAAGCAATAAAGG + Intergenic
1193966256 X:87990146-87990168 GAGGATAAGGAACTCACTAAAGG + Intergenic
1194075693 X:89389671-89389693 CAAGATAAGCAAATTACTAAAGG + Intergenic
1194712915 X:97257270-97257292 AAGGCTAAGGGATTCACTAATGG + Intronic
1194723465 X:97367671-97367693 GAAACTAAGGAATTCTCTATCGG + Intronic
1194748015 X:97650958-97650980 GAAGCTAAGAAAATACTTAAAGG - Intergenic
1194757828 X:97758493-97758515 GCAGCTGAGGCAATCACTGAAGG - Intergenic
1194821058 X:98507988-98508010 GAAGTTAAGCAAACCACTAAAGG - Intergenic
1195332273 X:103812889-103812911 GAAGTTAAGCAAATTGCTAAAGG - Intergenic
1195929842 X:110063564-110063586 GATGCTTAGGAAAGAACTAAAGG + Intronic
1196062496 X:111426076-111426098 GAAGCTAATGAAATAATTACAGG + Intergenic
1198603439 X:138310429-138310451 TAGGCTAAGGAAACAACTAAGGG + Intergenic
1200731294 Y:6743826-6743848 CAAGATAAGCAAATTACTAAAGG + Intergenic
1200833218 Y:7707693-7707715 GAAATTAAGGAAATAATTAATGG - Intergenic