ID: 1189015757

View in Genome Browser
Species Human (GRCh38)
Location X:37094891-37094913
Sequence TGAAGCTAAGGAAATCACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189015757_1189015760 0 Left 1189015757 X:37094891-37094913 CCTTAGTGATTTCCTTAGCTTCA 0: 2
1: 0
2: 1
3: 19
4: 205
Right 1189015760 X:37094914-37094936 ACTCTTAGAAGTGGAATTTCTGG No data
1189015757_1189015762 8 Left 1189015757 X:37094891-37094913 CCTTAGTGATTTCCTTAGCTTCA 0: 2
1: 0
2: 1
3: 19
4: 205
Right 1189015762 X:37094922-37094944 AAGTGGAATTTCTGGGTCAAAGG 0: 9
1: 37
2: 244
3: 755
4: 1897
1189015757_1189015759 -9 Left 1189015757 X:37094891-37094913 CCTTAGTGATTTCCTTAGCTTCA 0: 2
1: 0
2: 1
3: 19
4: 205
Right 1189015759 X:37094905-37094927 TTAGCTTCAACTCTTAGAAGTGG No data
1189015757_1189015761 1 Left 1189015757 X:37094891-37094913 CCTTAGTGATTTCCTTAGCTTCA 0: 2
1: 0
2: 1
3: 19
4: 205
Right 1189015761 X:37094915-37094937 CTCTTAGAAGTGGAATTTCTGGG No data
1189015757_1189015763 9 Left 1189015757 X:37094891-37094913 CCTTAGTGATTTCCTTAGCTTCA 0: 2
1: 0
2: 1
3: 19
4: 205
Right 1189015763 X:37094923-37094945 AGTGGAATTTCTGGGTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189015757 Original CRISPR TGAAGCTAAGGAAATCACTA AGG (reversed) Intergenic
905778505 1:40686974-40686996 TGATGCTATGGAAAACAGTATGG + Intergenic
909107884 1:71435454-71435476 TGCTGTTAAGGAAATCACTAAGG + Intronic
909109758 1:71459825-71459847 AAAGGATAAGGAAATCACTATGG - Intronic
913232621 1:116754168-116754190 AGAGGCTAAGTAGATCACTAAGG - Intergenic
913466621 1:119149575-119149597 TGATTCTAAGGAAATCACAAGGG - Intergenic
915567917 1:156726823-156726845 TTCAGCAAAGGATATCACTATGG - Intronic
915987864 1:160484310-160484332 TGAAGCTCAGGAAATCTCACTGG - Intergenic
916804157 1:168242557-168242579 TGAAGCTTTGGAAGGCACTATGG + Exonic
918994256 1:191735843-191735865 AGAAGCTATGGAAAACAGTATGG - Intergenic
919127166 1:193408974-193408996 TGAATCTAAGGAATTTATTAGGG + Intergenic
921397899 1:214688453-214688475 AGATGCTGAGGAAATCACTATGG - Intergenic
921563416 1:216686384-216686406 TCAAGCCATGGAAATGACTAAGG + Intronic
922309810 1:224377902-224377924 TGAGGCTAAGCAAATCAGAAAGG + Exonic
923456147 1:234167325-234167347 AGAAGCCAAGGAAATGCCTAAGG + Intronic
924375574 1:243404387-243404409 TGAAGCAGAGGAAATAATTAAGG + Intronic
924674790 1:246164949-246164971 TGAAGCTACAGGAATCAGTAAGG + Intronic
1065543809 10:26798317-26798339 TGAATCAAATGAAATCACGAGGG + Intronic
1069118875 10:64543453-64543475 TGAAGATATGGAAATGGCTAAGG + Intergenic
1071225976 10:83527616-83527638 TGCAGCTGAAGAAATCATTAGGG + Intergenic
1071395825 10:85223217-85223239 TAAAGCAAAGGAAATCAGTTTGG - Intergenic
1072074214 10:91952565-91952587 TGAAGCAAAGGAAAAGACCAGGG - Intronic
1073917074 10:108417902-108417924 TGTAGTTAAGGAAAACAGTATGG + Intergenic
1075196196 10:120361335-120361357 TCCAGCTAAGGAAACCACGATGG - Intergenic
1075350805 10:121723431-121723453 TGAAGCTAAAGATATCAGTAAGG + Intergenic
1081763911 11:45595934-45595956 TGGAGCTTAGGAAATCAGGAAGG + Intergenic
1081949611 11:47032655-47032677 AGAAGTTCAGGAAATCTCTATGG - Intronic
1082893802 11:58168450-58168472 TGAAGCTACGTATATCAATATGG - Intronic
1083715500 11:64573016-64573038 TGAAGCTAAAGTAATGATTATGG + Intergenic
1086205060 11:84248365-84248387 AGAAGCTAAGAAAATCTCTGAGG + Intronic
1086242906 11:84717756-84717778 TGAAGCTATGAAAATAATTAAGG + Intronic
1086536681 11:87855333-87855355 TGAAGAAAAGGAGATCACCATGG - Intergenic
1088399802 11:109410999-109411021 TGAAGCAAAACAAAACACTATGG - Intergenic
1090815500 11:130290551-130290573 TGAAGGCAAGGAAATCAATCAGG - Intronic
1092210056 12:6640083-6640105 GGAAGCTAAGGAACTCAGTCTGG + Exonic
1095389283 12:41686730-41686752 TGAACCCAAGGAAGGCACTAGGG - Intergenic
1096545339 12:52335170-52335192 AGAAGCAAAGGAAAGCACTCGGG + Intergenic
1097327353 12:58292280-58292302 TGAAGCTAAGCAGATAAATAGGG - Intergenic
1098742998 12:74199319-74199341 TGAAGCTAAAGAAATCAAGATGG - Intergenic
1099709726 12:86208022-86208044 TCAAGCTTAGGAAAACATTAAGG - Intronic
1100486710 12:95036220-95036242 TGTAGTTAAGGTTATCACTAAGG + Intronic
1101543544 12:105687025-105687047 TGGAGCAAAGGAAATTACCAGGG - Intergenic
1105284068 13:18990298-18990320 AGAAGCTACGGAAGACACTAAGG + Intergenic
1105595653 13:21835364-21835386 TCAAGAAAAGGAAATCACTTTGG + Intergenic
1107807033 13:44163084-44163106 TGAAGCCAAGGAAATGGCTAGGG - Intergenic
1108691378 13:52862235-52862257 GGAAGCTGAGGAGATAACTAGGG + Intergenic
1109349973 13:61167097-61167119 TGAAACTGATAAAATCACTATGG + Intergenic
1109627987 13:65002827-65002849 CGAAGTTAAGGGAATCTCTAGGG + Intergenic
1113008237 13:105732726-105732748 TGAAGCTAATGAATTATCTATGG - Intergenic
1113077242 13:106479247-106479269 TGAAACTGAGGAAAACAATAAGG + Intergenic
1113178752 13:107600132-107600154 TGTAGGTAAGAAAATCACCATGG + Intronic
1115846099 14:37536839-37536861 TGAAGCTTAGAAAATTATTATGG - Intronic
1117703298 14:58437238-58437260 TGAGGGTAAGGAAGGCACTAAGG + Intronic
1117858785 14:60066473-60066495 TGAAGCTAACCAAATCATTTTGG + Intergenic
1119058050 14:71443789-71443811 AGAAATAAAGGAAATCACTAGGG + Intronic
1119900129 14:78252485-78252507 TGTAGCTAAGAAAATGACTCTGG + Intronic
1120296350 14:82646747-82646769 TTATGCCAAGGAAATCACTCTGG - Intergenic
1120850465 14:89164670-89164692 TGAAGCTTGGGAAATGACTGTGG + Intronic
1121353898 14:93196982-93197004 TGCAGCTATGGAAAACACTAAGG - Intronic
1121697218 14:95923603-95923625 TAAAACTAAGGAAAGCTCTATGG - Intergenic
1122877065 14:104672579-104672601 TAAATCTAAGGAGATCATTAAGG + Intergenic
1126221830 15:46223195-46223217 TGATGCCAAGGAAATAACTAAGG - Intergenic
1127812922 15:62580093-62580115 TGAAGCCAAGGAACTCCCTGTGG - Intronic
1131094718 15:89648088-89648110 TGAAGTTAAGGAAGTGACCACGG + Intronic
1131492443 15:92874733-92874755 AGCAGCTATGGAAAACACTATGG - Intergenic
1133620847 16:7524843-7524865 TGAAGCTGATGGAATCACTAAGG + Intronic
1134478950 16:14601042-14601064 AGCAGCTAAGGAAAACAGTATGG + Intronic
1134848257 16:17459651-17459673 TGCAGCGAAGGAAACCATTAGGG - Intronic
1136185149 16:28583769-28583791 CGAAGCTACGGTAATCACGATGG - Intronic
1136934829 16:34451145-34451167 TGAATCTAATGGAATCACCATGG + Intergenic
1136944247 16:34627905-34627927 TGAATCTAATGGAATCACCATGG - Intergenic
1136947229 16:34667468-34667490 TGAATCTAATGGAATCACCATGG - Intergenic
1136969743 16:34960669-34960691 TGAATCTAATGGAATCACCATGG - Intergenic
1137087039 16:36138744-36138766 TGAATCTAATGGAATCACCATGG - Intergenic
1138181027 16:54940136-54940158 AGCAGCTAAGGAAAGCACTCAGG - Intergenic
1140629921 16:76839108-76839130 GGAAGCTAATGAAATCTCTCAGG - Intergenic
1141263357 16:82473814-82473836 TGAACCTAATGTAATCACAAGGG - Intergenic
1146116690 17:30147037-30147059 AGAAGCTTAGGATATCACTTAGG - Intronic
1147239659 17:39082264-39082286 AGAGGCAAAGGAAATCACTGGGG + Intronic
1148401543 17:47366631-47366653 TGAAACTAAGGCAATCAATATGG - Intronic
1148597223 17:48866478-48866500 AGCAGCTAAGGAAAGCACTGGGG - Intronic
1149136080 17:53366256-53366278 TGAAGTTAAGGAAAACAAAAGGG - Intergenic
1154236681 18:12612459-12612481 TGAAACTATTGAAATCACCAAGG - Intronic
1159682021 18:71366869-71366891 GGAAGCCACGGATATCACTAAGG - Intergenic
1159810219 18:73010026-73010048 TAAGGCTAAGAATATCACTAAGG + Intergenic
1159866011 18:73705958-73705980 TGAAGTTCAGGAAACCAATAAGG + Intergenic
1159999677 18:75004816-75004838 GGTAGCTAAGGAAAGCACTTGGG - Intronic
1161653102 19:5497326-5497348 TTAAGCTTAGGAAATCAGGAGGG + Intergenic
1163690924 19:18737867-18737889 TGATACTAAGAAAATCATTAAGG - Intronic
1166423223 19:42654198-42654220 AGGAGCTGAGGAAATCACCATGG - Intronic
1167567962 19:50268702-50268724 TGAAGCTGAGGACATCACTTAGG - Intronic
1167567976 19:50268788-50268810 TGAAGCTAAGGACATCACTTGGG - Intronic
1168521926 19:57058188-57058210 TGAAGCTATAGAATACACTAGGG + Intergenic
925816539 2:7756847-7756869 TGAAGCAAAGGAAGTAATTAAGG - Intergenic
926342008 2:11911432-11911454 TGAAACTAGGGAAATAACTAGGG + Intergenic
927970481 2:27303075-27303097 AGAAGCAAAGGAAATCAGTGGGG + Intronic
928256203 2:29725118-29725140 TGAAGGTAACCAAATCCCTAAGG - Intronic
929046902 2:37798958-37798980 TGAAGATAAACAAATCCCTAAGG - Intergenic
931046013 2:58353902-58353924 TGAAAAGAAGGAAATCAGTAAGG + Intergenic
931062610 2:58547961-58547983 TGAAGCAAAAGAAAGCTCTATGG + Intergenic
931243375 2:60472087-60472109 TTAAGCTTAGGGAATCCCTAAGG + Intronic
935357145 2:102212189-102212211 TGAAGCCATTGAAATCACCAGGG + Intronic
937506731 2:122546093-122546115 TGTAGCTAATCAAATCACTGGGG + Intergenic
940129635 2:150366380-150366402 TGAAAATATAGAAATCACTAAGG - Intergenic
943799175 2:192036271-192036293 TGAAGCAAGGGAAATTGCTATGG + Intronic
948630142 2:239297178-239297200 TGAAGACAAGGCAATCACAAAGG + Intronic
948743563 2:240067195-240067217 TAGAGCTCAGGAAACCACTAAGG + Intergenic
948748358 2:240111778-240111800 TGAAACCAAGGAAAGCTCTATGG - Intergenic
1168905319 20:1398817-1398839 TGTAACAAAGGAAATCACTGGGG + Intergenic
1170345364 20:15380398-15380420 TGAAGATTAGGAAATAACTTAGG + Intronic
1170637571 20:18121783-18121805 TGAAGGTGACTAAATCACTAGGG + Intergenic
1170698568 20:18682836-18682858 TGAACCTATGAAAACCACTATGG - Intronic
1172325631 20:34032263-34032285 TAAAGCTAAGAAAGTCTCTACGG - Intronic
1173031361 20:39364075-39364097 GGAAGCAAAGTAACTCACTATGG + Intergenic
1178414027 21:32389321-32389343 TGAAGCAATGGAAATGACTTTGG + Intronic
1179305862 21:40153567-40153589 TGAAGCTAGGGACATATCTACGG + Intronic
1179429959 21:41314853-41314875 TGCAGCTATGGAAAACAGTATGG + Intronic
1181386988 22:22553533-22553555 TAAAGCCAAGGTAATCACTGAGG + Intronic
1182782227 22:32877348-32877370 AGCAGCTAAGGAACTCACCAAGG + Intronic
1182887737 22:33789682-33789704 GGAATCAAAGGAAATCACTTCGG + Intronic
1183183125 22:36274920-36274942 GGAAGCTGAGGAAATCATGAAGG + Intergenic
1203327403 22_KI270738v1_random:39024-39046 TGAATCTAATGGAATCACCATGG + Intergenic
949270460 3:2210445-2210467 TGAAGGTAAGGAGACCATTAAGG - Intronic
949739773 3:7218130-7218152 TGAAGCTAAAGAAATCATCTGGG - Intronic
952013080 3:28923966-28923988 TGAGGCTAAGCAAAGAACTAGGG + Intergenic
952020494 3:29013279-29013301 TGATTCTAAAGAAATCTCTAAGG + Intergenic
952398788 3:32944815-32944837 TGAAACTGAGGAAAGCAATAAGG - Intergenic
953399184 3:42597993-42598015 TGCAGCTATGGAAAACAGTATGG + Intronic
955151531 3:56371923-56371945 AGAAGCCTAGGAAAGCACTAAGG + Intronic
956120812 3:65964200-65964222 TGACGCTAAGGTAATTACTGGGG - Intronic
957258631 3:77871597-77871619 TGAAGCCAAGGTAAACACTGAGG + Intergenic
957625276 3:82647018-82647040 TGAGTCAAAGGAAATCACTTTGG + Intergenic
958686587 3:97406135-97406157 AGAAGCAAAGGAAATCATAAAGG + Intronic
959537111 3:107499114-107499136 GGAAGCTAAGGAAATCAGAAGGG - Intergenic
959688093 3:109169490-109169512 TGCAGGTAAGCAAATCACTTGGG - Intergenic
960611707 3:119560518-119560540 TGAAGCTTTGGAAATCATGAAGG + Intergenic
962065181 3:131972199-131972221 TGAAGCCAATGAAAATACTAAGG + Intronic
963728982 3:148952571-148952593 TTATCCTAAGGAAATAACTATGG - Intergenic
963884054 3:150561086-150561108 AGCAGCTAGGGAAATCAGTAAGG - Intronic
964592940 3:158386578-158386600 TGAAACTAAGGACCTCAATATGG + Intronic
966448695 3:180033045-180033067 TGAACCTAAATAAATCACCAGGG + Intronic
967399326 3:189043039-189043061 TAAAGCAAAGGAGAACACTATGG + Intronic
967649075 3:191963352-191963374 TTATGCTAAGGAAATGACTCAGG - Intergenic
968107328 3:196010618-196010640 TGAAGCAAACAAAATCACCAGGG + Intergenic
970831853 4:20348921-20348943 TGAATCTAAACAAATCACTGTGG + Intronic
971551077 4:27956111-27956133 TGAATCTAATGTAATCACAAGGG + Intergenic
974020730 4:56689829-56689851 TAAAGGAAAGGAAATGACTAGGG + Intergenic
974258216 4:59489390-59489412 TCAAGCTAAGGAAAACATTAAGG + Intergenic
974701525 4:65454514-65454536 TGAATCTATGGAAATCTCTGTGG - Intronic
976102288 4:81578540-81578562 TGAAGCTAAGGAAAACATTTTGG + Intronic
978070786 4:104465624-104465646 TGAAGATAAAGAAAGCATTAGGG + Intergenic
978108052 4:104928772-104928794 TGCATATAAGGAAACCACTATGG + Intergenic
979105275 4:116678250-116678272 TGAAGGTATAGAAATGACTATGG + Intergenic
979297366 4:119048992-119049014 TGAAACTAGGGAAATCAATTAGG + Intronic
980281037 4:130720118-130720140 GGAAGCTAAGTAATTCTCTAGGG - Intergenic
982711775 4:158765308-158765330 TGAAGGGAAGGAAATCTATAAGG + Intergenic
983318949 4:166169976-166169998 TGAAGATAATGAATTCAATAAGG - Intergenic
985382987 4:189414862-189414884 TGAAGCTAAGAAAATCCTAATGG - Intergenic
987671176 5:21011366-21011388 TGAAGTTTAGGAAACCATTATGG + Intergenic
987760164 5:22151345-22151367 TGAAGTAAAGGAACTCACTTTGG + Intronic
988066708 5:26234263-26234285 TGAAGCAAACAAAATCACCAGGG + Intergenic
994120034 5:96102925-96102947 TGGAGATAAGAAAATAACTATGG + Intergenic
995874112 5:116772466-116772488 TGCAGATAAGAAAATCACTCTGG - Intergenic
998878531 5:146624384-146624406 TGAAGTAAAGGAAAGCACCAAGG - Intronic
998911601 5:146966259-146966281 TGCAGGTAAGGAAATCACGGAGG + Intronic
1002489803 5:179567105-179567127 TGAAGCTTATAAAATCTCTAAGG - Intronic
1004201379 6:13551309-13551331 TGAAGGAAAGGAAATTAATAAGG - Intergenic
1004251386 6:14025755-14025777 TGAAGCTGCAGAAATCACGAAGG - Intergenic
1005610614 6:27520405-27520427 TCAAACTAAGGAAAGCACTTTGG - Intergenic
1007158857 6:39772634-39772656 TGAAGATAGACAAATCACTATGG - Intergenic
1007641298 6:43342070-43342092 TGAATGTAAGGAAACCACAAAGG + Intronic
1008157878 6:48039228-48039250 TAAGGCTAAGCAAATCAATATGG + Intronic
1008887855 6:56450602-56450624 TGAAGCAAAGGAAATAAGCATGG - Intergenic
1009656976 6:66559787-66559809 AGAAGATACGGAAATCACTATGG + Intergenic
1015018794 6:128446794-128446816 TAAAACTAAGGAAAACAGTAGGG + Intronic
1015772223 6:136780875-136780897 TGAAGCTAAGGGAAGCAGTCAGG - Intronic
1018595324 6:165473681-165473703 TGAAGCAAAGGAAAACACTGTGG + Intronic
1020879398 7:13740122-13740144 TGAAAATAAGAAAATCAATATGG - Intergenic
1021209211 7:17824578-17824600 GGAAGTTAAGGAACTCACTCAGG + Intronic
1023415787 7:39931015-39931037 TGAAAGAAAGGAAATCAATAAGG + Intergenic
1024857466 7:53798036-53798058 TTAAGCCAAGGGAATCACGATGG + Intergenic
1026002953 7:66577016-66577038 TGAAGATAATGGAATCACTCAGG - Intergenic
1026384427 7:69832035-69832057 TGAACCTATGGTAATCCCTAAGG + Intronic
1029462377 7:100703438-100703460 TGAAGTAAAGGAAAGAACTATGG + Intergenic
1030917800 7:115338644-115338666 TGAAGATTAAGAAATGACTATGG + Intergenic
1032517279 7:132516436-132516458 TGCAGCAAAGGAAATCAGTATGG + Intronic
1034191848 7:149219183-149219205 TTAAGCTAAGGAGATGACAAAGG - Intronic
1035988415 8:4460244-4460266 AGGAGTTAAAGAAATCACTAGGG + Intronic
1037233583 8:16689573-16689595 TGAACATAAGCAAATCATTAGGG + Intergenic
1037460572 8:19104354-19104376 GGAAGCTGAAGAAATGACTAAGG + Intergenic
1037846149 8:22283825-22283847 TGAAGATAAGGAAATAATTTAGG + Intronic
1038763175 8:30403652-30403674 TGAAGCTAAGGAAATCACTAAGG - Intronic
1038776716 8:30538071-30538093 TGAAGCAATGGAAATGACCAAGG + Intronic
1039031440 8:33313922-33313944 TAAAGCTAATGAAATCAAGAGGG - Intergenic
1039269886 8:35869145-35869167 TGAATCAAAGGAAAACACCAAGG + Intergenic
1040004392 8:42607244-42607266 TGAAACTAAGCAAACCACCATGG - Intergenic
1040873480 8:52125199-52125221 TGACACTAAGGAAATATCTAGGG + Intronic
1041599067 8:59694190-59694212 TGAGGCTAAGGAAATAATTCTGG - Intergenic
1042085192 8:65099829-65099851 TTAAGCTAAATAAATCACCAGGG + Intergenic
1042941509 8:74113376-74113398 TGAAACACAGGAATTCACTAGGG - Intergenic
1042990185 8:74630575-74630597 TGATGATAAGGAACTCTCTAGGG + Intronic
1043969391 8:86513525-86513547 TGCAGCTAAACAAAACACTATGG - Intronic
1046618840 8:116506366-116506388 TGAAGATATGGAGACCACTACGG + Intergenic
1047640740 8:126819115-126819137 TGAAGAAAAGGAAGACACTAAGG - Intergenic
1047806422 8:128365604-128365626 TGAAGCTATTGACACCACTAAGG - Intergenic
1048404793 8:134108295-134108317 GGTAGCTAAGGAAATCCCTCAGG + Intergenic
1048784482 8:138035797-138035819 TTAAGCTAAGGCAATCTCTTTGG - Intergenic
1049549006 8:143247751-143247773 TGAGGCCAAGAAAATCGCTATGG + Intronic
1050063501 9:1734842-1734864 TGAAGCTGAAGAAATCCCTGAGG + Intergenic
1050296678 9:4212287-4212309 TGAAGCTGAAGACATCACTGTGG - Intronic
1051795472 9:20864257-20864279 TTAAGCTAATGAAGTTACTAGGG - Intronic
1052197788 9:25738686-25738708 TCAAACTGAGGAAATCATTAAGG + Intergenic
1053622470 9:39834072-39834094 TGAAACTAATAAAATCACTGAGG + Intergenic
1053890279 9:42685282-42685304 TGAAACTAATAAAATCACTGAGG + Intergenic
1054797599 9:69317026-69317048 TGCAGCTTAGGATATAACTAAGG - Intergenic
1054953357 9:70879346-70879368 TGAAGCTATGGAAATAAGAAAGG - Intronic
1056632106 9:88302442-88302464 TGGTTCTATGGAAATCACTATGG - Intergenic
1056729375 9:89152059-89152081 TGAAGCTACTCAAATCACTAGGG - Intronic
1059078071 9:111216270-111216292 TGAAGTTAATGAAATCAAGATGG - Intergenic
1059391354 9:114001480-114001502 TGCATCTAAGGAAATTACCAAGG + Intronic
1186352413 X:8753684-8753706 TGAAGGAAGGGAAATCACGAGGG - Intergenic
1187974896 X:24695058-24695080 TGAACATCAGGAAATCACTTTGG + Intronic
1188943004 X:36263487-36263509 GGAAGGTAAGCAAATAACTATGG - Intronic
1189015757 X:37094891-37094913 TGAAGCTAAGGAAATCACTAAGG - Intergenic
1189198783 X:39174229-39174251 TGGAGGTGAGGACATCACTAAGG + Intergenic
1191201836 X:57791706-57791728 TGAATCAAGGGAAAACACTAAGG + Intergenic
1197510958 X:127368610-127368632 TGGAGATAAGGAAGTTACTAGGG - Intergenic
1198430248 X:136558434-136558456 TTAAGCTAGGGAAATAATTAGGG - Intergenic