ID: 1189015759

View in Genome Browser
Species Human (GRCh38)
Location X:37094905-37094927
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189015755_1189015759 14 Left 1189015755 X:37094868-37094890 CCTAGCTAAATCTGTGTATACAC 0: 2
1: 0
2: 0
3: 12
4: 141
Right 1189015759 X:37094905-37094927 TTAGCTTCAACTCTTAGAAGTGG No data
1189015756_1189015759 -8 Left 1189015756 X:37094890-37094912 CCCTTAGTGATTTCCTTAGCTTC 0: 2
1: 0
2: 0
3: 21
4: 228
Right 1189015759 X:37094905-37094927 TTAGCTTCAACTCTTAGAAGTGG No data
1189015757_1189015759 -9 Left 1189015757 X:37094891-37094913 CCTTAGTGATTTCCTTAGCTTCA 0: 2
1: 0
2: 1
3: 19
4: 205
Right 1189015759 X:37094905-37094927 TTAGCTTCAACTCTTAGAAGTGG No data
1189015754_1189015759 17 Left 1189015754 X:37094865-37094887 CCTCCTAGCTAAATCTGTGTATA 0: 2
1: 0
2: 0
3: 12
4: 134
Right 1189015759 X:37094905-37094927 TTAGCTTCAACTCTTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189015759 Original CRISPR TTAGCTTCAACTCTTAGAAG TGG Intergenic
No off target data available for this crispr