ID: 1189017213

View in Genome Browser
Species Human (GRCh38)
Location X:37296765-37296787
Sequence GGCCTCCCCAGAAGCTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189017213_1189017219 14 Left 1189017213 X:37296765-37296787 CCTGCTCAGCTTCTGGGGAGGCC No data
Right 1189017219 X:37296802-37296824 ATCATGGCAGAAGGCAAAGAGGG 0: 57
1: 641
2: 1376
3: 2520
4: 3515
1189017213_1189017217 5 Left 1189017213 X:37296765-37296787 CCTGCTCAGCTTCTGGGGAGGCC No data
Right 1189017217 X:37296793-37296815 ACATTTTCAATCATGGCAGAAGG No data
1189017213_1189017220 21 Left 1189017213 X:37296765-37296787 CCTGCTCAGCTTCTGGGGAGGCC No data
Right 1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG No data
1189017213_1189017218 13 Left 1189017213 X:37296765-37296787 CCTGCTCAGCTTCTGGGGAGGCC No data
Right 1189017218 X:37296801-37296823 AATCATGGCAGAAGGCAAAGAGG 0: 890
1: 2562
2: 4481
3: 5642
4: 5429
1189017213_1189017216 -2 Left 1189017213 X:37296765-37296787 CCTGCTCAGCTTCTGGGGAGGCC No data
Right 1189017216 X:37296786-37296808 CCTCAGGACATTTTCAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189017213 Original CRISPR GGCCTCCCCAGAAGCTGAGC AGG (reversed) Intergenic
No off target data available for this crispr