ID: 1189017215

View in Genome Browser
Species Human (GRCh38)
Location X:37296786-37296808
Sequence CCATGATTGAAAATGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189017215_1189017222 16 Left 1189017215 X:37296786-37296808 CCTCAGGACATTTTCAATCATGG No data
Right 1189017222 X:37296825-37296847 AGCAAGGCATCTCACATGGCAGG No data
1189017215_1189017218 -8 Left 1189017215 X:37296786-37296808 CCTCAGGACATTTTCAATCATGG No data
Right 1189017218 X:37296801-37296823 AATCATGGCAGAAGGCAAAGAGG 0: 890
1: 2562
2: 4481
3: 5642
4: 5429
1189017215_1189017221 12 Left 1189017215 X:37296786-37296808 CCTCAGGACATTTTCAATCATGG No data
Right 1189017221 X:37296821-37296843 AGGGAGCAAGGCATCTCACATGG No data
1189017215_1189017220 0 Left 1189017215 X:37296786-37296808 CCTCAGGACATTTTCAATCATGG No data
Right 1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG No data
1189017215_1189017219 -7 Left 1189017215 X:37296786-37296808 CCTCAGGACATTTTCAATCATGG No data
Right 1189017219 X:37296802-37296824 ATCATGGCAGAAGGCAAAGAGGG 0: 57
1: 641
2: 1376
3: 2520
4: 3515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189017215 Original CRISPR CCATGATTGAAAATGTCCTG AGG (reversed) Intergenic
No off target data available for this crispr