ID: 1189017220

View in Genome Browser
Species Human (GRCh38)
Location X:37296809-37296831
Sequence CAGAAGGCAAAGAGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189017215_1189017220 0 Left 1189017215 X:37296786-37296808 CCTCAGGACATTTTCAATCATGG No data
Right 1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG No data
1189017213_1189017220 21 Left 1189017213 X:37296765-37296787 CCTGCTCAGCTTCTGGGGAGGCC No data
Right 1189017220 X:37296809-37296831 CAGAAGGCAAAGAGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189017220 Original CRISPR CAGAAGGCAAAGAGGGAGCA AGG Intergenic
No off target data available for this crispr