ID: 1189018616

View in Genome Browser
Species Human (GRCh38)
Location X:37310623-37310645
Sequence AGCACGAATACTTCCAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189018616_1189018618 5 Left 1189018616 X:37310623-37310645 CCAGTACTGGAAGTATTCGTGCT No data
Right 1189018618 X:37310651-37310673 ATGAACATTTATCTGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189018616 Original CRISPR AGCACGAATACTTCCAGTAC TGG (reversed) Intergenic
No off target data available for this crispr