ID: 1189021835

View in Genome Browser
Species Human (GRCh38)
Location X:37349441-37349463
Sequence CCTTCCTGGGGCGCTTCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189021835_1189021843 -9 Left 1189021835 X:37349441-37349463 CCAGGCGAAGCGCCCCAGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1189021843 X:37349455-37349477 CCAGGAAGGATTGGGGTGTGTGG 0: 1
1: 1
2: 2
3: 47
4: 422
1189021835_1189021844 -8 Left 1189021835 X:37349441-37349463 CCAGGCGAAGCGCCCCAGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1189021844 X:37349456-37349478 CAGGAAGGATTGGGGTGTGTGGG 0: 1
1: 0
2: 0
3: 28
4: 326
1189021835_1189021847 3 Left 1189021835 X:37349441-37349463 CCAGGCGAAGCGCCCCAGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1189021847 X:37349467-37349489 GGGGTGTGTGGGGGTGACTTCGG 0: 1
1: 0
2: 6
3: 58
4: 548
1189021835_1189021845 -7 Left 1189021835 X:37349441-37349463 CCAGGCGAAGCGCCCCAGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1189021845 X:37349457-37349479 AGGAAGGATTGGGGTGTGTGGGG 0: 1
1: 0
2: 4
3: 46
4: 577
1189021835_1189021848 13 Left 1189021835 X:37349441-37349463 CCAGGCGAAGCGCCCCAGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1189021848 X:37349477-37349499 GGGGTGACTTCGGTTCTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
1189021835_1189021846 -6 Left 1189021835 X:37349441-37349463 CCAGGCGAAGCGCCCCAGGAAGG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1189021846 X:37349458-37349480 GGAAGGATTGGGGTGTGTGGGGG 0: 1
1: 0
2: 7
3: 68
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189021835 Original CRISPR CCTTCCTGGGGCGCTTCGCC TGG (reversed) Exonic