ID: 1189026218

View in Genome Browser
Species Human (GRCh38)
Location X:37397694-37397716
Sequence CCAGTTCAAAACATATTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189026218 Original CRISPR CCAGTTCAAAACATATTTAA GGG Intronic
901662861 1:10809610-10809632 CCAGCTCAGATCAAATTTAAAGG - Intergenic
901894801 1:12301773-12301795 CCCGTTCTAAAGCTATTTAAGGG + Intronic
902970922 1:20049001-20049023 CGAATTCAAAGCTTATTTAAAGG + Intronic
903784620 1:25850991-25851013 CCAGTTAACATCATACTTAATGG - Intronic
904511020 1:31007990-31008012 GCAGTTGAAAACATAATTAGAGG - Intronic
906098424 1:43239997-43240019 TCAATTCAATACATATTTATTGG - Intronic
906564146 1:46785092-46785114 CTAATTCAAAGCTTATTTAAAGG - Intronic
908096069 1:60740172-60740194 CAAGTTCAACACAGATATAAAGG - Intergenic
908808212 1:67952458-67952480 CCCTTTCAAAATATTTTTAATGG + Intergenic
908953946 1:69598268-69598290 CCAGATCAAAACATACTTTCTGG - Intronic
909854339 1:80509197-80509219 CCAATTCAAATTATACTTAAGGG - Intergenic
910893004 1:92037514-92037536 TCAGCTCAAAATATTTTTAAAGG - Intronic
911114185 1:94227519-94227541 CCATTTTAAAATATATTTGAGGG - Intronic
911119743 1:94283857-94283879 CCATTTCCAAACATCTTTATCGG + Intergenic
911477347 1:98389826-98389848 CCAGTGCAAACTATATGTAATGG - Intergenic
912980985 1:114372148-114372170 CTAATTCAAAGCTTATTTAAAGG + Intergenic
913243650 1:116852433-116852455 CCAGTTCAGGACATCTCTAAAGG - Intergenic
915264522 1:154707223-154707245 CCAACTCAAAACACATGTAAGGG + Exonic
915652627 1:157328651-157328673 CTAATTCAAAGCTTATTTAAAGG + Intergenic
916549933 1:165840226-165840248 CTATTTAAAAACATTTTTAAAGG - Intronic
916624371 1:166538566-166538588 CTAATTCAAAGCTTATTTAAAGG - Intergenic
917095371 1:171394158-171394180 CCAGTTGGAAATATAATTAAGGG + Intergenic
917232153 1:172849569-172849591 CTAATTCAAAGCTTATTTAAAGG - Intergenic
917508227 1:175648411-175648433 TCAGTTTAAAACATCTTAAAAGG + Intronic
918738021 1:188091468-188091490 CAAATTCAATAGATATTTAAAGG - Intergenic
918919309 1:190687184-190687206 TCAGTTCACAACATATTCACTGG + Intergenic
918949576 1:191119440-191119462 TCATTTCAAAAAATATTTAGGGG + Intergenic
919421338 1:197373784-197373806 CCAGTAGTAAACATATTCAATGG - Intronic
921086163 1:211795200-211795222 ACAATTAAAAACATTTTTAAGGG + Intronic
922417771 1:225437179-225437201 TCTGTTTAAAACACATTTAAGGG + Intergenic
923791841 1:237118125-237118147 CCATTTCAAAAGAAATTGAAGGG + Intronic
923912947 1:238470063-238470085 GCATTTCAAATAATATTTAATGG + Intergenic
1062787675 10:278776-278798 ACAGTTTAAAGGATATTTAATGG + Intronic
1063888664 10:10606185-10606207 CAAGTTAGAAACACATTTAATGG + Intergenic
1064060580 10:12133075-12133097 CCATTTCAAATGATATGTAAAGG - Intronic
1064576591 10:16752127-16752149 CCAGGTCAATAAAAATTTAAGGG + Intronic
1064943843 10:20766317-20766339 CAAGTTCAAAAAAAATTTTACGG + Intergenic
1065528057 10:26642425-26642447 GCAGTTCACAATATATTTACTGG + Intergenic
1065559168 10:26945060-26945082 GCAGTTCACAATATATTTACTGG - Intergenic
1065605106 10:27410424-27410446 CCAATCCAAAACGTATTAAAAGG + Intronic
1065994648 10:31046498-31046520 CTAGCCCAAAACATATTTCAAGG - Intergenic
1066253728 10:33658399-33658421 GCCGTTAAAAACATAATTAATGG + Intergenic
1066990136 10:42505378-42505400 TCATTTCAATAAATATTTAAGGG - Intergenic
1067970962 10:50970234-50970256 CCAGTTGATAAGATATATAAAGG - Intergenic
1068269467 10:54701412-54701434 CCAGCTAAAAACATGATTAAAGG + Intronic
1069674140 10:70235081-70235103 CAAGTTCAAAGAATATTTTAAGG + Intergenic
1071895924 10:90066914-90066936 CTAGTTCCAAAAAGATTTAAAGG - Intergenic
1072042399 10:91620899-91620921 CCAGTACAAAACATCTAAAAAGG - Intergenic
1072260780 10:93669609-93669631 GCAATTGAAAAGATATTTAAAGG + Exonic
1072917964 10:99551602-99551624 TCAGTTCAAAAAATATTCATGGG + Intergenic
1073704629 10:105969329-105969351 CCAGATCATAACAAATTGAAAGG + Intergenic
1073738311 10:106376732-106376754 CTAATTCAAAGCCTATTTAAAGG + Intergenic
1074025864 10:109633812-109633834 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1074073370 10:110096744-110096766 CAAGTCCAAACCAGATTTAAGGG + Intronic
1074244822 10:111678725-111678747 TCAGTTCAGACCATATTTTATGG + Intergenic
1074805658 10:117048848-117048870 CCTCTTTAAAATATATTTAATGG + Intronic
1075361526 10:121840139-121840161 GCAGCACAAAACATTTTTAATGG - Intronic
1076575925 10:131467850-131467872 ACAGTTAACATCATATTTAATGG - Intergenic
1076594069 10:131614189-131614211 CCAATTAAAAACATAGTGAAAGG - Intergenic
1077737841 11:4809978-4810000 TCAGATCAAGGCATATTTAAAGG + Intronic
1078110342 11:8387000-8387022 TCGGTTAAAAACATATTCAAAGG + Intergenic
1078394726 11:10970841-10970863 ACTGTTCAAAGAATATTTAATGG - Intergenic
1079420491 11:20282442-20282464 CTAGTTTAAAAGTTATTTAAAGG - Intergenic
1080323864 11:31047834-31047856 GCAGTGCACAACTTATTTAAAGG + Intronic
1081212065 11:40347907-40347929 CCATTTGAAAACATTTTAAAGGG + Intronic
1082741393 11:56915150-56915172 CCTGTTCCTAAAATATTTAAAGG + Intergenic
1082746926 11:56973723-56973745 CCACTTCAAAACATACTATAAGG + Intergenic
1082942322 11:58720140-58720162 CCAATTCAAAGCTTATTTAAAGG - Intronic
1082950782 11:58813659-58813681 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1083358645 11:62088241-62088263 CAAATTCAAAGCTTATTTAAAGG + Intergenic
1086878498 11:92126694-92126716 CTAGTTTAAAACATATGTTATGG - Intergenic
1086924148 11:92622069-92622091 CCAGTTCACCACATTTTTTAAGG - Intronic
1087049886 11:93875592-93875614 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1092993791 12:13928425-13928447 CTAATTCAGAAGATATTTAAAGG + Intronic
1093298396 12:17420485-17420507 ACAGGTAACAACATATTTAATGG - Intergenic
1094467576 12:30769992-30770014 CCAGTTCCAAACTGGTTTAATGG + Intergenic
1094468001 12:30774547-30774569 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1095266477 12:40164462-40164484 CTAATTCAAATCTTATTTAAAGG - Intergenic
1095362966 12:41366483-41366505 CCAGTACACAATATATTTACAGG - Intronic
1095680813 12:44973206-44973228 CCAGTTCCAACCATACTTCAAGG + Intergenic
1095855712 12:46858777-46858799 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1096321150 12:50614162-50614184 CCAGTTAAGAACAGTTTTAAAGG - Intronic
1096765099 12:53880112-53880134 ACAGTTAACATCATATTTAATGG + Intergenic
1097252655 12:57645840-57645862 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1097404438 12:59173176-59173198 CTAATTCAAAACATACTGAAGGG - Intergenic
1097810851 12:64017298-64017320 CCAGTTAAAAACATATCTTATGG - Intronic
1097951159 12:65429513-65429535 TCAGTTCAAGAAATATTTGAAGG - Intronic
1098527941 12:71508321-71508343 ACAGTTTATAACATAGTTAAAGG - Intronic
1098666185 12:73166063-73166085 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1098775943 12:74617688-74617710 CCAATTCAAGACATTTCTAAAGG + Intergenic
1099023918 12:77442186-77442208 CCAGATCAAACCATACCTAAAGG - Intergenic
1100140383 12:91611544-91611566 CCAAATCAAAACATATTCAAAGG - Intergenic
1100357387 12:93844021-93844043 TCAGTTAAAAATAAATTTAAAGG - Intronic
1100466132 12:94847502-94847524 AAATTTCAAAACAAATTTAAAGG + Intergenic
1100932101 12:99620818-99620840 CAATGTGAAAACATATTTAAGGG + Intronic
1101189919 12:102322003-102322025 CCACTTCATCAAATATTTAAAGG - Intergenic
1101226501 12:102693155-102693177 CCAGTTTATAAAATATTTGAAGG + Intergenic
1101803152 12:108040169-108040191 CTCATTCAAAACATATTTATTGG + Intergenic
1102402367 12:112640564-112640586 TCAATTCAAAAAATATTTACTGG - Intronic
1105839466 13:24241458-24241480 CCAGTTCAAAACTAAGTAAATGG - Intronic
1105905041 13:24800702-24800724 ACAATTGAAAACATTTTTAATGG + Intronic
1106674151 13:31939965-31939987 ACAGATCAAAAGATGTTTAAGGG + Intergenic
1106827521 13:33540562-33540584 CGAGGTCCAAAAATATTTAATGG - Intergenic
1107427619 13:40309650-40309672 CCAGTTAAAGACCTCTTTAAAGG + Intergenic
1107634725 13:42380799-42380821 ACAGTTTAAGACATTTTTAAGGG + Intergenic
1107703913 13:43079936-43079958 CCAGTTTAACACCTATTAAATGG + Intronic
1108279116 13:48843195-48843217 CTAGTTCAAAAAGTACTTAAAGG + Intergenic
1108864759 13:54909949-54909971 GTAGCTCAAATCATATTTAATGG + Intergenic
1110081853 13:71323284-71323306 TCAATTCAACACATATTTATTGG - Intergenic
1110809690 13:79798142-79798164 CTAGTTCAAAGCACATTTACAGG + Intergenic
1111048700 13:82849474-82849496 ACAGTTAATATCATATTTAATGG - Intergenic
1111328897 13:86736516-86736538 TGACTTCAAAACATATTAAAAGG + Intergenic
1111840470 13:93443560-93443582 CATATTCACAACATATTTAATGG + Intronic
1112413496 13:99184685-99184707 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1112447604 13:99479200-99479222 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1113898469 13:113782219-113782241 CTAATTCAAAGCTTATTTAAAGG - Intronic
1114894719 14:26972966-26972988 GTTGTTCAAAACACATTTAATGG - Intergenic
1116263108 14:42656457-42656479 CTAATTCAAAACTTGTTTAAAGG + Intergenic
1116842414 14:49832763-49832785 GTAATTCAAAAAATATTTAATGG + Intronic
1117187687 14:53258009-53258031 CTAGTTCAAAGCTTATTTAAAGG - Intergenic
1118014924 14:61650586-61650608 CCACATCAAAAAATAATTAATGG - Intronic
1119005905 14:70928228-70928250 CCAGTTCAGGATACATTTAATGG - Intronic
1119093294 14:71805005-71805027 CTAGTTCAAAAAATATGTAAAGG - Intergenic
1121147553 14:91598259-91598281 CTAATTCAAAGCTTATTTAAAGG - Intronic
1122186781 14:100004805-100004827 CTAATTCAAAGCTTATTTAAAGG - Intronic
1124469960 15:29975545-29975567 CAAGTTCAACAAATATTTATTGG - Intergenic
1124487505 15:30132437-30132459 CCAGTGAAATACATTTTTAACGG - Intergenic
1124542594 15:30601415-30601437 CCAGTGAAATACATTTTTAACGG - Intergenic
1124756024 15:32405888-32405910 CCAGTGAAATACATTTTTAACGG + Intergenic
1124824127 15:33076469-33076491 TCATTTCAAAATATTTTTAAAGG + Intronic
1125323113 15:38509770-38509792 GCAGTCCAAAAAAAATTTAATGG - Intronic
1128886206 15:71290300-71290322 CCAGGGGAAAATATATTTAAAGG - Intronic
1131880465 15:96857103-96857125 CCAGTTCCTAACATATATTAGGG - Intergenic
1132193556 15:99891450-99891472 CCAATTCTAAACATATTTCCTGG + Intergenic
1132281054 15:100616002-100616024 CCAAGTCAAAACATTTTTTATGG + Intronic
1134370978 16:13624401-13624423 CCAATTCAACAAATATTTTAGGG - Intergenic
1135294386 16:21266583-21266605 ACAGTACAAAAGAAATTTAAAGG + Intronic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1137923924 16:52521530-52521552 CAAAGGCAAAACATATTTAAGGG - Intronic
1138412739 16:56852762-56852784 GCAGTTCAACAAATGTTTAAGGG + Intergenic
1139862998 16:70040820-70040842 TCAGGTCAAAGGATATTTAAGGG + Intergenic
1145746650 17:27325012-27325034 CCAGTTCAAGGCATACTTTAGGG + Intergenic
1146591332 17:34130462-34130484 CCAGTGCAACACACATTTACTGG + Intronic
1149106223 17:52969951-52969973 CCAGTTCCATCCATATTTTATGG + Intergenic
1149476867 17:56969122-56969144 CTAATTCAAAACTTATTTAAAGG + Intergenic
1149765408 17:59272879-59272901 CCAGTTTAACACAAATATAAAGG + Intronic
1150950271 17:69795713-69795735 CCAGTTAAAAAGTTAATTAAAGG + Intergenic
1153136552 18:1924081-1924103 CTAATTCAAAGCTTATTTAAGGG - Intergenic
1153621285 18:6980626-6980648 CCAATGCAATACCTATTTAAAGG + Exonic
1154469499 18:14685008-14685030 CCAATTAAAAACAAAATTAAAGG - Intergenic
1157002538 18:43543950-43543972 CCAGTTCAGAACATACCCAATGG + Intergenic
1157008949 18:43623016-43623038 CAAGTTCACAACATATTTAATGG + Intergenic
1157646283 18:49276178-49276200 ACAGCTCACATCATATTTAATGG - Intronic
1157880566 18:51317620-51317642 CAAGTTCACAACATAGTTTAGGG - Intergenic
1157912662 18:51632645-51632667 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1158267131 18:55672051-55672073 TTACTTCAAAAAATATTTAAAGG - Intergenic
1159270172 18:66138607-66138629 CCTGTTTAAAATACATTTAAAGG - Intergenic
1159344476 18:67182122-67182144 GCAGTTCAAAAAGTAGTTAAAGG - Intergenic
1159912099 18:74155232-74155254 CCAGTTTAAAAAATATTCAAGGG - Intronic
1164759506 19:30718336-30718358 ACAGTGCAAGACACATTTAATGG + Intergenic
1168340434 19:55620251-55620273 CCAGTTCCAAAGATATTAACTGG + Intergenic
929073851 2:38061055-38061077 CCATTTTAAATTATATTTAAAGG + Intronic
929094685 2:38252053-38252075 TCAGTTCAGGACATGTTTAAAGG + Intergenic
929195778 2:39182983-39183005 CCAGCCCAAGACATCTTTAATGG - Intronic
929697890 2:44134781-44134803 CCATTTCAAAATATATTTGGGGG + Intergenic
929875562 2:45793756-45793778 CCAGTTCCAAACATATCTAGGGG - Intronic
933132785 2:78693354-78693376 ACAGTTAAAATAATATTTAATGG + Intergenic
933199142 2:79428734-79428756 CCATTTAAAAACAGATTTATTGG - Intronic
933240686 2:79917366-79917388 CCAATTAAAAACAAATTTAAAGG - Intronic
933363814 2:81323477-81323499 CAACTTGGAAACATATTTAAGGG - Intergenic
934540541 2:95170623-95170645 CCAGATCAATAGATATTTACTGG - Intronic
934889601 2:98055787-98055809 CCAGTTCAAAAATTATTCTATGG - Intergenic
935784091 2:106533282-106533304 CAAATTCCAAACATCTTTAAAGG + Intergenic
935957721 2:108394796-108394818 CTAATTCAAAGCTTATTTAAAGG - Intergenic
936005895 2:108887284-108887306 TCACTTCAAAACATATTACAAGG - Intergenic
936070563 2:109368059-109368081 CCATTTTAAAATATGTTTAATGG + Intronic
936587871 2:113774358-113774380 ACTGATCAAAACATATTTATTGG + Intergenic
938524931 2:132120397-132120419 CCAGAATAAAACATATTTAAGGG - Intergenic
938640173 2:133269523-133269545 CCAGGTGCAATCATATTTAAGGG - Intronic
939198772 2:139007437-139007459 CTAATTTAAAAAATATTTAAAGG + Intergenic
939339346 2:140873846-140873868 CTAATTCAAAGCTTATTTAAAGG + Intronic
939935947 2:148293729-148293751 ACAGTTCATATCATACTTAATGG - Intronic
940228930 2:151429976-151429998 ACAATACAAAACATATTAAAAGG - Intronic
940793694 2:158054767-158054789 GTAGTTTAAAACATTTTTAATGG - Intronic
940988094 2:160069324-160069346 CTAATTCAAAGCTTATTTAAAGG - Intergenic
941141364 2:161787499-161787521 CAATTTGGAAACATATTTAAAGG - Intronic
941441896 2:165548436-165548458 CAAATTCAAATCATATTTACTGG - Intronic
941529187 2:166644107-166644129 ACAGTTGAAAGCATAGTTAATGG - Intergenic
941926448 2:170900053-170900075 CCTGTTAAAATTATATTTAATGG + Intergenic
942702964 2:178734209-178734231 CCAAGACAAAACAAATTTAAAGG + Intronic
942777438 2:179600146-179600168 CCAGCCCAGAACAGATTTAATGG + Intronic
943666333 2:190612831-190612853 CTAATTCAAAGCTTATTTAAAGG - Intergenic
945102063 2:206271341-206271363 ACACATCTAAACATATTTAAAGG - Intergenic
945340249 2:208644174-208644196 TCAGTTCAACAAATATTTATTGG + Intronic
945697503 2:213126224-213126246 CCAGTTCAGAACTTACGTAATGG + Intronic
945766251 2:213981535-213981557 CAGGTTCAAAACGTTTTTAAAGG + Intronic
946118106 2:217481744-217481766 ACAGTGCAAAACATATTAATGGG - Intronic
946211319 2:218149553-218149575 CGAGTTCAAGAGATCTTTAAGGG + Intergenic
946631260 2:221671686-221671708 CCAGGTCCAATCATATTTCATGG + Intergenic
947304063 2:228723946-228723968 TCTGTCCAAAACATATTAAAAGG + Intergenic
947431620 2:230033535-230033557 CCCGGTCTCAACATATTTAAGGG - Intergenic
1168825070 20:805676-805698 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1170418902 20:16173015-16173037 CCTGTTCACAACCTGTTTAAAGG + Intergenic
1171789946 20:29514068-29514090 GCAGTTCACAACATATTGACTGG + Intergenic
1175504793 20:59474010-59474032 ACATTTCAATACATATTTTAAGG - Intergenic
1177393870 21:20508708-20508730 ACATTACAAAAAATATTTAAAGG - Intergenic
1177550046 21:22608867-22608889 CTAATTCAAAACTTACTTAAAGG - Intergenic
1177979270 21:27890236-27890258 ACATTTCAACAAATATTTAAGGG + Intergenic
1178386855 21:32159075-32159097 CCAATTCAAACCTTATTTAAGGG - Intergenic
1179107166 21:38411845-38411867 GCAGTTCATTACATATTTCAAGG + Intronic
1184576711 22:45373996-45374018 CTAATTCAAAGCTTATTTAAAGG + Intronic
1184641272 22:45871795-45871817 CCAGAACAAAGCATATTTACTGG + Intergenic
951124243 3:18964666-18964688 CAAGTTCAGACCATATATAACGG - Intergenic
951281937 3:20761874-20761896 CCAGTTCACAACAATTTTTAAGG - Intergenic
951300707 3:20992776-20992798 CTAATTCAAAGCTTATTTAAGGG - Intergenic
951513448 3:23530509-23530531 TCAGATCAAAATATGTTTAAGGG - Intronic
952031519 3:29148358-29148380 CTATTTTAAAACAAATTTAATGG + Intergenic
953247827 3:41211876-41211898 CATGTTGAAAACACATTTAAGGG - Intronic
954587515 3:51748750-51748772 CTAATTCAAAGCTTATTTAAAGG - Intergenic
955416076 3:58692426-58692448 CTAATTCAAACCTTATTTAAAGG - Intergenic
955775799 3:62431655-62431677 CTGGTTCAAAATAAATTTAAGGG + Intronic
956230237 3:67006692-67006714 CTAGTTCAAAACAGTTTTCAAGG + Intronic
956382612 3:68681650-68681672 GCAGTACAAGACACATTTAAGGG - Intergenic
957240144 3:77649240-77649262 TGAGTACAAAACAGATTTAATGG + Intronic
957423112 3:79998455-79998477 CCACATAAGAACATATTTAAAGG + Intergenic
957585832 3:82130485-82130507 CCAGTTCAAAAGACATATCATGG - Intergenic
957786808 3:84893123-84893145 CCTATTCAAAATATATGTAAAGG - Intergenic
958472908 3:94544080-94544102 CCTGTTCAAAACATTTATAAGGG - Intergenic
958522979 3:95215212-95215234 CTAATTCAAAGCTTATTTAAAGG + Intergenic
958954061 3:100447951-100447973 CCAGTTAAAAATATATTTGTAGG - Intronic
959192070 3:103126604-103126626 CAATTTCAAAATATATTTCAAGG + Intergenic
959467052 3:106701143-106701165 CCAAGTCAGAACATATGTAAAGG - Intergenic
959980642 3:112512733-112512755 CTAATTCAAAGCTTATTTAAAGG - Intergenic
960131490 3:114061051-114061073 CGAGGTCCAAACATATTAAACGG - Intronic
961249705 3:125491072-125491094 CCAGACCAAAAGAGATTTAAAGG + Intronic
961322685 3:126087516-126087538 CTAATTCAAAGCTTATTTAAAGG + Intronic
961961138 3:130856588-130856610 TCAGTTCAAATGATATTTGAGGG + Intronic
962612169 3:137087190-137087212 ACAGCTCACAGCATATTTAATGG - Intergenic
965400861 3:168210682-168210704 CAGATTCAAAACTTATTTAAGGG + Intergenic
965786319 3:172339039-172339061 CCATTTAAAAAAAAATTTAATGG - Intronic
965966375 3:174495376-174495398 TCAGTTCAAAAAACATTTAATGG + Intronic
966164237 3:176999146-176999168 TAAGTTCAACAAATATTTAATGG + Intergenic
966407694 3:179615734-179615756 CCAGCTCAAATCCTATTTAGTGG + Intronic
966621271 3:181966752-181966774 CCAATTCAAAAAATACTTTAAGG - Intergenic
967244628 3:187473418-187473440 CTAATTCAAAGCTTATTTAAAGG + Intergenic
968294453 3:197563738-197563760 CTAATTCAAAGCTTATTTAAAGG + Intronic
968421954 4:492883-492905 CTAATTCAAAGCTTATTTAAAGG - Intronic
969548047 4:7844867-7844889 CTTTTTCAAAACATACTTAAGGG + Intronic
970115007 4:12685137-12685159 CCAGTTAAAAACAGAGATAATGG - Intergenic
970293222 4:14599741-14599763 GCAGAACAAAACATATTTAAAGG - Intergenic
970839858 4:20455166-20455188 CAAATTCAAAACAAATTAAAAGG + Intronic
971477474 4:27085890-27085912 CAAATTCCAAACATTTTTAAAGG + Intergenic
971929151 4:33056103-33056125 CCATTTCAAAGCAAATTTTAAGG + Intergenic
972850648 4:43045876-43045898 CCAGTGAAAAAAATATATAAGGG + Intergenic
973948888 4:55990195-55990217 TGTATTCAAAACATATTTAAAGG - Intronic
974393389 4:61303499-61303521 TCAGGTAAAAACATTTTTAAAGG - Intronic
974816253 4:67007714-67007736 CAAATTCAGTACATATTTAATGG + Intergenic
974948333 4:68555831-68555853 CTAATTCAAAGCTTATTTAAAGG + Intronic
975298495 4:72762394-72762416 CCAATTGAAACTATATTTAATGG - Intergenic
976436790 4:85027560-85027582 GCAGTTGCAAAAATATTTAATGG + Intergenic
976545874 4:86335199-86335221 CCAATTCAAAACATGTATCAGGG - Intronic
977001359 4:91508211-91508233 CCAGTTAACAACATGCTTAATGG - Intronic
977042683 4:92034436-92034458 CTAATTGAAAACTTATTTAAAGG - Intergenic
977720419 4:100233668-100233690 CTAATTCAAAGCTTATTTAAAGG - Intergenic
977761966 4:100748726-100748748 CTAATTCAAAGCTTATTTAAAGG + Intronic
977933160 4:102770314-102770336 CCAGTGAAAAAAAAATTTAAAGG + Intergenic
978032293 4:103949845-103949867 CTAATTCAAAGCTTATTTAAAGG + Intergenic
978268041 4:106850748-106850770 CCTGAACAAGACATATTTAAAGG - Intergenic
978357130 4:107888680-107888702 CTAATTCAAAGCTTATTTAAAGG - Intronic
979153003 4:117343858-117343880 CCAATTTAAGAGATATTTAAAGG - Intergenic
979446039 4:120813260-120813282 AAAGTTGAAAACATATTTTATGG - Intronic
979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG + Exonic
980269950 4:130571425-130571447 CTAATTCAAAACACATTTAAAGG - Intergenic
981114915 4:140978340-140978362 GAATTTAAAAACATATTTAAAGG + Intronic
981292600 4:143093499-143093521 CTAATTCAAAGCTTATTTAAAGG + Intergenic
981423337 4:144576680-144576702 TAAGCTCAAAAAATATTTAAAGG + Intergenic
981947458 4:150364835-150364857 CCAGCTCAATAAATATTTATTGG - Intronic
981974179 4:150703563-150703585 TAATTTCAAAACATTTTTAATGG + Intronic
982395349 4:154909922-154909944 CCAGTTCAATACATATTTGCTGG + Intergenic
982395354 4:154909973-154909995 CCAGTTAAATACATATTTGCTGG + Intergenic
982764681 4:159331839-159331861 CCATTTCTAAACTCATTTAAGGG + Intronic
983901539 4:173140894-173140916 CAAGTTCAAGAAATATTTAAGGG + Intergenic
984287743 4:177755166-177755188 CCAATAGAAAACAGATTTAAAGG + Intronic
984413568 4:179428225-179428247 GCTGTTCCAAACATATTTAAGGG - Intergenic
984876699 4:184374787-184374809 CCAGTACAAGACAGATTGAATGG - Intergenic
985238450 4:187902580-187902602 CCAGTTCAAGACAGATGTTATGG + Intergenic
986033951 5:3919942-3919964 TCAGTTTAAAACATATTTTTTGG - Intergenic
986494439 5:8328404-8328426 CCAATTCAACATATGTTTAATGG - Intergenic
986698634 5:10381829-10381851 CCAATTCAAGACATATTTGCTGG + Exonic
987564072 5:19562213-19562235 ACAGTTTAAAACATATTTACTGG + Intronic
987719987 5:21620921-21620943 CTAATTCAAAGCTTATTTAAGGG + Intergenic
988234972 5:28530631-28530653 ACAGTTCACATCAAATTTAATGG + Intergenic
988431138 5:31119948-31119970 GCAGTTCTAAACCTATTCAAAGG - Intergenic
988847927 5:35148286-35148308 CAAGTTCAACACAAATTGAATGG - Intronic
989175446 5:38520840-38520862 CAACTTCAAAATATATTAAAAGG - Intronic
989477108 5:41886819-41886841 CTAATTCAAAAACTATTTAAAGG - Intergenic
990186028 5:53210548-53210570 CTAATTCAAAGCTTATTTAAGGG - Intergenic
990782356 5:59379602-59379624 TCATTTGAAAATATATTTAATGG + Intronic
991258685 5:64643397-64643419 CAAATTCAATACATCTTTAAGGG + Intergenic
991423851 5:66470129-66470151 CTAATTCAAAGCTTATTTAAGGG - Intergenic
992292682 5:75295615-75295637 CTAATTCAAAGCTTATTTAAAGG + Intergenic
992539931 5:77754330-77754352 CTAATTCAAAGCTTATTTAAAGG - Intronic
993392705 5:87340612-87340634 AAAGTTCAAAACATAGTAAAAGG + Intronic
993398127 5:87415790-87415812 TCAGTTGCAAACATATTTACTGG - Intergenic
993536270 5:89090389-89090411 CCAGTTCATAAATTATTTATTGG + Intergenic
993970752 5:94417125-94417147 CAACTTCTAAACATCTTTAAAGG + Intronic
994025733 5:95080389-95080411 CAACTTCCAAACATATTTGAAGG - Intronic
994189687 5:96856017-96856039 CCTGCTCAAAATATATTTATAGG - Intronic
994868037 5:105304009-105304031 GCTGCTCAAAACATATTTTAAGG - Intergenic
994968568 5:106705865-106705887 GCAGTTCAAAAAATTTTAAATGG + Intergenic
995277247 5:110291050-110291072 GCAGTTCAAAAGAAAATTAATGG - Intronic
995604776 5:113841379-113841401 ACAGTTAATAACATAATTAATGG - Intergenic
996261435 5:121474715-121474737 CCAGTTAAAAACAGAGTTAGGGG + Intergenic
996956968 5:129194819-129194841 CCAGTTCACAACAAATAGAATGG + Intergenic
998055276 5:139070707-139070729 CAGGTTCAAAGCATATTTTATGG - Intronic
998925404 5:147118610-147118632 TGACTTCAAAACATATTAAAAGG - Intergenic
998987078 5:147771464-147771486 CCAGGTTAAAATATATCTAAGGG - Intronic
999401602 5:151268556-151268578 CCAGTTGGAAATATAATTAAGGG + Exonic
1000032430 5:157415208-157415230 CTGGTTCAAAATATATTTCAAGG + Intronic
1001345168 5:170888805-170888827 ACAGCTAAAATCATATTTAATGG - Intronic
1001375260 5:171250521-171250543 CCAGTTAAAAAGATATAGAATGG + Intronic
1002030867 5:176429062-176429084 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1004197216 6:13515874-13515896 CCATTTCAACAAGTATTTAATGG - Intergenic
1004646414 6:17565887-17565909 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1004893309 6:20122625-20122647 CCAGTCCAAATTATTTTTAAGGG - Intronic
1005370958 6:25132490-25132512 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1008205057 6:48645076-48645098 CCAGTCAAAAAGATAATTAAAGG - Intergenic
1009615096 6:65993417-65993439 TCTGATCCAAACATATTTAATGG + Intergenic
1010138579 6:72585593-72585615 AAAGTTAAAAACATTTTTAAAGG + Intergenic
1010998064 6:82556276-82556298 CCAGATTAAGACAGATTTAATGG + Intergenic
1012637556 6:101563577-101563599 CCATTTAAAAATATTTTTAAAGG + Intronic
1013125473 6:107180127-107180149 CCACTTTAAAACAGTTTTAATGG + Intronic
1013213045 6:108003677-108003699 CCAGCCTAAAACATATTTAGAGG + Intergenic
1014086732 6:117354712-117354734 CCAGTTTTATACATATATAATGG + Intronic
1014106803 6:117573831-117573853 CCAGTAAAAAAAATTTTTAAAGG + Intronic
1014746467 6:125206722-125206744 CCTGTTCAAAAAACATTCAATGG - Intronic
1014914161 6:127125181-127125203 CCAATTAAATAAATATTTAATGG + Intronic
1015668381 6:135658022-135658044 ACAGTAGAGAACATATTTAATGG - Intergenic
1016274758 6:142335962-142335984 CCAGTTCCAAACCTCTTGAAGGG - Intronic
1016506650 6:144788861-144788883 CCAATTCATAATATTTTTAAAGG + Intronic
1017351386 6:153446332-153446354 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1018145713 6:160886072-160886094 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1019997899 7:4736712-4736734 CCAGTTCAAAACCTGATTATGGG - Intronic
1021183667 7:17537723-17537745 CCAGTTTTGAACATCTTTAAAGG - Intergenic
1021303597 7:19003837-19003859 TCAGATCAAATCAAATTTAAAGG + Intergenic
1021601012 7:22363173-22363195 CCAGTGCAAAACATCTTGAATGG - Intergenic
1021630975 7:22647126-22647148 CCATTCCAAAAAATATTAAATGG + Intergenic
1024821821 7:53340169-53340191 CTACTTCAAAGCTTATTTAAAGG + Intergenic
1024906730 7:54391210-54391232 CTAATTCAAAACTTATTTAAAGG - Intergenic
1025797231 7:64750228-64750250 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1026717812 7:72805310-72805332 CCAGATCAAAAGAATTTTAAAGG + Intronic
1027951485 7:84822540-84822562 CCATTTCAAAATATGTTAAAGGG - Intergenic
1028076485 7:86522449-86522471 CCAGGACAAAACATGTTTATAGG + Intergenic
1030163169 7:106528946-106528968 CCACTTCAAGAAAGATTTAAGGG + Intergenic
1030848155 7:114448076-114448098 CAAGTTCAAAACATACTATATGG - Intronic
1031093279 7:117388673-117388695 ACAGTTAACATCATATTTAATGG + Intronic
1031160308 7:118159168-118159190 CTAATTCAAAAGTTATTTAAAGG - Intergenic
1031255903 7:119448714-119448736 CCAGTTCACAACATAATAACAGG - Intergenic
1031707771 7:125003482-125003504 CTAGTTCAAAACATGTTTTGTGG - Intergenic
1035004136 7:155643008-155643030 ACAGTTCAAAAAATAATGAAAGG + Intronic
1036507824 8:9371716-9371738 CCAGTTCAGAACATTTACAAAGG - Intergenic
1039444063 8:37616379-37616401 CCTGCCCAAAACACATTTAAAGG + Intergenic
1041352360 8:56960422-56960444 ACAGTTCACAAAATATTCAAAGG + Exonic
1041591162 8:59586212-59586234 ACAGTTCACAACCAATTTAATGG + Intergenic
1041651049 8:60303416-60303438 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1042071429 8:64939641-64939663 ACAATTCAAAACATACATAAAGG + Intergenic
1042729763 8:71919816-71919838 CCAGTTCAAAACATATTTTAAGG - Intronic
1043114714 8:76235848-76235870 CCAGCTGAAAACTTATTAAAAGG + Intergenic
1044037968 8:87330000-87330022 ACAGTTAAAATAATATTTAATGG - Intronic
1045126018 8:99089850-99089872 CCATTTCAAAATATGTATAAGGG + Intronic
1045815842 8:106274910-106274932 CTGGTTCAAACCATATTTATTGG - Intronic
1045816606 8:106283925-106283947 CCAAATCAAAATATATTTACTGG + Intronic
1046210349 8:111065023-111065045 TCAGTCCAAAACATATGAAAAGG - Intergenic
1047603597 8:126452079-126452101 ACAGTTGAAAACATGTTTATGGG - Intergenic
1047999408 8:130365348-130365370 TCAATTCAAAACACATTTATGGG - Intronic
1050531469 9:6593626-6593648 CTATTTTAAACCATATTTAATGG + Intronic
1051127134 9:13817191-13817213 CCAGCTACAAACATTTTTAATGG - Intergenic
1053075492 9:35130174-35130196 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1054997187 9:71405817-71405839 CCAGATGAAAATATTTTTAAAGG + Intronic
1056937215 9:90925037-90925059 CCATTTCAAAAAGAATTTAAGGG + Intergenic
1058378568 9:104353875-104353897 CCAATTAAAAAAATATATAATGG - Intergenic
1058384055 9:104412199-104412221 CTAATTCAAAACTTATGTAAAGG + Intergenic
1185561800 X:1065605-1065627 CCAGCTCTAAGCAGATTTAATGG + Intergenic
1186803113 X:13113371-13113393 CAAGTTCAAAAAAAGTTTAAGGG + Intergenic
1186927276 X:14348196-14348218 CGACTTCAAAATATATTAAAAGG - Intergenic
1187189284 X:17017988-17018010 CCATTTCAAAACATTTTTAATGG - Intronic
1187616310 X:20997731-20997753 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1187714873 X:22092671-22092693 TCAATTCAAAACATATTTATTGG - Intronic
1188167791 X:26883559-26883581 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1188253825 X:27934673-27934695 CCTGTTTAATACATATTTCAAGG - Intergenic
1188384282 X:29536657-29536679 TTAGTTCAAAATATGTTTAAAGG - Intronic
1188737533 X:33737195-33737217 CCAGTGAAAAACATATAGAAGGG - Intergenic
1189026218 X:37397694-37397716 CCAGTTCAAAACATATTTAAGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189268298 X:39733043-39733065 CCAGTTCAGCAAATATTTACTGG - Intergenic
1189550900 X:42092139-42092161 CTAATTCAAAGCTTATTTAAAGG - Intergenic
1190104859 X:47552446-47552468 CCAGAGCAAAAAATATATAATGG + Intergenic
1190315692 X:49149229-49149251 ACAGCTAAAATCATATTTAATGG + Intergenic
1190956257 X:55197102-55197124 CTAATTCAAAGCTTATTTAAAGG - Intronic
1191096940 X:56683026-56683048 ACAGTTAAAATCATATTGAATGG - Intergenic
1191625673 X:63268480-63268502 CTAATTCAAAGCTTATTTAAGGG - Intergenic
1192623032 X:72699133-72699155 CTAATTCAAAGCTTATTTAAAGG + Intronic
1193474980 X:81952379-81952401 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1193718134 X:84955675-84955697 CTAATTCAAATCTTATTTAAGGG - Intergenic
1193817418 X:86121012-86121034 AAAGTGTAAAACATATTTAAGGG - Intergenic
1194003911 X:88467017-88467039 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1194632831 X:96307448-96307470 ACAGTTAATATCATATTTAATGG + Intergenic
1195016601 X:100787551-100787573 CCACTTCAAGAGAGATTTAAGGG + Intergenic
1195546764 X:106121275-106121297 CTAATTCAGAACATATTTAAAGG - Intergenic
1196128614 X:112127461-112127483 ACAGTTCATCACATGTTTAATGG + Intergenic
1196638193 X:118028821-118028843 GCAGTTCAAAAAATATTAAACGG + Intronic
1197481162 X:126988168-126988190 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1198553674 X:137770256-137770278 CTAGTTTAAAAGATATTTGAGGG + Intergenic
1198554163 X:137775146-137775168 CTAGTTTAAAAGATATTTGAGGG - Intergenic
1198952303 X:142085152-142085174 CTAATTCAAAGCTTATTTAAAGG + Intergenic
1199813505 X:151374899-151374921 CCAGTTTATCACATTTTTAATGG - Intergenic
1199878395 X:151953624-151953646 CCAGTGCCATACAAATTTAAGGG + Exonic
1200346386 X:155453181-155453203 CCAGTTCAAAAGACATAAAATGG + Intergenic
1201580691 Y:15509061-15509083 CTAATTCAAAGCTTATTTAATGG - Intergenic
1202033846 Y:20610329-20610351 ACAGTTCAAAATTTACTTAAGGG + Intergenic