ID: 1189030382

View in Genome Browser
Species Human (GRCh38)
Location X:37443285-37443307
Sequence ACCTCAGGACATTTGCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189030378_1189030382 1 Left 1189030378 X:37443261-37443283 CCTGGGTTGATGGTGCTATTCTT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1189030382 X:37443285-37443307 ACCTCAGGACATTTGCAGTGGGG 0: 1
1: 1
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189030382 Original CRISPR ACCTCAGGACATTTGCAGTG GGG Intronic
901145155 1:7059931-7059953 TCCTCAGCACATCTGCCGTGTGG - Intronic
902469230 1:16637008-16637030 ACCTCAGGTCCTGTGCAGTTGGG - Intergenic
903844336 1:26268788-26268810 ACCTCAAAAAATTTGCAGTCTGG - Intronic
905319482 1:37105760-37105782 AAGTCAGGACAGATGCAGTGAGG - Intergenic
909885135 1:80931967-80931989 ACCTCAGGAATTTTGAAGAGAGG + Intergenic
910293034 1:85616976-85616998 ACCTCAGCACAATTTCAGCGAGG - Intergenic
910626431 1:89313001-89313023 AGTTCATGCCATTTGCAGTGGGG - Intergenic
912111631 1:106349302-106349324 AGTTCAGGACATTTGCAGCAGGG - Intergenic
912660144 1:111520272-111520294 ACCTTAGTACATGTGCAGTCAGG + Intronic
915405567 1:155657371-155657393 ACCCCAGGAAATTTGCAGATGGG - Intergenic
916324312 1:163540235-163540257 AATTCACGCCATTTGCAGTGGGG + Intergenic
916638746 1:166703150-166703172 AGTTCATGCCATTTGCAGTGAGG + Intergenic
919936088 1:202251794-202251816 CCCTCAGAACATCTGGAGTGTGG + Intronic
920174126 1:204089609-204089631 AGCTCAGCACTTTTGCAGAGAGG - Intronic
1063367414 10:5499631-5499653 ACCCCAGGGCATTTGGAGGGTGG - Intergenic
1064243984 10:13654921-13654943 GCCCCAGGGCATTTTCAGTGTGG + Intronic
1065022463 10:21511005-21511027 ACCTCAGGAAATTGGCAAGGAGG - Intergenic
1066207535 10:33204603-33204625 ACCTCGGGCCATTTACAATGCGG - Intronic
1066704795 10:38165858-38165880 CCTCCAGGACATTTGCAGAGAGG - Intergenic
1066985767 10:42465336-42465358 CCTCCAGGACATTTGCAGAGAGG + Intergenic
1068787860 10:60996526-60996548 ACATCAGGTCATCTACAGTGGGG - Intronic
1069314744 10:67083198-67083220 ACTTGAGGACATTAGCAATGTGG - Intronic
1076696026 10:132247812-132247834 CCCTCTGGTCACTTGCAGTGGGG - Intronic
1077789630 11:5424477-5424499 ACTTCATGCCATTTGCAGAGGGG - Intronic
1082079822 11:48004061-48004083 ACCTGATGACCTTTGCAGTCAGG - Intronic
1085554101 11:77403842-77403864 ACCTCTCAACACTTGCAGTGAGG - Intronic
1087677552 11:101180381-101180403 ACCTCAGAACATTGCCAGTCAGG - Intergenic
1089719441 11:120399802-120399824 ATCACAGTACATTTGCAGTTTGG - Intronic
1092875321 12:12842690-12842712 ACCTCAGTAAATCTGCTGTGGGG - Intergenic
1098715352 12:73822751-73822773 ACCTCAGGAAATTTACAATCAGG + Intergenic
1101095589 12:101336481-101336503 ACCTCAGGAGTTTTTCAGTTTGG - Intronic
1101870558 12:108562348-108562370 ACCTCAGGGCTTCTGCAGTGTGG - Intergenic
1104419688 12:128625064-128625086 ACCTCAGGACCCCTGCAGGGTGG - Intronic
1110508166 13:76314692-76314714 AGCTCAGGCTATTTTCAGTGGGG - Intergenic
1111743631 13:92237047-92237069 ACCTCAGGGCATTAGTTGTGGGG - Intronic
1112553005 13:100439467-100439489 ACCCCAGAACCTTTGTAGTGTGG + Intronic
1117428130 14:55622294-55622316 ACCTCAGGACTATTGTTGTGGGG + Intronic
1117714456 14:58566467-58566489 ATCTCAGGACATAGGGAGTGAGG + Intergenic
1119128782 14:72153010-72153032 AGTTCATGCCATTTGCAGTGGGG - Intronic
1119977441 14:79040843-79040865 ACCTCAACACATGTGCAGTAAGG - Intronic
1126358469 15:47821236-47821258 ACAACAGGACATTTGAACTGTGG + Intergenic
1127851924 15:62920796-62920818 ACCTCAGGACCTCTGTAGTCAGG - Intergenic
1129134179 15:73531692-73531714 ATCTCATGAAGTTTGCAGTGAGG + Intronic
1135926835 16:26702187-26702209 AGCTCAGGACCTATGGAGTGTGG + Intergenic
1138979119 16:62244811-62244833 ACATCAGGAAATATGTAGTGGGG - Intergenic
1139560030 16:67736040-67736062 GGCTCTGGACAGTTGCAGTGGGG - Intronic
1140443079 16:75001276-75001298 ACCCCAGGCTATTTGCAGGGGGG - Intronic
1140476340 16:75241034-75241056 ACCTTGGGGCATGTGCAGTGTGG + Intronic
1141566500 16:84905958-84905980 ACCTCAGCACTTTGGGAGTGAGG - Intronic
1203069774 16_KI270728v1_random:1058990-1059012 ATCTCAGGCCATCTGCAGAGAGG - Intergenic
1152294290 17:79457601-79457623 TCCCCAGGACAGTGGCAGTGTGG + Intronic
1155246496 18:23915342-23915364 AGCTCAGAACATTTTCATTGAGG - Exonic
1158212263 18:55064935-55064957 ACATCACGACATTTGGGGTGAGG - Intergenic
1158530202 18:58253940-58253962 GCCCCAGGCCATCTGCAGTGTGG + Intronic
1160395395 18:78567086-78567108 CCCTCAGCTCATCTGCAGTGAGG + Intergenic
1163129373 19:15263043-15263065 AGCTGAGGACATCTGCACTGTGG - Intronic
1164467974 19:28504493-28504515 ACCTGAAGACCTTTGCAGTCAGG - Intergenic
1165124861 19:33586791-33586813 ACCTCTGAACACTTGCACTGGGG - Intergenic
1168375159 19:55870911-55870933 CCTTCAGGACATTGGCACTGAGG - Exonic
925101848 2:1253780-1253802 GCCTCAGGAAACTTACAGTGTGG + Intronic
928939172 2:36709790-36709812 TACTCAGGAGAATTGCAGTGAGG + Intronic
929518927 2:42629596-42629618 TCCTCAGGGAATTTGCAGTTGGG + Intronic
931297047 2:60937559-60937581 AGCTCAGGACAGATGCAGTGAGG - Intergenic
940063686 2:149601641-149601663 AACTCTGGAGATCTGCAGTGGGG - Intergenic
940140772 2:150488387-150488409 ACCTCCCCACATTTGCAGTGAGG + Intronic
943618164 2:190117283-190117305 AGCCTAGGAAATTTGCAGTGAGG - Intronic
944162634 2:196681007-196681029 TATTCAGTACATTTGCAGTGTGG + Intronic
945071147 2:205990299-205990321 ACCTCTCAACATTTGCACTGGGG - Intergenic
948398987 2:237668700-237668722 ACCTCAGGAAAAATGCTGTGAGG - Intronic
1171279588 20:23884494-23884516 AACTCAAGACAATTGCAATGGGG - Intergenic
1172497805 20:35401517-35401539 ACTTGTGGACATTTGCAGAGGGG - Intronic
1174287898 20:49484812-49484834 ACATCAGTACATATGCAATGTGG + Intergenic
1176276001 20:64269752-64269774 ATGTGTGGACATTTGCAGTGTGG + Intronic
1176766973 21:13029497-13029519 GCCTCAGGAAGTTTGCAGCGGGG + Intergenic
1178203808 21:30440289-30440311 AGCTCAGGTGATTTGCAGTGAGG - Exonic
1180911650 22:19455086-19455108 AGCTCAGGACAGTGACAGTGAGG - Intronic
1181560602 22:23697473-23697495 ACCTCAGCAGCTTTGCAGTCAGG - Intronic
1182467229 22:30525098-30525120 ACCTCAGGACATCTGCAGTGAGG + Exonic
1184334787 22:43846783-43846805 AGCTCAGGACAGCTGCAGTGAGG + Intronic
949347264 3:3088223-3088245 CTCTCAGCACTTTTGCAGTGGGG + Intronic
950138682 3:10600733-10600755 CCCTCAGGACAGTTGCAGGCAGG - Intronic
950194883 3:11002159-11002181 AGGACAGTACATTTGCAGTGAGG - Intronic
951346085 3:21547999-21548021 ACCTCGGGAAGTTTGTAGTGGGG + Intronic
951484991 3:23201718-23201740 AGACCAGGACATTAGCAGTGGGG + Intergenic
952341910 3:32454275-32454297 CCCTCAGGAGCTTTGCAGAGAGG + Exonic
953666694 3:44930703-44930725 ACCTGAGGAGATATGCATTGTGG - Intronic
955104240 3:55881275-55881297 ATTTTAGGACATTTACAGTGAGG - Intronic
956400417 3:68873617-68873639 ACCACAGGACACTTGCAGGGAGG + Intronic
956948656 3:74253979-74254001 AGCTCAGGTCTTTTGCAGTCTGG - Intergenic
957719962 3:83981893-83981915 ACCCCAGAACATTTGAACTGGGG - Intergenic
958623173 3:96589213-96589235 TCCTCAGGTCATTTACAGTTAGG + Intergenic
959015053 3:101124301-101124323 AGCCCAGGGCATTTGCTGTGCGG - Intergenic
959685386 3:109140415-109140437 AGCTCAGGCCGTTTGCAGCGGGG - Intergenic
959842462 3:110994011-110994033 ACCTCAGGACAATTTCATTATGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
962082261 3:132152554-132152576 ACATCAGGGCATTTGGAGTCAGG + Intronic
963597453 3:147346337-147346359 ACCCCAGGACATTGGTAGAGTGG - Intergenic
966303748 3:178507869-178507891 AGCTCTGGACTTTTTCAGTGGGG - Intronic
968435561 4:586418-586440 ACTACAGGCCATGTGCAGTGTGG + Intergenic
969613188 4:8238250-8238272 AGCTCAGGGCAGGTGCAGTGGGG + Intronic
973854529 4:54997514-54997536 ACCTCAAGACATTTGGATTTTGG - Intergenic
976409514 4:84697042-84697064 TCCTGAAGACATTGGCAGTGAGG - Intronic
976667826 4:87618466-87618488 ACCTAAGGACACTTGCATAGAGG - Intergenic
978629448 4:110726638-110726660 ACCTCAGAACCTTTGCGGAGTGG + Intergenic
981162286 4:141513021-141513043 AACTCAGCACATTTGCAGTTGGG - Intergenic
982890061 4:160835981-160836003 AGTTCAGGACATTTGCAGCTGGG + Intergenic
983875969 4:172874845-172874867 AGCTCGGGACATTCGCAGTGTGG + Intronic
985875752 5:2592477-2592499 TGCTCAGGACCTTTGCAGGGTGG - Intergenic
987645152 5:20661131-20661153 ATCTGAGGACATGTGCAGAGTGG - Intergenic
994434870 5:99714779-99714801 ACCTCAGGTGATATGCACTGTGG - Intergenic
994764710 5:103901487-103901509 ATCTGTGGACATTTGGAGTGAGG - Intergenic
996351034 5:122542116-122542138 AGCTGAGGACTTTGGCAGTGAGG - Intergenic
996553834 5:124757749-124757771 AGTTCAGGACATTTGCAGCAGGG + Intergenic
999495606 5:152093849-152093871 ACCTCAAGGCATTTGCATTGAGG + Intergenic
1004667386 6:17761036-17761058 ACCTCAGGGCTTTTACAATGTGG - Intronic
1010453726 6:76030914-76030936 AGTTCATGACATTTGCAGCGAGG + Intronic
1010489895 6:76462780-76462802 ACCTCAGGGGATTTGTAATGGGG + Intergenic
1012583910 6:100899416-100899438 AGTTCACGCCATTTGCAGTGGGG + Intergenic
1012715366 6:102661522-102661544 GCCTCAGGAAACTTGCAGTCAGG - Intergenic
1013410090 6:109876271-109876293 AGTTCAGGACATTTGCAGCAGGG + Intergenic
1014241985 6:119027987-119028009 AGGGCAGGACATTTGAAGTGGGG - Intronic
1016269937 6:142277204-142277226 ACCTCAAGAAATTTGTAGTCAGG + Intergenic
1018616481 6:165691685-165691707 TCCTGAGGACATCTGCACTGAGG - Intronic
1019424679 7:968710-968732 ACCTGAGTCCATTTGCAGTTAGG - Exonic
1021403454 7:20237090-20237112 AAACCAGCACATTTGCAGTGAGG + Intergenic
1024244982 7:47462669-47462691 ACCTGAGGCCATTTGCAGCAAGG + Intronic
1025992736 7:66507816-66507838 TTCTCATGACATTTGCTGTGGGG - Intergenic
1027878499 7:83801908-83801930 ACATCAGTACTTTTGCAGTCAGG + Intergenic
1028677290 7:93480140-93480162 ATCTCAGCACATTTGCATTTTGG + Intronic
1034541165 7:151759192-151759214 GCCTCCGGACATTTGCATCGTGG + Intronic
1035409650 7:158629228-158629250 ACCTCAAGACTGTGGCAGTGTGG + Intergenic
1046516931 8:115274690-115274712 ACTTCAGGAAATTGGTAGTGTGG + Intergenic
1048188196 8:132263689-132263711 AACCCAGAACTTTTGCAGTGGGG + Intronic
1048406122 8:134124019-134124041 GCCTCAGGAAACTTGCAGTCAGG + Intergenic
1050778377 9:9297814-9297836 AGCTTAGGACATTGGCAGTGGGG + Intronic
1051811997 9:21059834-21059856 ACATCAGGAAATTGGCAGAGAGG - Intergenic
1052519950 9:29533864-29533886 AGTTCATGTCATTTGCAGTGGGG - Intergenic
1052950188 9:34202489-34202511 ACCTTAGGACAGTTGAAGGGAGG + Intronic
1053410174 9:37911164-37911186 ACTTCAGGAGATGTCCAGTGAGG + Intronic
1053567761 9:39271030-39271052 ATTTCAGGACAGGTGCAGTGGGG - Intronic
1053680931 9:40484714-40484736 ACACCAGGAGAGTTGCAGTGGGG - Intergenic
1053833771 9:42111977-42111999 ATTTCAGGACAGGTGCAGTGGGG - Intronic
1053930919 9:43113028-43113050 ACACCAGGAGAGTTGCAGTGGGG - Intergenic
1054129382 9:61347969-61347991 ATTTCAGGACAGGTGCAGTGGGG + Intergenic
1054282782 9:63140221-63140243 ACACCAGGAGAGTTGCAGTGGGG + Intergenic
1054294013 9:63320229-63320251 ACACCAGGAGAGTTGCAGTGGGG - Intergenic
1054392038 9:64624718-64624740 ACACCAGGAGAGTTGCAGTGGGG - Intergenic
1054503691 9:65891610-65891632 ACACCAGGAGAGTTGCAGTGGGG + Intronic
1054596782 9:67075433-67075455 ATTTCAGGACAGGTGCAGTGGGG + Intergenic
1055845865 9:80563119-80563141 ACCGCTGAACATTTGAAGTGAGG - Intergenic
1056478050 9:86972030-86972052 GCCTCAGGACTTTGGCACTGAGG - Intergenic
1059287950 9:113193306-113193328 ACCTCAGCACACTAGGAGTGAGG + Intronic
1059971749 9:119675669-119675691 TAGTGAGGACATTTGCAGTGTGG - Intergenic
1060706146 9:125803164-125803186 ACCTGAGGCAGTTTGCAGTGAGG - Intronic
1061728015 9:132591889-132591911 ACTTCACAACCTTTGCAGTGAGG + Intergenic
1186835518 X:13433557-13433579 ACCTCACAACACTTGCACTGAGG + Intergenic
1189030382 X:37443285-37443307 ACCTCAGGACATTTGCAGTGGGG + Intronic
1189547249 X:42054542-42054564 ATTTCAAGTCATTTGCAGTGAGG - Intergenic
1195623411 X:106982526-106982548 TCCTCAGGGCATATGCATTGGGG - Intronic
1195648166 X:107256275-107256297 AGCTGAGGTCATTAGCAGTGAGG + Intergenic
1196528721 X:116758605-116758627 TCCTCTGGACATTTCCATTGTGG - Intergenic
1197348690 X:125356773-125356795 AGTTCATGCCATTTGCAGTGGGG + Intergenic
1198074955 X:133185298-133185320 AGTTCATGCCATTTGCAGTGGGG + Intergenic
1202026168 Y:20526132-20526154 AGTTCATGACATTTGCAGTGGGG - Intergenic