ID: 1189032218

View in Genome Browser
Species Human (GRCh38)
Location X:37462415-37462437
Sequence AGGGAAAACAGAATGGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 2, 1: 10, 2: 30, 3: 97, 4: 546}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189032218_1189032226 26 Left 1189032218 X:37462415-37462437 CCACTACCCATTCTGTTTTCCCT 0: 2
1: 10
2: 30
3: 97
4: 546
Right 1189032226 X:37462464-37462486 TTGCCATACGTTACCTGATAAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1189032218_1189032224 3 Left 1189032218 X:37462415-37462437 CCACTACCCATTCTGTTTTCCCT 0: 2
1: 10
2: 30
3: 97
4: 546
Right 1189032224 X:37462441-37462463 CCTTCAACAAGCACCTCTGCTGG 0: 1
1: 9
2: 230
3: 317
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189032218 Original CRISPR AGGGAAAACAGAATGGGTAG TGG (reversed) Intronic
900888101 1:5429699-5429721 AGGAAAAACAAAAGGGGCAGGGG + Intergenic
901136318 1:6999117-6999139 TGGGAACACAGAGTGGGAAGAGG - Intronic
902172857 1:14627136-14627158 AGGGAAATCAGAGTGGCTGGGGG + Intronic
902767425 1:18626682-18626704 AGAGAAAACAGAAAAGGAAGGGG + Intergenic
902783030 1:18716741-18716763 AGGGGGAAGAGAATGGGTAGAGG - Intronic
903197636 1:21703638-21703660 AGGGAAAACAGAAGTGGCTGAGG + Intronic
903420216 1:23213574-23213596 AGAGAATACAGAATGTGTAGGGG - Intergenic
904119407 1:28187118-28187140 AGGGAAAAGAGCATGGGTTTTGG - Intronic
904621302 1:31776903-31776925 AGGGACAACAGCATGGGGAAGGG + Intergenic
904812458 1:33172345-33172367 GGGGAGAACAGGTTGGGTAGGGG + Intronic
905678319 1:39846129-39846151 AGAGAAAACAGGATAAGTAGAGG + Intronic
906366303 1:45212968-45212990 GGGGAATTCAGAATGGATAGTGG - Intronic
906383013 1:45344837-45344859 AGGGAAAGCAGGATGGGTGAGGG - Exonic
906517692 1:46449123-46449145 AGGAATCACAGAATGAGTAGAGG - Intergenic
907087979 1:51695609-51695631 AGCGAAAACAGAATGGGATGGGG + Intronic
907118817 1:51991066-51991088 AGGAAACACAGATAGGGTAGAGG - Intergenic
907262479 1:53230347-53230369 AGGGAGAACAGAATGGGAGATGG - Intronic
907881378 1:58552080-58552102 AGGGAAACAGGACTGGGTAGAGG - Intergenic
907951747 1:59189896-59189918 AGGGAAAGAAGAATGGAGAGGGG - Intergenic
908011333 1:59780331-59780353 AGGGAAAAGCTTATGGGTAGTGG - Intergenic
908042324 1:60127893-60127915 GGGGAAACTAGAATGGATAGTGG + Intergenic
908104433 1:60826902-60826924 AGGGAATGAAGAATGGGGAGTGG - Intergenic
908979937 1:69943451-69943473 AGGGAGAGGAGAATGGGTATGGG + Intronic
909091740 1:71234150-71234172 AGAGAAAACAGAATGTCTGGAGG - Intergenic
909286513 1:73826893-73826915 AGGGAAAAGGGAGTGGGTAGGGG + Intergenic
910010404 1:82453991-82454013 AAGGAAGACAGAATGGGGAGTGG + Intergenic
910141775 1:84034025-84034047 AGGGAATACAGAATGAGTAGTGG + Intergenic
910318270 1:85914186-85914208 ACGGAATAAAGAATGGGTAGCGG + Intronic
910349798 1:86282204-86282226 AGGGAATACAAAAAGGGTAGTGG + Intergenic
910948495 1:92618699-92618721 AGGGAATACAGAATGGGTAACGG + Intronic
912226457 1:107739866-107739888 AGGAAAACCAGAAGGGGTAGAGG - Intronic
912687971 1:111781905-111781927 AGGGAGAAGGGACTGGGTAGAGG + Intronic
914444594 1:147739451-147739473 AGAGGAAGGAGAATGGGTAGAGG + Intergenic
914899076 1:151702534-151702556 AGGGAAAAGAAAATGGGGTGGGG - Exonic
915243666 1:154541557-154541579 AGGGAGACCAGCATGGGTTGGGG + Intronic
915786738 1:158621846-158621868 AAGGAAATCAGAATGGTCAGTGG - Intronic
915969368 1:160343050-160343072 GGGGAAGAGAAAATGGGTAGAGG - Intronic
916042798 1:160975826-160975848 AGAGAAAAGAGAATGGGTCTTGG + Intergenic
916077926 1:161213562-161213584 AGAGAAAACAGAATGAATAGAGG + Intronic
916228609 1:162516443-162516465 AGGGAAAAAAGAAAGGGATGAGG + Intronic
917712029 1:177694822-177694844 ATGGAAAACAGAAAAGGCAGGGG + Intergenic
917928608 1:179808657-179808679 ATCGAAAACAGCATGGGTAATGG - Intronic
918148320 1:181777268-181777290 AGGGGGACCAGAATGGATAGAGG - Intronic
919416176 1:197313130-197313152 AGGGGAAAGAGAATGTGTGGTGG + Intronic
920692538 1:208158049-208158071 AGGGGAAAGAGAGTGGGAAGTGG + Intronic
921352553 1:214250846-214250868 AGGGAAAACTGAAGGGGGAAAGG + Intergenic
921533429 1:216313428-216313450 AGGTGCAACAGAATGGCTAGAGG + Intronic
921986587 1:221318892-221318914 AGGGAATGCAGACTGGGTAGTGG + Intergenic
922956383 1:229604734-229604756 AGGGAATACAGAATGGGTAGTGG + Intronic
923051324 1:230393098-230393120 AGGGGAAAAAGAAGGGGAAGGGG + Intronic
923925945 1:238627836-238627858 AGAGAATACAGAATGGGTAGTGG - Intergenic
924432651 1:244009909-244009931 GGGGAATATGGAATGGGTAGAGG + Intergenic
924653668 1:245952883-245952905 AAGGAAACCTCAATGGGTAGAGG - Intronic
924866601 1:247989114-247989136 AGGCAAAAGAGAATGGATGGTGG + Intronic
1063758705 10:9046446-9046468 AACCAAAACAGAATGGGTAAAGG - Intergenic
1063878463 10:10506519-10506541 AGGGAAAACAGATTGGGGTAGGG - Intergenic
1063979437 10:11441823-11441845 GTGGAAAACAGAATGGTTATCGG + Intergenic
1064445758 10:15391494-15391516 AGGGAACGTGGAATGGGTAGTGG - Intergenic
1064583334 10:16815863-16815885 AGGGAAAACAGAATTTGTAAAGG + Intronic
1064682458 10:17824829-17824851 TGGGGAAACAGAAAGGGTAGGGG - Intronic
1064691836 10:17926570-17926592 AGTGAAAACAGCATGGGCAAAGG - Intergenic
1064784498 10:18878709-18878731 AAGGAATACAGAATGGGTAACGG + Intergenic
1065453760 10:25884704-25884726 AGGGAATACAGAATGGGTAGTGG + Intergenic
1066047355 10:31604912-31604934 AGGGAACACAGTTTGGGTATGGG + Intergenic
1066051202 10:31637459-31637481 AGGGAAAACAGAATGGGTAGTGG - Intergenic
1066334507 10:34462848-34462870 AAGGAAAACGGAAAGGGAAGAGG + Intronic
1066698841 10:38104888-38104910 ATGGAAAACAGAAAGGCTATGGG - Intronic
1066957887 10:42190002-42190024 AGGGAATACAGAATGAATAGTGG + Intergenic
1066993811 10:42543341-42543363 ATGGAAAACAGAAAGGCTATGGG + Intergenic
1067025969 10:42844726-42844748 AGGGAATACAGACTGGGGAGTGG - Intergenic
1067307192 10:45075093-45075115 AGGGAGAAAAGAATAGGTTGAGG - Intergenic
1067666319 10:48282618-48282640 AGGGAATACAGAATGAGTAGTGG - Intergenic
1068233517 10:54202355-54202377 AGGGAATAAAGGATGGATAGAGG + Intronic
1068502710 10:57860470-57860492 ATAAAAACCAGAATGGGTAGAGG + Intergenic
1068846426 10:61680869-61680891 AGGGAAGAAAGAAGGGGAAGGGG + Intronic
1069178611 10:65326992-65327014 AAGGAAAACAGAGTGGGAAGGGG - Intergenic
1070162212 10:73873654-73873676 AAGGAAAATAGCATGGGAAGGGG - Intronic
1070414242 10:76174727-76174749 AGCGGAAACAGAATGGGTTTTGG + Intronic
1071031192 10:81183291-81183313 AAGGAATACAGGATGGGGAGGGG + Intergenic
1071201795 10:83227887-83227909 AGGAAAAACACAATGTGCAGAGG + Intergenic
1071716894 10:88106166-88106188 AGGGAAAAGAGTGTGGGTGGAGG - Intergenic
1072253545 10:93600553-93600575 AGGGAGCACCGAATGGGTGGAGG - Intronic
1072425975 10:95331248-95331270 AGGGAAATCAGGATGGGGTGGGG - Intronic
1072436169 10:95416219-95416241 AGGGAAAAAAGAAAGAGGAGGGG + Intronic
1074135846 10:110625825-110625847 ATGGGAATCAGAATGGGAAGAGG - Intergenic
1074235409 10:111580121-111580143 AGGGAATATGGAATGGGTAGTGG - Intergenic
1074886225 10:117695901-117695923 AGAGAAAAAAAAATGCGTAGGGG - Intergenic
1075573758 10:123563587-123563609 AGGACAGACAGAATGAGTAGGGG - Intergenic
1075933421 10:126319279-126319301 AGGCAACACAGCATGGGAAGGGG + Intronic
1076575970 10:131468395-131468417 AGGCAAAACAGAATGTGTGCAGG + Intergenic
1076598453 10:131640603-131640625 ATGGAAAACAGAAAGAGCAGGGG + Intergenic
1077401652 11:2361150-2361172 AGGGACTACAGAATGGGCAGTGG + Intergenic
1078576424 11:12506808-12506830 AGGGAACAAATAATGGGTGGAGG + Intronic
1079538657 11:21545702-21545724 AGTGAAAACAGAATGAGAGGGGG + Intronic
1079658646 11:23014017-23014039 AGTGAAAACTGCATGGGTATTGG - Intergenic
1079915946 11:26368559-26368581 AGAGAAAAAAGAAAGGGTGGGGG + Intronic
1080208819 11:29761568-29761590 AGGCAAGACAGCATGTGTAGGGG + Intergenic
1080438374 11:32267849-32267871 AGGGAAAATGGAGTGGGTGGTGG - Intergenic
1080446276 11:32340142-32340164 ATAGAAAACATAATGGGTATTGG + Intergenic
1080552726 11:33387657-33387679 AGGGAAAACAGCCTGGGTGAGGG + Intergenic
1080796903 11:35573121-35573143 AAGGAAAAAAGAATGGATATTGG - Intergenic
1081021348 11:37951452-37951474 AGGCAAGACAGCATGTGTAGGGG - Intergenic
1081356465 11:42120486-42120508 AGGGAAGACAGCATGTGTAGGGG - Intergenic
1081440407 11:43074833-43074855 AGTGAAAAGAGAATGGGTCTAGG + Intergenic
1081951734 11:47049920-47049942 AGGGAAAGAAGAATGGATAATGG + Intronic
1082822285 11:57552251-57552273 AGGGAAAAATGAATGGGGAATGG + Exonic
1083134241 11:60656439-60656461 AGGAAATATGGAATGGGTAGTGG + Intergenic
1083741656 11:64714459-64714481 AGGGTAACCAGACTGGGAAGGGG + Intronic
1084443255 11:69188159-69188181 AGGCAAGACAGCATGTGTAGGGG + Intergenic
1085144235 11:74178495-74178517 AGGGAAGAGAGAGTGGGAAGTGG + Intronic
1085654197 11:78297561-78297583 AGGGAGAACAGCATAGGTAAAGG + Intronic
1085827298 11:79861196-79861218 ATGGAAGGCAGAATGGGCAGTGG - Intergenic
1086423908 11:86665277-86665299 GGGGAAAGCAGGATGTGTAGGGG + Intronic
1086839204 11:91664584-91664606 AGTGAAAGCACCATGGGTAGAGG + Intergenic
1087021372 11:93606814-93606836 AGGGAATACAGAATAAGTGGTGG - Intergenic
1087208152 11:95418396-95418418 AGGGCAAACAGAATCAGTATTGG - Intergenic
1087432841 11:98075402-98075424 AGGGAAGGAAGATTGGGTAGAGG + Intergenic
1088324656 11:108589317-108589339 AGGGCAGGCAGAATGTGTAGGGG + Intronic
1088407334 11:109496695-109496717 AGGTAATACAGAATGGGTAGTGG - Intergenic
1089091408 11:115880401-115880423 ATGGAAAACAAAATAGGCAGAGG - Intergenic
1089348102 11:117804595-117804617 AGGGAAACCAGAATAGGGAAAGG - Intronic
1089473641 11:118740965-118740987 AGGAAATGCAGAATGGGTGGTGG - Intergenic
1089652593 11:119924088-119924110 AAGGAAAACAGAAGTGGCAGTGG - Intergenic
1089963807 11:122638712-122638734 AGGGAAAACAAAATAGGTACAGG - Intergenic
1090753750 11:129770637-129770659 CGGGAATACAGAATGGATAGTGG - Intergenic
1091103747 11:132899164-132899186 AAATAATACAGAATGGGTAGTGG + Intronic
1091530971 12:1354950-1354972 AGAGAAAACAGTTTGGGAAGTGG - Intronic
1091705792 12:2692032-2692054 AGTGAAAACAGAAAGGTGAGGGG - Intronic
1091816796 12:3444895-3444917 AAGGAAAAGACAGTGGGTAGTGG + Intronic
1092084920 12:5748839-5748861 AGGGAAAAAGGAAGGGGGAGAGG - Intronic
1092203482 12:6601627-6601649 AGGTAAAACAGAAGGGGTTTGGG - Exonic
1092272651 12:7035651-7035673 AGGACATACAGAATGGGTAGTGG + Intronic
1092952258 12:13517397-13517419 AGGGAAAAAAGAAAGGGTGCTGG + Intergenic
1093271432 12:17067038-17067060 AGGGAAGACAGAGGGGGTAAAGG - Intergenic
1093443467 12:19227745-19227767 AAGAAAAAAAGAATGGGCAGTGG + Intronic
1093510807 12:19925833-19925855 AGGGAAAACAGAATTGATAAAGG + Intergenic
1093765321 12:22955117-22955139 AAGGAAGGAAGAATGGGTAGGGG + Intergenic
1093808156 12:23460611-23460633 ACTGAAAAAAGAATGGGTAAGGG + Intergenic
1094186819 12:27652416-27652438 AGGGAAAAGAGAAAGGGAACAGG + Intronic
1096027535 12:48380085-48380107 AAGGAAAAGAGACTGGCTAGGGG + Intergenic
1096192202 12:49627093-49627115 AAGGAAAACACAATGGGAACTGG + Intronic
1096721388 12:53525391-53525413 AGGGAAATCAGAATTGGGGGAGG + Intronic
1096756614 12:53804818-53804840 AGTGAAAACAGAATGGAAGGAGG - Intergenic
1097289998 12:57906637-57906659 TGGGAATACAGAATCGGTAGAGG + Intergenic
1098771726 12:74560779-74560801 AGGGAAAACAGAGTGTGCAGGGG + Intergenic
1098807414 12:75036858-75036880 AAGGAATACAGAATGGGTGATGG + Intergenic
1099994939 12:89768443-89768465 AGGGAATACAGAATGGGTAGTGG - Intergenic
1100150395 12:91729627-91729649 AGGGAATACAGAATGGATGGTGG + Intergenic
1100680990 12:96921048-96921070 AGGGAAAATTGAAAGGGTTGGGG + Intronic
1100884433 12:99054494-99054516 ATGGAAACTAGAATGGGGAGCGG - Intronic
1102786495 12:115609253-115609275 AGGGAAAATAGAGTGGATATTGG - Intergenic
1103112848 12:118296506-118296528 CGGGAAAAAAGAATGGGACGGGG + Intronic
1103137367 12:118519199-118519221 AGGGGGAACAGTATGGGTAAAGG - Intergenic
1103582661 12:121927040-121927062 AGGGAAATGAGATTGGGTGGGGG - Intronic
1104026605 12:125032111-125032133 AAGGAAACCAGAATGAGGAGGGG + Intergenic
1104185141 12:126423414-126423436 AGGGAATACAGAATGGGTAATGG - Intergenic
1104633708 12:130425024-130425046 AATGAAAACAGAATGGGTTACGG + Intronic
1105617065 13:22028643-22028665 AGGAAAGACGGAATGGGGAGAGG - Intergenic
1105947643 13:25203133-25203155 AGGGATGGCAGAATGGGGAGGGG + Intergenic
1106545398 13:30726550-30726572 GGGGAATATAGAATGAGTAGTGG + Intronic
1107168770 13:37315330-37315352 AGAGAAAACAAAAAGGGCAGAGG - Intergenic
1107566545 13:41611050-41611072 AGGGAAAACTAAATGAGCAGAGG - Intronic
1107780686 13:43898931-43898953 AGGAAAGAGAGAATGGGAAGGGG + Intergenic
1108018265 13:46098275-46098297 GGGGAAAACAGAACGGGTAGGGG + Intronic
1108148093 13:47500975-47500997 AGGGCAGACAGAATGAGAAGGGG - Intergenic
1108200339 13:48037380-48037402 ACGGAAAAAAGAATGTGCAGTGG + Intergenic
1108708064 13:53007957-53007979 AGGGAGAACAGATGGGGAAGTGG + Intergenic
1108997132 13:56748224-56748246 AGGGAAAACACAATGAATTGAGG - Intergenic
1109955293 13:69557718-69557740 AGGGATTATAGAATGGGTAGTGG + Intergenic
1110545664 13:76752453-76752475 ATTGAAAACAGAAGTGGTAGGGG - Intergenic
1110568540 13:76980099-76980121 AGGGAAAACAGCTTAGGAAGGGG + Intergenic
1110710572 13:78646625-78646647 AGGGAAAGCAGAGTAAGTAGAGG + Intronic
1110790802 13:79584659-79584681 AGGTAAAATAGAAAGGCTAGAGG - Intergenic
1110833866 13:80062654-80062676 AGGGAATCCAGAATGGGTAGTGG - Intergenic
1110938872 13:81323772-81323794 AGGGACAACAGAAAGAGTAATGG + Intergenic
1110981311 13:81902352-81902374 AGGAGAAACTCAATGGGTAGTGG + Intergenic
1112668300 13:101602720-101602742 TGGGACAAGAGAATGGGGAGTGG - Intronic
1114360378 14:21965723-21965745 AGAGAAGACAGATTGGGTAGGGG - Intergenic
1114537700 14:23433349-23433371 AGGGAAGACAGAAGGGATATTGG + Intronic
1114715746 14:24822143-24822165 AGGGAAAAGATAATGAGTTGAGG - Intronic
1114965411 14:27953742-27953764 AGGTAATACAGAATGGATAGTGG - Intergenic
1116101286 14:40440430-40440452 AGAGAATACAGAATGATTAGTGG - Intergenic
1116218779 14:42054492-42054514 AAGAAATACAGAATGGGTAGTGG + Intergenic
1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG + Intergenic
1116978353 14:51141120-51141142 AGGGAAAAGAGAAGGGAGAGAGG + Intergenic
1116997317 14:51337142-51337164 AGGGAAAAGAGAATGGGATTTGG - Intergenic
1117962735 14:61178963-61178985 AGGGAAAATGGCATGGATAGTGG + Intergenic
1118471433 14:66078491-66078513 AGTGAAAACTTAATGGGTACAGG - Intergenic
1118950488 14:70432609-70432631 AAGGAATACTGAATGGGTAGTGG - Intergenic
1118968055 14:70606713-70606735 AGGCAAGACAGAATGGGCACTGG - Intergenic
1119460117 14:74794890-74794912 AGGGAATATGGAATGAGTAGTGG - Intronic
1120063617 14:80014120-80014142 AGAGAATATAGAATGGATAGTGG + Intergenic
1120200058 14:81527911-81527933 AGGAAAAAAAAAATGGGTTGGGG + Intronic
1120580102 14:86236538-86236560 AGGGAAATAAGAATGGTTAATGG + Intergenic
1121320860 14:92990940-92990962 AGGGAAAACAGAGCTGGTGGGGG - Intronic
1121633355 14:95437387-95437409 AGGGAAGACAGCATGCGCAGTGG - Intronic
1121711185 14:96039924-96039946 CGGGAAAACAGAGTGGGGAAGGG - Intronic
1121739857 14:96243702-96243724 TGGGAAAAAAGAGTGGGTTGGGG - Exonic
1122555141 14:102574895-102574917 AGGGAGAACAGACTGGGAAAAGG - Intergenic
1123106279 14:105843114-105843136 CAGGAAAACACAATGGGGAGAGG - Intergenic
1123190854 14:106568275-106568297 AACAAATACAGAATGGGTAGTGG - Intergenic
1202935225 14_KI270725v1_random:81774-81796 AGGGAATACAGAATGAATAGTGG - Intergenic
1123507121 15:20954249-20954271 ATGGAATACAGAATGTGAAGGGG - Intergenic
1123564348 15:21527996-21528018 ATGGAATACAGAATGTGAAGGGG - Intergenic
1123600601 15:21965279-21965301 ATGGAATACAGAATGTGAAGGGG - Intergenic
1123951737 15:25285296-25285318 AGGGAGAAAAGCATGGGAAGGGG - Intergenic
1124733750 15:32224680-32224702 AAGTAATACAGAATGGGTAGTGG - Intergenic
1125527351 15:40385422-40385444 AGGGTAAACAAAAGGGCTAGTGG + Intronic
1126325434 15:47472019-47472041 AGAGAAAAGAGAATAGATAGAGG + Intronic
1126435289 15:48631405-48631427 AGTGATAACAGAGTGGGTGGAGG + Intronic
1127206898 15:56731100-56731122 AGAGAAAACAGAGAGGATAGGGG + Intronic
1128068558 15:64779268-64779290 AGGGGAGAGAGAATGGGTACTGG - Intergenic
1128658961 15:69483936-69483958 AGAGAAAAAAGAATGGGAAGAGG - Intergenic
1128724860 15:69981032-69981054 AGGCAAAAGACAATGGGAAGGGG - Intergenic
1129129039 15:73474244-73474266 AGGGAAAACAGCATATGCAGAGG + Intronic
1130200937 15:81826277-81826299 AGGGAGAACAGAATGAGGAGAGG + Intergenic
1130226028 15:82058942-82058964 AGGGAAAGGAGAAGGGGAAGAGG - Intergenic
1130377185 15:83339663-83339685 AGGGAATATGGAATGAGTAGTGG + Intergenic
1130634933 15:85609251-85609273 GGGGAGAAGAGAATGGGGAGAGG - Intronic
1131058042 15:89387769-89387791 AGGGAAAACAGAACTGGAAATGG - Intergenic
1131581961 15:93652152-93652174 AGGGAAGAGGGAATGGGGAGGGG - Intergenic
1131795445 15:96011224-96011246 AAGGAAATCAGAATGGGTGGGGG + Intergenic
1131967041 15:97855211-97855233 AAGGAATACATAATGGGTAGTGG + Intergenic
1202972709 15_KI270727v1_random:255100-255122 ATGGAATACAGAATGTGAAGGGG - Intergenic
1132647311 16:1004998-1005020 AGGGAGAAGAGAAGGGGGAGGGG + Intergenic
1133986359 16:10671787-10671809 AGGCAAAAGAGAATGTGCAGGGG + Intronic
1134087960 16:11371658-11371680 AGGGAAGACAGAAGGGAGAGTGG - Intronic
1134368306 16:13599780-13599802 AGGGAAAAGAGGATGGGAAATGG + Intergenic
1134636341 16:15794769-15794791 AGGGCAAACAGTATGGACAGAGG + Intronic
1134770545 16:16805519-16805541 AGGGAAGACAGAATGATTATGGG + Intergenic
1135141580 16:19926656-19926678 AGCAAAAACATAATGAGTAGAGG - Intergenic
1135719928 16:24807638-24807660 AGAGAAAAAAGAGTGGGTGGGGG - Intronic
1135904707 16:26500961-26500983 AGGGAGAAGAGAATGAGAAGGGG + Intergenic
1136219077 16:28816364-28816386 AGGGAAGGCAGAATGGTTAATGG - Intergenic
1136857658 16:33673444-33673466 AGGGAATACAGACTGGGGAGTGG + Intergenic
1137488640 16:48912438-48912460 AGGGAGAACACCATGGGAAGGGG + Intergenic
1137871044 16:51950614-51950636 AGGGAAAAGAGCATGAGAAGGGG + Intergenic
1138418928 16:56886797-56886819 AGGGAAAACACAAGGAGTGGGGG - Intronic
1139369708 16:66459217-66459239 ATGGAGGACAGAATGGGCAGAGG - Intronic
1140966165 16:79968121-79968143 AAGGAGAACAGATTGGGGAGGGG - Intergenic
1141263069 16:82471326-82471348 AGGAGAAACAGAAGGGGAAGGGG - Intergenic
1141408673 16:83816882-83816904 AAGGAAATCAGAATGGCTATCGG + Exonic
1141673055 16:85502916-85502938 ACGGAAGACAGAATGCGTGGCGG + Intergenic
1141774569 16:86114236-86114258 AGGGAAAAGAGGAAGGGTGGAGG + Intergenic
1141859193 16:86704909-86704931 AGGGAGAACAGCAGAGGTAGAGG + Intergenic
1203119239 16_KI270728v1_random:1521927-1521949 AGGGAATACAGACTGGGGAGTGG + Intergenic
1143380699 17:6494335-6494357 AGGGAAGAAAGAGTGGGAAGAGG + Intronic
1143467834 17:7149760-7149782 AGGGAACATTCAATGGGTAGTGG + Intergenic
1143549202 17:7619014-7619036 AGGGAAAACAAAAATGGTACAGG + Intronic
1144762943 17:17717605-17717627 AAGGAAGACAGATTGGGGAGTGG - Intronic
1146565621 17:33910531-33910553 AAGGAAAACAGAATGGGATGAGG - Intronic
1146667511 17:34714969-34714991 AGAGAAAGAAGAATGGGTAGGGG + Intergenic
1147150126 17:38509674-38509696 ACGGAAAACAGAATGGAAGGGGG + Intronic
1147421523 17:40324286-40324308 AGGAAAAAAAAAATGGGAAGAGG - Intronic
1148486793 17:47995905-47995927 AGGGAAAACAGAATGGGTCCTGG + Intergenic
1148525451 17:48328710-48328732 AGAGAAAACAGGATGTGGAGTGG - Intronic
1149919711 17:60645746-60645768 AGGGAAAACTGGAAGGGCAGTGG + Intronic
1150911850 17:69395972-69395994 ATGGAAACCAGAATGGGTGATGG + Intergenic
1151272324 17:73006463-73006485 AGGGAGAAGAGGATGGGGAGGGG + Intronic
1153128237 18:1822428-1822450 AAGGAAAACAGAATGGTGAAGGG + Intergenic
1153449486 18:5211255-5211277 AGGCAAAAAAAAATGTGTAGAGG + Intergenic
1153741887 18:8138198-8138220 AGGGAAAAAAAAAAAGGTAGGGG - Intronic
1154037199 18:10814665-10814687 AGGGAAAACGGTATGAGAAGAGG - Intronic
1154272972 18:12935976-12935998 AGGGAATCTGGAATGGGTAGTGG - Intergenic
1155336737 18:24772853-24772875 AAGGAATACAGAATGGGTAGTGG - Intergenic
1155338079 18:24785403-24785425 AGGGAAACCAAAATGGGCAATGG - Intergenic
1155381130 18:25223896-25223918 GGGGATAACAAATTGGGTAGGGG - Intronic
1155753210 18:29455456-29455478 AGGCAAAACTGACTGGGTTGAGG - Intergenic
1156117331 18:33801878-33801900 AGGCAAGACAGCATGTGTAGGGG + Intergenic
1156867276 18:41902970-41902992 ATGGAAAACACAATGAGAAGAGG + Intergenic
1157052785 18:44187755-44187777 AGAGAAAACAGAAGGTTTAGGGG + Intergenic
1157744064 18:50119354-50119376 AGAGAAAACAGAATTTGTTGAGG - Intronic
1158591731 18:58784322-58784344 AGGGAAAACAGACTGGAAAGAGG + Intergenic
1158658003 18:59358804-59358826 AGAGAGAACAGAATGGGTGAGGG + Intronic
1158799183 18:60886213-60886235 AAAGTAAACAGAATGGGGAGTGG + Intergenic
1159501168 18:69272332-69272354 AGGGAAAACTACATGGGGAGGGG - Intergenic
1159593955 18:70364685-70364707 GGGGAAGACAGAATGGGTAATGG - Intergenic
1159801572 18:72906633-72906655 AGGGCAATAAGAAGGGGTAGAGG - Intergenic
1160126319 18:76175654-76175676 ATGAAAAAGAGAATGGGTAGTGG + Intergenic
1161626331 19:5329084-5329106 AGGGAAAACAAAACGGGGTGCGG + Intronic
1161857790 19:6775640-6775662 AAGGGCAACAAAATGGGTAGGGG - Intronic
1163190678 19:15674604-15674626 AGGAATAAGTGAATGGGTAGAGG - Intronic
1163462280 19:17446244-17446266 AGGGGAAAGAGAATGGATGGTGG - Intronic
1164242211 19:23399548-23399570 AAGGAAAACAAAAGGGGAAGGGG + Intergenic
1164647302 19:29868823-29868845 AGTGAAAACAGAATGAATATTGG - Intergenic
1164823591 19:31268113-31268135 AGGCAAGACAGCATGGGCAGGGG - Intergenic
1166654424 19:44599763-44599785 AGGGAAAGAAGAATGGGCATGGG + Intergenic
1166731074 19:45059385-45059407 GGGGCCCACAGAATGGGTAGGGG - Intronic
1167035276 19:46991567-46991589 AGGAAACACACAATGGGAAGAGG - Intronic
1167505356 19:49868381-49868403 AGGGAAAAAAAAATGGCTGGAGG - Intergenic
1167766389 19:51485507-51485529 AGGGAGAAGAGATTGGGCAGTGG + Intronic
1168127397 19:54293386-54293408 AGGGAAGAGGGAATGGGGAGTGG + Intergenic
1168172960 19:54601462-54601484 AGGGAAGAGGGAATGGGGAGTGG - Intronic
925820446 2:7794581-7794603 AGGGAACACAGTTTGGGGAGAGG + Intergenic
926505525 2:13709871-13709893 AGGGAAAATGAAATGTGTAGTGG + Intergenic
927815707 2:26215333-26215355 AGGGAAATCACAATGAATAGAGG + Intronic
928505205 2:31944521-31944543 AGGGAAAGCAGAATAAGTGGTGG - Intronic
929236167 2:39607692-39607714 AAGGAAAGCAGCATGGTTAGGGG - Intergenic
929386775 2:41417365-41417387 AAGGAATACAGAATGGGTGATGG - Intergenic
929481235 2:42310340-42310362 AGGGAAAAGGGAAGGGGAAGGGG - Intronic
930082090 2:47459105-47459127 AAGTAAAACAGAATGGGCAAGGG - Intronic
930132782 2:47869638-47869660 AAAGAGTACAGAATGGGTAGTGG + Intronic
930196506 2:48516082-48516104 AGAGAAAACAGAAAGGGCAAGGG - Intergenic
930241201 2:48937493-48937515 AGGAAAAAAAGACTGGGGAGAGG - Intergenic
930251086 2:49034717-49034739 AGGGAATACAGAATGGGGCAGGG - Intronic
930295863 2:49552861-49552883 AGGGAAAAGATAATGGGAAAGGG - Intergenic
930412705 2:51047070-51047092 GGGGAGAAGAGAATGGGGAGAGG - Intergenic
930546971 2:52780547-52780569 AGGTAAAACACAATGAGTATAGG + Intergenic
930678440 2:54230172-54230194 AAGGAAAACAAAAGGGGAAGGGG - Intronic
931647542 2:64438233-64438255 AGGGCAAACAGAAAGGTAAGAGG - Intergenic
931786333 2:65622426-65622448 GGGGAAAAGAGAATGAGGAGGGG + Intergenic
932531538 2:72539197-72539219 AAGGAAAAAAGAAGGGGGAGGGG + Intronic
933171670 2:79132311-79132333 AGGGGAAGCAAAATGGGAAGGGG - Intergenic
933587291 2:84193236-84193258 AGGAGAAACAGAAGGGGAAGAGG + Intergenic
933784500 2:85827981-85828003 AGTGGAAAGAGAATGGGGAGTGG - Intergenic
934065314 2:88335360-88335382 AGACAAAACAGGATGGGTAGTGG - Intergenic
934306004 2:91822519-91822541 AGGGAATACAGAATGAATAGTGG + Intergenic
934327252 2:92030223-92030245 AGGGAATACAGAATGAATAGTGG - Intergenic
934465634 2:94260803-94260825 AGGGAATACAGAATAAATAGTGG - Intergenic
934506012 2:94894921-94894943 AAGAAAAATAGAATAGGTAGGGG - Intergenic
934986927 2:98894216-98894238 AGGGAAAGCAGAGTGGGAAGAGG + Intronic
935074664 2:99729370-99729392 AGGGCAAACAGAATAGGTTCTGG + Intronic
935510585 2:103967713-103967735 AGGGAAAGAAGAATGTTTAGAGG + Intergenic
935527152 2:104183974-104183996 AGGAAATACAAAATGGGTAGCGG + Intergenic
936646120 2:114375015-114375037 AGAGAATACAGAATAAGTAGTGG - Intergenic
937137819 2:119570239-119570261 AGGTGAGACAGAATGGCTAGTGG + Intronic
937692588 2:124772765-124772787 AAGGAAAACAGGAAGGATAGAGG - Intronic
937784938 2:125885766-125885788 AGGGAATACAGAATGAGTAGTGG - Intergenic
938192235 2:129294159-129294181 ATGGAAAACAAAAAGGGCAGGGG + Intergenic
938204152 2:129402878-129402900 AGGGAATAGAGAATGGGTAGTGG + Intergenic
938250886 2:129814722-129814744 AAGGAAAACAAAGTGGGAAGGGG + Intergenic
938577869 2:132620670-132620692 AGGGAAAACAGAGAGGCGAGGGG - Intronic
938995500 2:136673671-136673693 AGGGGAAACAGAAAGGGTAGAGG - Intergenic
939069625 2:137523609-137523631 ATGGAAAAAAGAATGGCTATTGG - Intronic
939358926 2:141143393-141143415 AGAGAAATCAAACTGGGTAGGGG - Intronic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
939848549 2:147277117-147277139 AGGGAATAGAGAATAGTTAGTGG - Intergenic
939988844 2:148858673-148858695 AAGGAAAACAGAAGGGGTAATGG - Intergenic
940044840 2:149398794-149398816 AAGTCAAACAGAATGGATAGAGG + Intronic
940939246 2:159538839-159538861 AGGGAAAAAGGAAGGGGAAGAGG + Intronic
940976976 2:159957259-159957281 AGGGAACACAGAAAAGGTTGTGG + Intronic
941387056 2:164866539-164866561 AGGGAATACAGAATGGGTAGTGG + Intergenic
941825962 2:169897373-169897395 AGAGAAATGAGAATGGGAAGAGG - Intronic
942174879 2:173323633-173323655 AGAGAAAAAAGATTGGGAAGTGG - Intergenic
942322211 2:174745501-174745523 AGGAAATACAGAATAGGTAGTGG + Intergenic
942393432 2:175520843-175520865 AGGGAAAGGAGAAAGGATAGTGG - Intergenic
942615548 2:177787707-177787729 ATGGAAAACAAAATAGGCAGGGG + Intronic
943988114 2:194649207-194649229 ATGTAAAACAGAATTGGGAGAGG + Intergenic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
944913152 2:204329639-204329661 AGAGAAAATAGAATGGGCAATGG - Intergenic
946009517 2:216553690-216553712 AAGAAAAACAGAGTGGGGAGAGG - Intronic
947021545 2:225683011-225683033 AGGAAGAACAGAATGGGGGGGGG - Intergenic
947193476 2:227536393-227536415 AAGTAAAACTGAATGTGTAGTGG - Intronic
947368636 2:229422790-229422812 AGGGAAAAAAGAAGGGGTCAAGG + Intronic
947400264 2:229724863-229724885 AGGGAAGCAAGGATGGGTAGCGG + Intergenic
947758290 2:232585275-232585297 AGGAAATACAGAATAGGCAGTGG - Intergenic
948040656 2:234899029-234899051 AGGGAGAACAGAGTGGGAACAGG - Intergenic
948990289 2:241550633-241550655 TGGGAAAAGTGAATGGGGAGGGG + Intergenic
1168789783 20:568354-568376 AAGGAAAGCCGAATGGGGAGCGG - Intergenic
1168956544 20:1838367-1838389 AGGGAAAGCAGCATGGTGAGTGG - Intergenic
1170247778 20:14242941-14242963 AGTGAAAACAAGATGGGAAGAGG - Intronic
1170373406 20:15674230-15674252 AGGGAGAACGGAAGGGGAAGAGG + Intronic
1170937173 20:20820520-20820542 AGGAATAAGAGAATGGGAAGAGG - Intergenic
1172896780 20:38305558-38305580 AGGGAAAAAAAAATGTGCAGTGG - Intronic
1173756420 20:45520788-45520810 AGGCAATACAGAATGGGTAGTGG - Intergenic
1174237605 20:49106915-49106937 AGGGAAAACTTAACGGGTAATGG - Intergenic
1174689338 20:52488483-52488505 AGGAAAAACAAGATGGGGAGTGG - Intergenic
1174931335 20:54818384-54818406 AAGGAATACAGAATGACTAGTGG + Intergenic
1175221166 20:57417327-57417349 AAGGGAAAAAGAATGGGTGGAGG + Intergenic
1176596643 21:8704010-8704032 AGGGAATACAGAATGAATAGTGG - Intergenic
1176943374 21:14950790-14950812 AGGAAAAAGAGAATGGGGAAAGG + Intergenic
1177316938 21:19474410-19474432 GGGGAAAAAAGAATGGAGAGGGG - Intergenic
1177896899 21:26863939-26863961 AGGGAAAACAGACAGAATAGAGG + Intergenic
1178031725 21:28535298-28535320 AAGGAAAACAAAAGGGGGAGGGG + Intergenic
1178395213 21:32236857-32236879 AGTGAAAAGAGAATGGATATGGG + Intergenic
1178507716 21:33176546-33176568 GAGGAACACAGAATGGGGAGTGG - Intergenic
1178634653 21:34291476-34291498 AGGGAAAACAGAATGGGTAATGG + Intergenic
1179457824 21:41511643-41511665 AGGGAACGCAGAGTGGGTAGTGG - Intronic
1180279562 22:10681452-10681474 AGGGAATACAGAATGAATAGTGG - Intergenic
1180586775 22:16899982-16900004 AGGGAATACAGAATGAAAAGTGG - Intergenic
1180724747 22:17938433-17938455 AGGTAATACAGATTTGGTAGGGG + Intronic
1182550933 22:31100425-31100447 AGGGAAACCAGAAAGAGAAGGGG - Intronic
1182742250 22:32576547-32576569 AGGGGAAAGAGAATGGGTTCAGG - Intronic
1183579045 22:38712276-38712298 AGGGAATAGTGAATGGGCAGAGG + Intronic
1184025206 22:41850600-41850622 GGGGAAAAAAGTGTGGGTAGAGG + Intronic
1184541488 22:45128503-45128525 TGGGAATGCAGAATGGGTAGTGG + Intergenic
1184729693 22:46365771-46365793 TGGGAACACAGAAGGGGTAGGGG - Intronic
1185001966 22:48251727-48251749 AGGGAGAACAGAGTAGGTAGGGG - Intergenic
949131685 3:509939-509961 AGGGAAAACAGAAAAAGCAGGGG - Intergenic
949163884 3:913791-913813 TGGGAAAACAAAGTGGGGAGGGG - Intergenic
949284021 3:2380172-2380194 TGTGAAAACACAATGGATAGAGG - Intronic
949445891 3:4133025-4133047 AGGGAATACAGAATGGGTATTGG + Intronic
949615000 3:5743805-5743827 AGGGAATACAGATTTTGTAGTGG + Intergenic
949730841 3:7110965-7110987 GGGGAAGACAGAATGGGTGGAGG + Intronic
950108820 3:10405519-10405541 AGGGAGAAGAGAATAGGAAGGGG + Intronic
951280414 3:20742121-20742143 TGGGAAAGCAGAGGGGGTAGGGG - Intergenic
951856305 3:27200921-27200943 AGAGAAAACAGAAGGGGAAGTGG + Intronic
952418654 3:33112037-33112059 AGGGAGGAATGAATGGGTAGAGG - Intergenic
953019750 3:39106040-39106062 AGGGGATACAGAATGGTGAGTGG - Intronic
953576959 3:44120625-44120647 AGAGCAAACAGAATGGGCAAGGG + Intergenic
953866182 3:46585249-46585271 AGGGGAGGCAGAATGGGTACAGG - Intronic
954076082 3:48182001-48182023 AGGGAAAACAGCATAGATGGTGG - Intronic
954525787 3:51269983-51270005 AGGAAAAAGAGAATGGGTTTTGG - Intronic
954535815 3:51358522-51358544 AGGGAAAAGAGAACGATTAGAGG - Intronic
954927468 3:54248853-54248875 AGGGAATACAGAATGGGTAGTGG + Intronic
955108781 3:55927059-55927081 AGCAAAAACAGAATGGACAGGGG - Intronic
955371819 3:58358370-58358392 AGGGGAAATACAATGGGTATGGG + Intronic
955451631 3:59074561-59074583 ATGGAAAACAGAATGGGGTAGGG + Intergenic
955456882 3:59131644-59131666 AGTGGAATCAGAATGGGTTGTGG + Intergenic
957139648 3:76336400-76336422 AGGAATAAGAAAATGGGTAGTGG + Intronic
959020367 3:101181977-101181999 AGGGTAAACAGACTGTATAGTGG - Intergenic
959325794 3:104934724-104934746 AAGGAAGAGAGAATGGGAAGAGG - Intergenic
959648766 3:108731392-108731414 AGGGAACACAAAATGTGTGGTGG - Intergenic
959651615 3:108756340-108756362 AGGGAAACAAGAATGGGCAAGGG + Intronic
959672070 3:108990043-108990065 AGGCAAGAGAGAATGTGTAGGGG - Intronic
960691950 3:120355695-120355717 AGGGAAGGGAGAATGGGCAGTGG + Intergenic
962194070 3:133342768-133342790 AGGGAGAAGAGAATAGGGAGAGG + Intronic
963378974 3:144505318-144505340 AGGGGATACAGAATGGGTAGTGG - Intergenic
963420780 3:145058333-145058355 AGGGAATACAGAATGAACAGTGG + Intergenic
963947346 3:151160941-151160963 AGGGGAAACACTATGGGAAGAGG + Intronic
964228710 3:154437406-154437428 ATGGAAAACAAAAAAGGTAGGGG - Intergenic
964234557 3:154509991-154510013 AGGGAAAAAGGAAAGGATAGAGG - Intergenic
965708228 3:171531186-171531208 AGGGAACACAGAATGGGTAATGG - Intergenic
965845357 3:172954636-172954658 AGGGCATACAGCATGGGAAGAGG - Intronic
966171603 3:177087746-177087768 AAGGAAAAAAGAATGGGGGGCGG + Intronic
966277774 3:178196478-178196500 AGGGTAAACAGAGTAGGAAGGGG - Intergenic
966549078 3:181184018-181184040 AGCGAAAGCAGTTTGGGTAGAGG + Intergenic
966921266 3:184613146-184613168 CGGGCAACCAGAATGGGGAGGGG + Intronic
969425282 4:7120663-7120685 TTGGAAAACAGGATGGGTGGTGG + Intergenic
969957668 4:10908313-10908335 TGAGAAAACAGAATGGGGAATGG - Intergenic
970006612 4:11416957-11416979 AGAGGAAACAGTATGCGTAGGGG + Intronic
970156411 4:13145862-13145884 AAAGAAAGCAGAATGGGAAGTGG + Intergenic
970524240 4:16915007-16915029 GAGGAATACAGAATGGGTAGTGG + Intergenic
970652889 4:18197953-18197975 TGGGAAAAGAGAATGGAGAGGGG - Intergenic
970754275 4:19405517-19405539 GGGGAAAAAAGAGTGGGGAGAGG - Intergenic
971100744 4:23464458-23464480 AGGGAATACAGAATAGGTAGTGG - Intergenic
971216365 4:24665813-24665835 AGGGCAGACAGAATGGAGAGGGG + Intergenic
972142108 4:35973473-35973495 AGGAAGAACAGAAGGAGTAGAGG + Intronic
972770144 4:42190070-42190092 AGAGAAAAGAGGATGGTTAGTGG - Intergenic
973936485 4:55851749-55851771 GGGAAAATTAGAATGGGTAGTGG + Intergenic
974243396 4:59282245-59282267 AGGGAACACAAAATGGACAGTGG - Intergenic
974779394 4:66533008-66533030 AAGAAAAACAGAATGGATATTGG - Intergenic
974859942 4:67507888-67507910 AAGTGAAACAGAATGGGTATGGG + Intronic
974925306 4:68291451-68291473 AGGCAAAACAGCATGTGCAGGGG + Intergenic
976301036 4:83515868-83515890 AAGGAATACAGAATGTGTACTGG - Intronic
976325817 4:83770556-83770578 AGAAAAAACAGAATGTGTTGAGG + Intergenic
976811045 4:89101736-89101758 AGGGAAAACAGGATGTGAAACGG - Intronic
977014194 4:91671409-91671431 AGGCAAGACAGCATGTGTAGGGG + Intergenic
977651800 4:99478515-99478537 AGGGAACACAGAAAGAGTGGTGG + Intergenic
977687566 4:99865851-99865873 AGGGAAAAAAGAATTGATAAAGG - Intronic
977832957 4:101615876-101615898 AGGGAATACAGACTCTGTAGTGG - Intronic
977889661 4:102294534-102294556 AGAGAAAACATCAAGGGTAGGGG - Intronic
978270186 4:106879118-106879140 AAGGGAAACAGAATGGGAAGGGG + Intergenic
978485669 4:109251273-109251295 AGGGAATACAGAATGAGTGGTGG - Intronic
978644130 4:110908473-110908495 AGTTAAAATAAAATGGGTAGTGG + Intergenic
978665585 4:111177394-111177416 AAGGAATATAGAATGAGTAGTGG + Intergenic
978921972 4:114194848-114194870 GGGGAAAACAGGATGGTTAACGG - Intergenic
979770520 4:124519450-124519472 AGGGAAAAAAGCAGGGATAGGGG + Intergenic
979935560 4:126690263-126690285 AGGTAAAACAGGAAGTGTAGAGG - Intergenic
980659876 4:135843290-135843312 AGGGATTACAGAATAGGAAGTGG + Intergenic
980705214 4:136484487-136484509 AGGTAATATGGAATGGGTAGTGG - Intergenic
981004512 4:139861288-139861310 AGGGAGAAGAGAATGAGTTGAGG - Intronic
981765293 4:148241655-148241677 AGGTAAAATAGAATGGGTGGGGG - Intronic
982161310 4:152572705-152572727 AGGGAAGACAGGATGGCTAATGG + Intergenic
982623063 4:157730925-157730947 AGGGAATACAGAATGGGTAGTGG - Intergenic
982702740 4:158673772-158673794 AAAGAAAACAGAAATGGTAGTGG - Intronic
982740981 4:159056733-159056755 AGGGAAAATAGAATGAGCAGAGG + Intergenic
982772233 4:159407206-159407228 AGGGAATATAGAATGGTTAGTGG + Intergenic
982932017 4:161420248-161420270 AGGGGATACAGAATGAGTAGTGG + Intronic
983166868 4:164488433-164488455 AGAGAAAAGTGAAGGGGTAGAGG + Intergenic
983352159 4:166603450-166603472 AGGAAGGACAGAATGGCTAGAGG - Intergenic
984264970 4:177487524-177487546 AGGGAATTTAGAATGGGTGGTGG - Intergenic
984393247 4:179165919-179165941 AAGGAAAACAAAAGGGGAAGCGG - Intergenic
984445971 4:179836319-179836341 TGGAGATACAGAATGGGTAGAGG + Intergenic
984538978 4:181013500-181013522 TGGGAAAACAGAATGGAAGGTGG + Intergenic
986525389 5:8668532-8668554 AAAGGATACAGAATGGGTAGTGG + Intergenic
986531131 5:8738373-8738395 AGGGAATGCAGAATGGGTAGTGG - Intergenic
987819297 5:22941272-22941294 AGGTGAAACAGAAAGGCTAGAGG + Intergenic
988092692 5:26563257-26563279 GAGGGATACAGAATGGGTAGTGG + Intergenic
988253840 5:28797976-28797998 AGGGAGAACATGGTGGGTAGAGG + Intergenic
988358588 5:30207198-30207220 AGGGAATACCTAATGAGTAGTGG + Intergenic
988782832 5:34539027-34539049 AAGGAAAAGAGAATGGGTTTTGG + Intergenic
989259553 5:39403817-39403839 AAAAAAAACAAAATGGGTAGAGG - Intronic
989344615 5:40415984-40416006 AGTGAAAACAGAATGGGTTCAGG + Intergenic
990335350 5:54767188-54767210 ATGGAAATAAGATTGGGTAGAGG - Intergenic
990359044 5:54999152-54999174 CGAGAAAACAGAATTGGTATGGG + Intronic
990470211 5:56108368-56108390 CTGGAAAACAGGATGGGTTGAGG + Intronic
990636329 5:57731965-57731987 AGAGAAAACAGAATGTGCAAAGG + Intergenic
990847673 5:60162089-60162111 AGGGAAAACAGTGGGGGTGGGGG + Intronic
991097523 5:62754697-62754719 ATGGAAAACAAAAAAGGTAGGGG + Intergenic
991240324 5:64451766-64451788 AGGAATCAGAGAATGGGTAGTGG - Intergenic
991408561 5:66324909-66324931 AGAGAAAAAACACTGGGTAGAGG - Intergenic
991427472 5:66506481-66506503 AGGGAACATGGAATAGGTAGTGG - Intergenic
992097492 5:73376517-73376539 CGGGCAGACAGAAAGGGTAGCGG - Intergenic
992099913 5:73396984-73397006 AGGGAATATGGAATGGGTAGTGG + Intergenic
992196872 5:74348923-74348945 ATGGAAAACAAAATAGGCAGGGG - Intergenic
993223846 5:85139706-85139728 AGGAAAAACAGAGTGTGTATAGG - Intergenic
993238926 5:85353945-85353967 AGGAAAAACAGAAAGGAAAGAGG - Intergenic
993535254 5:89076275-89076297 AGTGAAAACAAAAAGGTTAGGGG + Intergenic
993916642 5:93751853-93751875 GGGGCACACAGAATGTGTAGGGG + Intronic
994284545 5:97948956-97948978 AAGGAAAAGAGAACGGGGAGGGG - Intergenic
995766189 5:115622450-115622472 AGGGAGAAGATATTGGGTAGTGG - Intronic
996258601 5:121437681-121437703 AGGGAATAGGGAATGGTTAGTGG - Intergenic
996381463 5:122866469-122866491 ATGGAATATGGAATGGGTAGAGG - Intronic
996506678 5:124275814-124275836 AGACAAAGAAGAATGGGTAGTGG + Intergenic
996711906 5:126551807-126551829 AGGGAAACCAGATTGGGTAGTGG - Intronic
997071448 5:130627491-130627513 AGGGAAATGAGGATGGTTAGTGG - Intergenic
999124511 5:149237382-149237404 AGGGAAAAGGGAATGGAGAGAGG - Intronic
999272867 5:150307810-150307832 TGGGCAAACAGATTGGGCAGCGG - Intronic
999537968 5:152539323-152539345 AGGGAAACCAGAATGAAGAGAGG - Intergenic
999585190 5:153082081-153082103 AGGGAGAGGAGAAAGGGTAGAGG + Intergenic
1000462268 5:161537470-161537492 AGGGAAGACAGGAAGGGGAGTGG - Intronic
1001863816 5:175085144-175085166 AGGGAAAAAAGCAGGGGTGGAGG - Intergenic
1002024508 5:176388002-176388024 AGAGAAAAAAGACTGAGTAGAGG + Intronic
1002110297 5:176904767-176904789 AGGGATAGCAGAATAGGTAGTGG + Intergenic
1002379837 5:178818598-178818620 AGGGGATCCAGAATGGGTGGAGG + Intergenic
1003023358 6:2530957-2530979 AGGGAATTTAGAATGGATAGAGG + Intergenic
1003177090 6:3760081-3760103 AGGGAAAATACAGTGGGTTGTGG - Intergenic
1004691846 6:17998948-17998970 AGGGAGAAAAGGATGGGCAGTGG - Intergenic
1005225530 6:23638018-23638040 AGGGAATAAGGAATGGGTATTGG - Intergenic
1005464351 6:26097543-26097565 AAGGAATAAAGAATGGGTGGAGG + Exonic
1005605091 6:27468854-27468876 AGGGATAACTGACTGGGCAGAGG + Intronic
1006425120 6:33958893-33958915 AGGGAAAAAGGAAAGGGTGGAGG - Intergenic
1006852096 6:37106034-37106056 AAGGATGACAGCATGGGTAGAGG + Intergenic
1007266641 6:40601274-40601296 AGACAAAACAGTATGGGTGGAGG - Intergenic
1007752700 6:44080039-44080061 AAGGAAATCAAAATTGGTAGGGG + Intergenic
1007921919 6:45617946-45617968 AGGGAAAAGAAAAAGGGGAGGGG - Intronic
1008862982 6:56173377-56173399 AGGGAAAGGAGAAGGGGAAGGGG + Intronic
1009666316 6:66685601-66685623 AGGGAACAAAGAATGAGTAGAGG - Intergenic
1010291872 6:74147079-74147101 AGGGAATACAGAATGGGTAGTGG - Intergenic
1010698637 6:79011480-79011502 TGAGACAACAGAAAGGGTAGGGG + Intronic
1010834097 6:80565734-80565756 AGGGAAAAGTGAATGGCTACAGG + Intergenic
1010869680 6:81021990-81022012 AGAGAAAGGAGAAGGGGTAGGGG - Intergenic
1011345928 6:86369623-86369645 AGAGAAAAGGCAATGGGTAGGGG - Intergenic
1011500986 6:87989543-87989565 AGGGAAAAAAAAGTGGGTAAAGG + Intergenic
1011903539 6:92332119-92332141 AGGGAGAACATCATGGATAGGGG + Intergenic
1011989658 6:93498473-93498495 CTGGGAAACAGAAGGGGTAGTGG - Intergenic
1012002197 6:93666869-93666891 GGGGAATACTGAATGGATAGTGG + Intergenic
1014458073 6:121661153-121661175 GGGAAAAATAGAATTGGTAGTGG - Intergenic
1015381776 6:132578143-132578165 AGGGAGAGCAGAATAGGTAGTGG - Intergenic
1015473173 6:133629425-133629447 AAGGAATACAGAATGAATAGTGG + Intergenic
1015502257 6:133946653-133946675 AGGAAATACAGAATGGGTAGAGG - Intergenic
1015573593 6:134647460-134647482 AGGAAGAACAGAATGGATGGTGG + Intergenic
1016211754 6:141544459-141544481 GGGGAAAACAGGAGGGGCAGGGG + Intergenic
1016647044 6:146422907-146422929 AAGGAAAAAGGAATGGGAAGAGG + Intronic
1017388311 6:153911188-153911210 AGGGAATACTGAATGGGTGGTGG - Intergenic
1018280461 6:162179897-162179919 AAGGAAAAAAAAATGGGAAGAGG - Intronic
1018431802 6:163728799-163728821 AGGGAAAAGACAATGGGAAGTGG - Intergenic
1018506010 6:164469751-164469773 AGGGAAAAACGAATGGGCTGTGG + Intergenic
1019897647 7:3995142-3995164 AAGGAAAGCAGAATGGTGAGTGG - Intronic
1020870908 7:13627928-13627950 AGGGAATACAAAATGGACAGAGG - Intergenic
1021088022 7:16446999-16447021 AGGGAATACAGCATGTGTCGGGG - Intergenic
1021638037 7:22710623-22710645 AGGGAAAACAGAATGAAAAGGGG + Intergenic
1022547855 7:31205680-31205702 AAGGAAAAGAGAATGAGTATGGG - Intergenic
1022733145 7:33050575-33050597 AGAGAAGACAGAATGGGGACAGG + Intronic
1024158940 7:46654793-46654815 AGGGAATACAGAATGGATAGTGG - Intergenic
1024430747 7:49285428-49285450 AGGTAAAAAAGAATGGCTAGAGG - Intergenic
1024721773 7:52144835-52144857 AGGGAATACACAATGGGTGGTGG + Intergenic
1024936859 7:54719609-54719631 AGTGTCAACAGAGTGGGTAGGGG - Intergenic
1026232073 7:68493652-68493674 GGGGAAAGCAGGATGGGAAGAGG - Intergenic
1026544387 7:71309120-71309142 AGGGAAAAAAGACTAGGTAGAGG - Intronic
1027799972 7:82738239-82738261 AGGAAATACAGAATGAGTAGTGG + Intergenic
1028077177 7:86531449-86531471 ATGGAAAACAGAATAAGCAGGGG - Intergenic
1028150521 7:87366306-87366328 AGGGAAAACAGAAAGGGCAGAGG - Intronic
1028190823 7:87849634-87849656 ATAGAAAACAGAATCGGTAAGGG - Intronic
1028726126 7:94089945-94089967 AGGCAAAACAGAAAGCGAAGTGG + Intergenic
1029132461 7:98342791-98342813 AGGGAAAACAGAAATGGTAAGGG - Intronic
1030192484 7:106823549-106823571 AGAGAATACAGAATGGATATTGG - Intergenic
1030192674 7:106824965-106824987 AGGGAATACAGAATGGATATTGG + Intergenic
1030380257 7:108803246-108803268 AGGGAAGAAAGAAGGGGAAGGGG - Intergenic
1030396341 7:108991075-108991097 AAGGAAAACAAAGTGGGAAGAGG + Intergenic
1030529861 7:110699138-110699160 AGGGAAGAAAGAATAGGTAGAGG - Intronic
1031275261 7:119712920-119712942 AGGAAAAACAAAATGGTTTGTGG - Intergenic
1031648025 7:124251505-124251527 AGGGAAAATAAAATGGGAGGGGG + Intergenic
1032332344 7:130992136-130992158 AGGGACAACAGAATGGTTTCTGG + Intergenic
1032472921 7:132191250-132191272 ATGGCAAACAGAATGGGAAAAGG + Intronic
1032488651 7:132307274-132307296 AGCAAAAGCAGAATGGGGAGAGG - Intronic
1032690889 7:134285341-134285363 AGGGAATACAGACTGAGGAGTGG + Intergenic
1033034367 7:137859706-137859728 AGCAAAAACAGAATGCTTAGAGG + Intergenic
1033501701 7:141957534-141957556 AGGCAAAAGAGATTGTGTAGGGG + Intronic
1034291324 7:149934409-149934431 AGGGAATACAGAATGGATCCTGG + Intergenic
1036042097 8:5096731-5096753 AGGGCAAACAGGAAGGCTAGAGG + Intergenic
1036482197 8:9149648-9149670 AGGGAACACAGAATTGTTGGAGG - Intronic
1037017404 8:13925625-13925647 AGGTAAGACAGGATGGCTAGAGG + Intergenic
1037254250 8:16934532-16934554 AGGTAGAACAAAATGGCTAGCGG - Intergenic
1037383398 8:18312198-18312220 AGGGAATACAGAATGGATCATGG + Intergenic
1038301104 8:26349704-26349726 AGGGAAAAGAGAAGGGTTTGTGG - Intronic
1038454172 8:27661694-27661716 AGGGAATACAGAATGGGGAGTGG - Intronic
1038682169 8:29678965-29678987 AGGCAAGACAGTATGTGTAGGGG + Intergenic
1038791614 8:30672885-30672907 AGGGAAAGTGGAATTGGTAGTGG + Intergenic
1039191991 8:34986445-34986467 AGAGAAAACAGAAAAGGCAGAGG - Intergenic
1039816459 8:41099130-41099152 TGGGATATCAGAATGGGGAGGGG - Intergenic
1040511927 8:48103688-48103710 AGAGAAAGCAGAATGGAAAGGGG + Intergenic
1040726086 8:50383584-50383606 AAGGAATAAGGAATGGGTAGTGG - Intronic
1041274190 8:56141286-56141308 AGGGAATACAGAATGGGTAGCGG - Intergenic
1041325776 8:56662505-56662527 AGGAGATACAGAATGGGAAGTGG - Intergenic
1041776243 8:61526363-61526385 AGGCAAAACAGATTGTGGAGAGG - Intronic
1042752951 8:72178321-72178343 AGAGAACACAGAAAGGGTAGTGG + Intergenic
1042765351 8:72315275-72315297 AGAGAACAGAGAAAGGGTAGTGG + Intergenic
1043170611 8:76961438-76961460 AGGGAAGAGAGCATGTGTAGGGG - Intergenic
1044012544 8:87012533-87012555 CCGGAAAACAAAAGGGGTAGGGG - Intronic
1044081021 8:87884031-87884053 AGGGAAAAAGGTTTGGGTAGAGG - Intergenic
1045213628 8:100124817-100124839 AGGGAAAACAGCATTGGCAAAGG + Intronic
1046509025 8:115175532-115175554 AGGTAGAATAGGATGGGTAGTGG + Intergenic
1046954484 8:120048649-120048671 AGGCAAAACAAAATGGAAAGCGG - Intronic
1047649137 8:126900727-126900749 AGGGACAACAGATTTGGGAGGGG + Intergenic
1047847437 8:128823013-128823035 AGGTAAACCAGAATTTGTAGAGG + Intergenic
1048383126 8:133885870-133885892 AGGGGAAAGAGAGAGGGTAGGGG + Intergenic
1048896216 8:138994817-138994839 AGGGAATATAGAATGGGAAGTGG - Intergenic
1049236111 8:141513205-141513227 TGGGAAGACAGAATGGGTACAGG + Intergenic
1049333291 8:142067175-142067197 AGGGAAAACAGTACGGGATGGGG + Intergenic
1050096360 9:2071185-2071207 AGTGATACCAGAATGGGAAGTGG - Intronic
1050375054 9:4962618-4962640 AGGTCACACAGAATGGCTAGAGG + Intergenic
1050495950 9:6242911-6242933 AGGGAAACCAGTATGTGCAGAGG + Intronic
1050545825 9:6707957-6707979 AAGGAATAAAGAATAGGTAGCGG + Intergenic
1050648786 9:7752713-7752735 AGGGATTACTGAATGGGTATGGG + Intergenic
1050731717 9:8716710-8716732 AGGAAGAAGAGAATGGGTGGTGG + Intronic
1051252987 9:15181010-15181032 AGAGAAAAAGGAATGGGTGGAGG + Intronic
1051461787 9:17327064-17327086 AGGGGAAACTGAGTGGGTGGGGG + Intronic
1052165600 9:25323058-25323080 TGCGAAAACAGAAATGGTAGGGG - Intergenic
1052213343 9:25934016-25934038 AGGGAAAACAGAAGGGTAACTGG + Intergenic
1052351008 9:27458230-27458252 AGGGAAAACAGAAGGATTAGTGG - Intronic
1052895251 9:33741666-33741688 TGGGAATACAGAATGGGTAGTGG - Intergenic
1053695698 9:40637583-40637605 AGGGAATACAGAATGAATAGTGG - Intergenic
1053942688 9:43268626-43268648 AGGGAATACAGAATGAATAGTGG - Intergenic
1054306945 9:63436801-63436823 AGGGAATACAGAATGAATAGTGG - Intergenic
1054405676 9:64760789-64760811 AGGGAATACAGAATGAATAGTGG - Intergenic
1054439303 9:65246276-65246298 AGGGAATACAGAATGAATAGTGG - Intergenic
1054491104 9:65775663-65775685 AGGGAATACAGAATGAATAGTGG + Intergenic
1054822879 9:69541254-69541276 ATAGAAAACAGAATGGGGGGGGG - Intronic
1057167625 9:92941140-92941162 AGGGAAAACAGCAGGGGGAAGGG + Intergenic
1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG + Intergenic
1057899367 9:98936214-98936236 AAGGAAATCAGACTGGGTGGGGG - Intergenic
1057979218 9:99641908-99641930 AGGGAAAAGAGAAGGGAGAGAGG + Intergenic
1058454842 9:105129354-105129376 AGGGAAGAGAGTATGGTTAGTGG + Intergenic
1058944184 9:109841580-109841602 AGGGAAAGAAGAGAGGGTAGGGG + Intronic
1059095865 9:111413894-111413916 AGACAAAACAGAATGGATAAAGG - Exonic
1059930847 9:119258972-119258994 GGGGACACCAGAATGGGCAGAGG - Intronic
1060102980 9:120856588-120856610 AGGGAAACCAAAATTGGGAGGGG - Exonic
1060232794 9:121838152-121838174 AGGAAAAACAGAATTGGGAAGGG - Intronic
1060508153 9:124213953-124213975 AGGGAAGACAGAAGGGGAGGTGG - Intergenic
1061056438 9:128225256-128225278 AGGAAAGACAGAAAGAGTAGAGG - Intronic
1202778143 9_KI270717v1_random:11195-11217 AGGGAATACAGAATGAATAGTGG - Intergenic
1185552484 X:994192-994214 AAGGAAAACACAATGGTAAGTGG + Intergenic
1186129019 X:6446348-6446370 AGAGCAAACAGAAGGGGAAGGGG - Intergenic
1186226163 X:7401006-7401028 TGGGAAAAGAAGATGGGTAGTGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1189032218 X:37462415-37462437 AGGGAAAACAGAATGGGTAGTGG - Intronic
1189524507 X:41805637-41805659 AGGGGAAAGAGAAAGGGAAGGGG + Intronic
1189774046 X:44454294-44454316 AGGGAAGGCAGATTGGGTAAGGG - Intergenic
1189817965 X:44843247-44843269 TGGGAAGACAGCATCGGTAGTGG + Intergenic
1190817132 X:53938702-53938724 GGGGCAAACAGAATGGGTGGAGG + Exonic
1190833768 X:54081854-54081876 ATGGAAAAAAGAGTAGGTAGCGG - Intronic
1191101394 X:56732653-56732675 AGGAACAACAGCATTGGTAGAGG + Intergenic
1191154653 X:57259173-57259195 ATGAAAAACAGCATGGATAGAGG + Intergenic
1192053414 X:67747562-67747584 GGGGAAAAAAGGAGGGGTAGGGG + Intergenic
1192508313 X:71704806-71704828 AGGGAAGACAGCATGTGCAGGGG - Intergenic
1192518383 X:71776747-71776769 AGGGAAGACAGCATGTGCAGGGG + Intergenic
1192824749 X:74683308-74683330 AGGGAATATGGAATGGGTAATGG + Intergenic
1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG + Intronic
1193984457 X:88222925-88222947 GGGGAATTCAGATTGGGTAGTGG + Intergenic
1194108558 X:89802473-89802495 AGGAAATACACAATGGGTAGTGG - Intergenic
1194235606 X:91379868-91379890 AGGGAGTACAAAATGGGTAGTGG + Intergenic
1194482850 X:94448029-94448051 AGGGAATGCAGAATGGGTAGTGG + Intergenic
1194649687 X:96499974-96499996 AGGGAATACAGAATGGGTAGTGG + Intergenic
1195758167 X:108219854-108219876 AGGGAATACAATATGGGGAGGGG - Intronic
1196114273 X:111982338-111982360 AGGGAACACAGAATGAGTAGTGG - Intronic
1196393808 X:115237993-115238015 AGTGAAAACACAATGATTAGGGG - Intergenic
1196837805 X:119829448-119829470 AGGGAAGCCAGATTGGGTTGAGG - Intergenic
1196883738 X:120223733-120223755 AGGGAAAAGAGAACAGGCAGTGG + Intergenic
1196894292 X:120319626-120319648 AGGTAAAACAGAATAGAGAGAGG + Intergenic
1197099098 X:122630386-122630408 AGGGAAATGAGAATGGCTAATGG - Intergenic
1197386524 X:125810299-125810321 AGGGAATACAGAATGGGTAATGG - Intergenic
1197691383 X:129504296-129504318 ACAGGAAACAGAATGGGTGGAGG + Intronic
1198069586 X:133134847-133134869 GGAGAAAAGAGAATGGGGAGGGG + Intergenic
1198156715 X:133967944-133967966 AGGGAAAACTGAAAGGGAAATGG + Intronic
1198343529 X:135737916-135737938 AGGGAGTATAAAATGGGTAGTGG - Intergenic
1198648434 X:138835479-138835501 ATGGAAAACAGAAAAAGTAGAGG - Intronic
1199811965 X:151359090-151359112 AGAGAATAGAGAATGGGGAGAGG - Intergenic
1200461216 Y:3457204-3457226 AGGAAATACACAATGGGTAGTGG - Intergenic
1201193464 Y:11469499-11469521 AGGGAATACAGAATGGATAGTGG - Intergenic
1201313742 Y:12622042-12622064 AGGGAAGGCAGAAAGGGAAGAGG + Intergenic
1201895281 Y:18986024-18986046 AGGGAAGCCAGAATGGGCATGGG - Intergenic
1202345045 Y:23913308-23913330 AGGGAAAAGAGAAGGGGAAAAGG + Intergenic
1202525725 Y:25756776-25756798 AGGGAAAAGAGAAGGGGAAAAGG - Intergenic