ID: 1189035684

View in Genome Browser
Species Human (GRCh38)
Location X:37492004-37492026
Sequence CGGCGACAGCGGGCCCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 2, 2: 1, 3: 20, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189035684_1189035692 8 Left 1189035684 X:37492004-37492026 CCGCCCTGGGCCCGCTGTCGCCG 0: 1
1: 2
2: 1
3: 20
4: 165
Right 1189035692 X:37492035-37492057 GTACCACCATCCCAGCTGTGAGG 0: 1
1: 1
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189035684 Original CRISPR CGGCGACAGCGGGCCCAGGG CGG (reversed) Intronic
900113775 1:1020186-1020208 CGGCCGCAGCGGGCCCGGGTGGG - Exonic
900387320 1:2416566-2416588 GGGCGGCACTGGGCCCAGGGAGG + Intergenic
900548505 1:3241876-3241898 AGGCCACAGCAGGCCCAGGGTGG + Intronic
900870466 1:5298545-5298567 CTGCGGCAGCGGGGCCATGGGGG + Intergenic
901250001 1:7771112-7771134 GGGCCACAGGGGTCCCAGGGCGG - Intergenic
901874595 1:12160088-12160110 CCGGGCCAGCGGGCTCAGGGAGG + Intergenic
902477236 1:16694708-16694730 AGGCGATGGCAGGCCCAGGGGGG - Intergenic
902519064 1:17005566-17005588 CAGCGAGAGAGGGCCCAGGTCGG + Intronic
902916838 1:19644550-19644572 CGGCGGCCGCGGGCACCGGGTGG + Intronic
903310629 1:22452264-22452286 GGGCGACAGCGAGCCCCAGGCGG - Intronic
903741120 1:25559258-25559280 CAGGGACAGCTGGCCCTGGGTGG + Intronic
905239353 1:36571988-36572010 GGGGGACAGCTGGACCAGGGTGG - Intergenic
905670714 1:39788622-39788644 CGGCGACCGCGGCCTCAGCGCGG + Exonic
906035314 1:42747079-42747101 CGTTCACAGCAGGCCCAGGGAGG + Exonic
906524393 1:46485883-46485905 GGGCGGGAGCGGGCCCAGGATGG + Intergenic
906524685 1:46487347-46487369 CGGGGACAGCTGGCACAGGTGGG + Intergenic
906650356 1:47508447-47508469 CGGCCGCGGCGGCCCCAGGGAGG - Intergenic
907359943 1:53906304-53906326 TGGGGACAGGGGGCCCAGGGAGG + Intronic
909393116 1:75137137-75137159 CGGGGACAGCGGGGCCGAGGAGG - Exonic
913222108 1:116667791-116667813 AGGCGAGCGCGGGGCCAGGGCGG + Intergenic
922119036 1:222644234-222644256 CGGCGAGGGCGGGGCCAGAGCGG - Intronic
1067071763 10:43137918-43137940 GGGAGACAGAGAGCCCAGGGAGG + Intergenic
1067350024 10:45467032-45467054 CAGTGACAGCGGACCCAAGGAGG + Intronic
1070328906 10:75404521-75404543 CGGCGATAGCGGCCCAAAGGTGG - Intergenic
1071110494 10:82149955-82149977 CTGGCACAGCTGGCCCAGGGTGG - Intronic
1073106032 10:101032423-101032445 CGGCGACAGCGGAGGCAGAGAGG + Exonic
1076851269 10:133094501-133094523 CGGCCACAGCAGCCCCAGGGAGG + Intronic
1076935528 10:133566021-133566043 CAGGAACAGCGGGCCCAGCGGGG - Intronic
1077098534 11:810365-810387 CGGCGGCTGCGGGGCAAGGGCGG - Intronic
1077319803 11:1936090-1936112 CGGCCACAGCGGGCCCCCAGGGG + Intronic
1077419948 11:2445328-2445350 CGGCGGCCGCGGGCCAAGGTCGG - Exonic
1077491504 11:2862926-2862948 CGGCGGGCGCGGGCCCGGGGCGG + Intergenic
1078514119 11:12008585-12008607 CGGCGGCTGCGGGCGCAGAGCGG - Exonic
1079422855 11:20310772-20310794 CGGTGACTAGGGGCCCAGGGAGG - Intergenic
1081621631 11:44622312-44622334 AGCCCACAGAGGGCCCAGGGAGG - Intergenic
1084295804 11:68213041-68213063 GGGGGACCGCGGGCCCAGGCCGG - Intronic
1084307550 11:68296926-68296948 GGGTGACAGCAGGCCCAGGGAGG + Intergenic
1084957269 11:72698003-72698025 AGCCTACAGCGGGCCCAGGAGGG - Exonic
1088429616 11:109744768-109744790 CGGAGACAGCGAGACCTGGGAGG - Intergenic
1089346982 11:117796984-117797006 CGGAGGCGGCGGGGCCAGGGTGG - Intronic
1089800630 11:121024207-121024229 CGGCGACAGCGGTGGCCGGGAGG + Exonic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1091079235 11:132651034-132651056 CGGTTGCAGCAGGCCCAGGGAGG - Intronic
1091208398 11:133835949-133835971 CGGCGGCAGAGAGCCCAGGAAGG - Intergenic
1092391289 12:8082270-8082292 CGCCGACAGCGGACCCAAGATGG + Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096749944 12:53752144-53752166 CGGCGGCAGCGGGCAGAGAGGGG - Intergenic
1096793624 12:54060549-54060571 AGGCGACACCGCGCCCAGGGCGG - Intergenic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1097264689 12:57738364-57738386 CGGCGACAGCGGAGCCGGGCCGG - Intronic
1102197408 12:111034851-111034873 CGGCGGCGGCGGCCCCCGGGTGG - Intronic
1102853895 12:116277308-116277330 CGGGGGCAGCGGGCCCGGGCTGG + Exonic
1103484606 12:121274204-121274226 CTGCAAGAGCGGTCCCAGGGTGG - Exonic
1103828662 12:123762006-123762028 CGGCTGCAGCGGCCCGAGGGCGG + Intergenic
1106248726 13:27968556-27968578 CGGTGGCGGCGGGCCCAGGAGGG + Exonic
1113902025 13:113802819-113802841 GGGCGTCTGGGGGCCCAGGGTGG - Intronic
1115664502 14:35533572-35533594 CGCCGACAGCAGCCACAGGGCGG + Intergenic
1117450111 14:55841765-55841787 AGGCAAGAGCAGGCCCAGGGGGG - Intergenic
1117690395 14:58299351-58299373 CCGCCACCGCGGGCCCGGGGCGG + Intronic
1120898911 14:89558824-89558846 GGGCGACAGCAGGGCCAGGTGGG + Intronic
1121096632 14:91222006-91222028 TGGGGACAGAGGCCCCAGGGTGG - Intronic
1122205020 14:100144091-100144113 CGGTGACAGCCGGCCCAGCGTGG + Exonic
1122876109 14:104666124-104666146 CGGCCACAGAGGCCCCAGCGGGG + Intergenic
1124251030 15:28106693-28106715 CGGCAACAGCGAGCGCAGGGAGG + Intergenic
1125003634 15:34795533-34795555 CGGCGGCAGCGGGCTCTGGGTGG + Exonic
1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG + Exonic
1128145291 15:65329478-65329500 CGGGGACAGCGGGGCCAGCTGGG - Exonic
1129199884 15:73992367-73992389 CGGCGGAAGCGGGCCCCGGCCGG - Intronic
1131263647 15:90903060-90903082 CGGCGTCAGAGGGGCCAGGAAGG + Exonic
1132808334 16:1786094-1786116 AGGCAGCAGAGGGCCCAGGGTGG - Intronic
1132971921 16:2693341-2693363 TGGCCACAGCTGGCCCAGTGCGG - Intronic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1135925410 16:26689598-26689620 AGGTCACAGGGGGCCCAGGGTGG - Intergenic
1138083757 16:54115579-54115601 AGGGGACGGCGGGCCCAGGCAGG + Exonic
1141608576 16:85169240-85169262 CGGCGGCGGCGGGGCCCGGGCGG - Intergenic
1141910853 16:87057514-87057536 GGGAGCCAGCGGGCCCAGAGAGG + Intergenic
1142190486 16:88715049-88715071 CGGCGGCAGGGGGTCCAGTGAGG - Exonic
1142231546 16:88902461-88902483 CGGACACAGCTGGCCCTGGGTGG - Intronic
1142850376 17:2701771-2701793 GGGAGACAGCTGGCCCTGGGTGG - Intronic
1143527217 17:7479586-7479608 CGGCGGCAGCGGGGCCGGGCCGG - Intronic
1144339678 17:14301379-14301401 CGGCGGCCGCGGGCACACGGGGG + Exonic
1148768965 17:50056135-50056157 AGGCGACAGCGCGGCCAAGGGGG + Intronic
1150326682 17:64263317-64263339 CGGCGGCCGCGGGCGCGGGGCGG - Intergenic
1150423207 17:65056701-65056723 CGGCCCGAGCGCGCCCAGGGAGG + Exonic
1150445615 17:65225235-65225257 CGGTGACAGAGGGCCCACGGGGG - Exonic
1151724984 17:75878435-75878457 CGGCCAGAGCGCGCCCAGGCAGG + Exonic
1152132301 17:78484803-78484825 CGGTGAGGGCGGGGCCAGGGCGG - Intronic
1152354684 17:79801069-79801091 CGTGGTCCGCGGGCCCAGGGAGG - Intronic
1152408904 17:80112204-80112226 GGCCGCCAGCGGGCCCCGGGTGG - Intergenic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1154438003 18:14361209-14361231 CGGGGGCAGCTGTCCCAGGGTGG + Intergenic
1160720275 19:594206-594228 CGGTGACACCGGGGGCAGGGAGG - Intronic
1160810408 19:1010692-1010714 AGGCGAGACGGGGCCCAGGGCGG + Exonic
1160832022 19:1108574-1108596 CAGCGCCAGCGGGCGCGGGGCGG + Exonic
1160988002 19:1848411-1848433 CGGCGACCGCGGCGCCAGTGAGG - Exonic
1161041614 19:2113472-2113494 CGGGGACAGCAGGGCCAAGGAGG + Intronic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1162140205 19:8580809-8580831 CGGCCAGAGGGGGCCCCGGGGGG - Exonic
1162604205 19:11694574-11694596 CGGCGACTGCGGGCCCGGGCAGG - Intergenic
1162648185 19:12065100-12065122 CGGCGACTGCGGCCCCAGCCCGG + Intronic
1163176451 19:15566989-15567011 CGGCAACAGGGAGACCAGGGAGG - Intergenic
1163696350 19:18765497-18765519 GGGTGACAGCGGGGACAGGGTGG - Exonic
1164705382 19:30315458-30315480 CTGCTACAGAGGGCCCAGAGGGG - Intronic
1165854378 19:38870906-38870928 TGGCGAGAGCCGGCCCAGGATGG + Exonic
1166245404 19:41522157-41522179 CCGGGACAGCGGGCGCAGCGTGG + Intergenic
1166807667 19:45496872-45496894 CCGCGACCCCGGGCCCAGGGCGG - Exonic
1167019191 19:46861356-46861378 CGGGGACGGCGGGGCCCGGGGGG - Intergenic
1167502281 19:49854971-49854993 CCGGAACAGGGGGCCCAGGGTGG - Exonic
1167622736 19:50568299-50568321 CGGCGCCGGCGGGCCCGAGGAGG - Intergenic
1168154458 19:54465141-54465163 GGGCGGCAGCGGGCCTGGGGGGG + Exonic
1202711252 1_KI270714v1_random:20534-20556 AGGCGATGGCAGGCCCAGGGGGG - Intergenic
926197563 2:10772977-10772999 CGGCCACAGCGGGAGCCGGGAGG + Intronic
927964743 2:27262143-27262165 CCGGGACAGCGGGCCGGGGGTGG - Intronic
931052301 2:58428473-58428495 CGCCGGCCGCGGGCCCGGGGCGG + Intergenic
935255748 2:101308375-101308397 CGGCGACAGCTCGCCCAAGGAGG - Exonic
937208621 2:120252990-120253012 CGGCGCCCGCGGGCCCCGGGCGG + Intronic
937428093 2:121816503-121816525 CTGCCACAGAGGGCCAAGGGTGG - Intergenic
942241233 2:173965080-173965102 CGGCGGCAGCGGCCCCGGGCTGG + Intronic
942681365 2:178480682-178480704 CCGGGACAGCGGGCGCAGCGTGG - Exonic
944064136 2:195601583-195601605 CGGGGACATCTGGCCAAGGGAGG - Intronic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
946321128 2:218955183-218955205 GGGCGCCAGCGGGGCCTGGGAGG + Intergenic
948370698 2:237487455-237487477 AGGGAACAGCGGGGCCAGGGTGG + Intronic
949056948 2:241932877-241932899 CGGCGACCCCTGTCCCAGGGAGG - Intergenic
1172486825 20:35303562-35303584 AGGCCACAGCAGGCCCTGGGGGG + Exonic
1172771332 20:37384288-37384310 CGGCCACCGCGGCCCCAGCGCGG + Exonic
1173918399 20:46726218-46726240 CGGGCAGAGGGGGCCCAGGGAGG - Exonic
1175404380 20:58717119-58717141 CGGCGTCGGGGGGCCCACGGGGG + Intronic
1176190730 20:63808403-63808425 GGGCGGAAGCGGGGCCAGGGCGG + Intronic
1176457675 21:6928260-6928282 CGGGGGCAGCTGTCCCAGGGTGG - Intergenic
1176835847 21:13793344-13793366 CGGGGGCAGCTGTCCCAGGGTGG - Intergenic
1179584884 21:42368080-42368102 CGGGGGCACCAGGCCCAGGGTGG + Intergenic
1179959333 21:44759357-44759379 CGGCCTCAGCGGGCTCAGGGAGG - Intergenic
1183384315 22:37506205-37506227 CAGCTGCAGCGGGCCCAGGGTGG - Exonic
1184101540 22:42343861-42343883 CGGGGAGAGCGGGCGGAGGGCGG + Intergenic
1185376741 22:50486135-50486157 CGGGGTCGGCGGGCCCAGCGAGG - Exonic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
960902224 3:122564434-122564456 CGGGGACGGCGGGCGCAGGTGGG - Exonic
968486860 4:867067-867089 CGGCCTCAGGGGGCCCAAGGAGG + Exonic
968674734 4:1871421-1871443 CGGCGGCGGCGGGCGCAGCGCGG - Intronic
968816844 4:2825970-2825992 TGGGGACAGGAGGCCCAGGGAGG + Intronic
969379308 4:6783365-6783387 CGGCGACACCTGCCCCAGGCAGG - Intronic
969567175 4:7985389-7985411 AGGGAACAGAGGGCCCAGGGTGG - Intronic
971030700 4:22634640-22634662 CGGCCTCGGCCGGCCCAGGGAGG - Intergenic
972725870 4:41746091-41746113 CGGCGGCGGCGGGCCCAGCCCGG - Exonic
975801068 4:78059115-78059137 CGGCGGCGGCGGGCGCAGGGCGG + Intronic
981174770 4:141668280-141668302 CAGAGACACCTGGCCCAGGGAGG - Intronic
985190481 4:187367128-187367150 CGGAGACTGCGGACCCAGCGTGG + Intergenic
985533565 5:448322-448344 CGGTGCCAGCTGGCCCTGGGTGG + Intronic
985716178 5:1463292-1463314 CGGCGGCAGCGTGCACCGGGCGG - Exonic
990148407 5:52788374-52788396 AGGCGACAGCGACCCCTGGGCGG - Exonic
991054483 5:62306436-62306458 CAGCAGCAGCGGGCCGAGGGAGG - Exonic
991900567 5:71455853-71455875 CGGAGGCAGGGGGCCCGGGGAGG - Exonic
994072736 5:95620479-95620501 CGGCGGCGGCGGGCCCTGGGCGG + Exonic
997869933 5:137498342-137498364 CGGCGCCACCCGGCCCTGGGGGG - Intronic
1002297724 5:178240613-178240635 CGGGGACAGCAGGGGCAGGGTGG - Intronic
1002897907 6:1389901-1389923 CCGCGAGGGCGGGCCCCGGGCGG - Exonic
1003984025 6:11417412-11417434 CGGCCTCAGCTGGCCCAGAGAGG + Intergenic
1006682216 6:35805391-35805413 CGGCGCCAGCAGGCCCTGGTGGG + Exonic
1015031581 6:128601975-128601997 AGGCGACAGAGGGACAAGGGAGG - Intergenic
1017344966 6:153369843-153369865 CGGTGACTACAGGCCCAGGGCGG - Intergenic
1019019129 6:168902828-168902850 GGGAGAGAACGGGCCCAGGGAGG + Intergenic
1019577819 7:1746029-1746051 CTGGGACAGCGGGGCCAGGCCGG - Exonic
1021969454 7:25951656-25951678 AGGAGACACCGGGCCCAGGCAGG - Intergenic
1025143300 7:56483584-56483606 AGGCGACAGCGGGACCAGGGTGG - Intergenic
1025710057 7:63900456-63900478 AGGCGACAGTGGGACCAGGGCGG - Intergenic
1029206186 7:98870368-98870390 CGGCGGCATCGGATCCAGGGCGG - Intronic
1034422790 7:150998135-150998157 GGGAGACACCTGGCCCAGGGAGG + Intronic
1034455497 7:151167808-151167830 CGGCGGCGGCGGGCGGAGGGAGG - Intronic
1035266071 7:157690899-157690921 CGGCGCGGGCGGGCTCAGGGCGG + Intronic
1035751794 8:2001762-2001784 CGCCTACAGCGGGCGCATGGCGG + Exonic
1036663776 8:10725990-10726012 CGGGGAAAGCTGGCCCAGGTGGG + Exonic
1049222215 8:141433341-141433363 AGGCGACAGTGTGTCCAGGGTGG + Intergenic
1051146210 9:14030218-14030240 TGGCGGCGGCGGGGCCAGGGAGG + Intergenic
1056135158 9:83623464-83623486 CGGCGACCGCAGGCTCAGGGAGG + Intronic
1057208183 9:93185343-93185365 CCCCGACGGCGGCCCCAGGGAGG + Exonic
1057740775 9:97709550-97709572 CGGCTGCAGCAGGCCCAGTGAGG + Intergenic
1059000367 9:110342330-110342352 CTGAGTCAGCGGGTCCAGGGTGG - Intergenic
1060183886 9:121552205-121552227 AGGCGACCGCGTGCACAGGGAGG - Intergenic
1061861131 9:133469304-133469326 GGGCCCCAGCAGGCCCAGGGAGG - Exonic
1061889312 9:133609261-133609283 AGGCGACTGCGTGCCCAGGCGGG + Intergenic
1062576936 9:137213295-137213317 TGCCGACAGCGTTCCCAGGGAGG + Intronic
1189010719 X:37043551-37043573 CTGCGACAGCGGGCCCAGGGCGG + Intergenic
1189035684 X:37492004-37492026 CGGCGACAGCGGGCCCAGGGCGG - Intronic
1189037174 X:37505317-37505339 CTGCGACAGCGGGCCCAGGGCGG - Intronic
1196669101 X:118346655-118346677 CGGACACAGCGGGACCTGGGAGG - Intronic
1196886430 X:120250776-120250798 CGCCGACAGAGGGCACAGCGCGG - Exonic
1199846428 X:151695347-151695369 GGGCGACAGGGTGCCCGGGGCGG + Intronic
1199930967 X:152521128-152521150 CAGCAACAGCAAGCCCAGGGAGG + Intergenic