ID: 1189036398

View in Genome Browser
Species Human (GRCh38)
Location X:37497317-37497339
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189036398 Original CRISPR CAGGGTAATCACATGGTTTC TGG (reversed) Intronic
902000683 1:13191499-13191521 CAGGCGAATCACCTGGTGTCGGG + Intergenic
903780078 1:25815365-25815387 CAGGGTGATGAGATGGTGTCGGG + Intronic
904629734 1:31831850-31831872 CAGGGTAGTGTCATGGTCTCTGG + Intergenic
904674741 1:32192083-32192105 CTTGGTAAGCACATGGTTTATGG - Intronic
908346330 1:63237305-63237327 CAGGGGAATCACATGAGGTCAGG + Intergenic
908822170 1:68099789-68099811 CAAGGTAAGGACATGGATTCTGG + Intronic
911182078 1:94870222-94870244 CAGCATAAACACATGGTTGCTGG - Intronic
911549901 1:99265582-99265604 TAGGGAAATCAGATGGTTTTAGG + Intronic
915847599 1:159284148-159284170 CAGGGTAATCAAAAGGTTATAGG + Intergenic
919470619 1:197974675-197974697 CAGGATATTCACATAATTTCAGG + Intergenic
920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG + Intronic
921128189 1:212196475-212196497 CAGGGGAATCACATGGTGAAAGG - Intergenic
1070114492 10:73515873-73515895 CAGGGAAATCACTTGAATTCGGG - Intronic
1076299601 10:129415001-129415023 CAGCGTATTGACATGGTGTCTGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1080549292 11:33357330-33357352 CAGGGTCATCTTATGGTTGCAGG - Intergenic
1081879816 11:46439041-46439063 CAGGGTAATCACTTGAGGTCAGG + Intronic
1085781419 11:79412393-79412415 CAGGGAAATCACTTGGTAACTGG - Intronic
1085847128 11:80078606-80078628 AGGGGTAATTACATGGTTTCTGG + Intergenic
1086571670 11:88291953-88291975 CAGTCTAATCGCATGGTTTGTGG + Intergenic
1090292655 11:125558990-125559012 CAGGTTAATCACATGAATCCAGG + Intergenic
1090683684 11:129090335-129090357 TGGGTTAATCACTTGGTTTCAGG - Intronic
1091673380 12:2468581-2468603 GAGGGGAATCACATTGCTTCTGG + Intronic
1092938928 12:13389719-13389741 CAGGGTGGTGAGATGGTTTCAGG - Intergenic
1093795410 12:23304313-23304335 AAGGGTACTCACAGTGTTTCTGG - Intergenic
1094127597 12:27039741-27039763 CAGGGTAATCACTTGAATCCGGG - Intronic
1095315260 12:40753112-40753134 CAGAGTATTCACATGGTTGCAGG - Intronic
1095568727 12:43657293-43657315 AGAGGTAAGCACATGGTTTCAGG - Intergenic
1098391366 12:69972966-69972988 CTGGGAAAACACATGGATTCTGG + Intergenic
1098944058 12:76570963-76570985 CAGGGTAACCAAATAGTTCCAGG - Intergenic
1102396296 12:112589067-112589089 CAGGAGAAACACAGGGTTTCTGG + Intronic
1104062973 12:125283544-125283566 CATGGTAATTACATGTTTCCCGG - Intronic
1110091821 13:71460494-71460516 CAGTGTATTTACATGTTTTCTGG + Intronic
1110722930 13:78785968-78785990 CAGGGGAAAGCCATGGTTTCGGG - Intergenic
1117386940 14:55224743-55224765 CAGGGAAATGACATGATGTCTGG - Intergenic
1119617637 14:76109371-76109393 CAAGGTACTCACAGGGTGTCTGG - Intergenic
1119782421 14:77285603-77285625 CAGGGGACTCAAATGATTTCTGG - Exonic
1120581209 14:86252146-86252168 CAGAGTAATCCCAGGGCTTCAGG - Intergenic
1122188063 14:100017062-100017084 CAGAGTAATGACATGGATTCCGG - Intronic
1122499034 14:102182969-102182991 CAGGGTAATCACATGAACCCAGG + Intronic
1125923604 15:43542516-43542538 CAGGGGAATCACTTGAGTTCAGG - Intronic
1129279204 15:74470531-74470553 CAGGGTAGGGAGATGGTTTCAGG + Intergenic
1130788608 15:87127405-87127427 CAGGATAAGGACATGGTCTCTGG - Intergenic
1130909195 15:88259365-88259387 CAGGGAAATGACAAGCTTTCTGG + Intergenic
1131410923 15:92207829-92207851 CAGGCTAAAGACATGGTGTCAGG + Intergenic
1133063567 16:3190521-3190543 CAGGTTAATCACCTGATGTCAGG + Intergenic
1133814619 16:9187130-9187152 AAGGGTAGGCAGATGGTTTCTGG + Intergenic
1133861342 16:9598249-9598271 CATGATAAGCAAATGGTTTCTGG - Intergenic
1133926223 16:10194716-10194738 CAGGGGAATCACATGAGCTCAGG + Intergenic
1134069926 16:11254758-11254780 GAGGGTACCCACATGGTTCCAGG + Exonic
1136404294 16:30035002-30035024 CAGGGGAATCACATGAACTCGGG - Intronic
1138321241 16:56113909-56113931 CAGGGTAATCAAAAGTATTCTGG + Intergenic
1141851484 16:86649304-86649326 CAAGGTCATCACATGGGCTCTGG + Intergenic
1148158847 17:45438647-45438669 CAGGGGAATCACTTGAATTCGGG - Intronic
1148428360 17:47620541-47620563 CAGGATAATCCCCAGGTTTCTGG + Intronic
1149460481 17:56826045-56826067 CAGGAGAATCACATGAGTTCAGG - Intronic
1151764951 17:76128434-76128456 CATGGCAATCACATGGTGTCTGG + Intergenic
1154332891 18:13444072-13444094 CAGGGTAATCAAATCGTTGATGG - Intronic
1156933803 18:42678355-42678377 CAGTGTTATAACCTGGTTTCTGG - Intergenic
1161757538 19:6145301-6145323 CAGGGGAATCACATGATCCCAGG + Intronic
1161904763 19:7148568-7148590 CAGGAGAATCACTTGATTTCTGG - Intronic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165121376 19:33561026-33561048 CAGGGTCATTACTGGGTTTCAGG + Intergenic
1168031604 19:53684144-53684166 CAGGCTAATCACCTGGAGTCAGG + Intergenic
1168710037 19:58494282-58494304 CAGGAGAATCACTTGGTTCCGGG + Intronic
926617382 2:15010615-15010637 CTGGGGATTCACATGGTTACTGG - Intergenic
927664085 2:25017679-25017701 CAGGGTAATCACTTGAGGTCAGG - Intergenic
929019797 2:37540354-37540376 CAAGGTAATTTGATGGTTTCAGG + Intergenic
933574971 2:84057069-84057091 CAGGGAGCTCACATGGTTTTTGG + Intergenic
936838105 2:116732557-116732579 CAGGGAAAGGACCTGGTTTCTGG - Intergenic
938573183 2:132581405-132581427 CAGAGCCATCACATGGTTTCTGG - Intronic
940115787 2:150206726-150206748 CAGGTGAATCACATGGGGTCAGG + Intergenic
940124163 2:150305114-150305136 CAGGATAATCACTTGGACTCAGG - Intergenic
941277612 2:163509973-163509995 CAGGCAAATGACATGGTTTATGG - Intergenic
942197526 2:173536486-173536508 CAAGGTAAGGACCTGGTTTCGGG - Intergenic
943577419 2:189647046-189647068 AATGGTTTTCACATGGTTTCTGG - Intergenic
946784673 2:223230417-223230439 CAGGGGAATCACTTTGTCTCTGG - Intergenic
947943039 2:234075605-234075627 CTGGGTAACATCATGGTTTCAGG - Intronic
1169645148 20:7802199-7802221 CAGGGTAGACACATGTTCTCAGG + Intergenic
1174129267 20:48330071-48330093 CAGGGGGAGCACATGGTCTCTGG - Intergenic
1175916286 20:62427448-62427470 CCGGGTACTCACATGGCTCCTGG + Exonic
1177268377 21:18812805-18812827 CAGGAGAATCACTTGATTTCGGG - Intergenic
1178315924 21:31566793-31566815 GAGAGTAAACACATGGTTTGAGG - Intergenic
1182934946 22:34211982-34212004 CATGGTATTCACATGGTAGCTGG + Intergenic
1183705776 22:39474182-39474204 CGGGGTGCTCACATGGTTTCAGG + Intronic
1185212120 22:49576253-49576275 CAGGGGAAAGACATGCTTTCTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
956326016 3:68054040-68054062 CAGAGAAATCACAAGTTTTCTGG + Intronic
958441905 3:94165377-94165399 CAGGATGATGCCATGGTTTCTGG - Intergenic
959220297 3:103510017-103510039 CAGAGAAATCACATTGTTTAAGG + Intergenic
959325576 3:104932634-104932656 CAGGGAGAATACATGGTTTCAGG + Intergenic
962933054 3:140055214-140055236 CAGAGTAAGAAAATGGTTTCTGG - Intronic
963463233 3:145644229-145644251 CAGTGTATTCAGCTGGTTTCAGG + Intergenic
965874688 3:173301894-173301916 CAGGGTAACCCCTGGGTTTCTGG + Intergenic
966316869 3:178657166-178657188 CAGGGAAAACATATGGGTTCTGG - Intronic
966663022 3:182436042-182436064 CAAGGTGATCACCAGGTTTCTGG + Intergenic
968241856 3:197096424-197096446 CAGGGTAATGCCTTGGTTTCAGG - Intronic
969945933 4:10783163-10783185 CAAGGTATTCACCTGGCTTCTGG - Intergenic
970237183 4:13970834-13970856 AAGGGAAAGCACTTGGTTTCAGG - Intergenic
970955626 4:21807592-21807614 CAGGTTATTAACATGTTTTCTGG - Intronic
971053099 4:22883136-22883158 CAGGACAATAACATGGTTCCTGG + Intergenic
976978514 4:91194060-91194082 CAGGAGAATCACTTGGATTCGGG - Intronic
977732718 4:100373398-100373420 CAGGGAAATGAAATGGGTTCAGG + Intergenic
978750240 4:112237853-112237875 CAGGGAGATAATATGGTTTCAGG - Intronic
979190422 4:117849927-117849949 CTGGGCAATCACCTGGCTTCTGG - Intergenic
983759194 4:171384571-171384593 CAGGGAAACCACATAGTTTGGGG - Intergenic
984958858 4:185074592-185074614 CAGGAAACTCACATGTTTTCTGG - Intergenic
987288390 5:16483772-16483794 CAGGTTAATCATAGGGTTCCAGG + Intronic
989816286 5:45741577-45741599 CAGGATAATCATATGTTTTCAGG - Intergenic
992561136 5:77954139-77954161 CAGGCTGATCACCTGGGTTCAGG - Intergenic
997314379 5:132920140-132920162 CAGGGGAATCACATGAACTCAGG - Intronic
1004583029 6:16972847-16972869 CATGGAAATCACATGGCTTTGGG - Intergenic
1004703952 6:18105280-18105302 CCTGGTAAACACATGGTTTAGGG - Intergenic
1005287125 6:24339720-24339742 CAGAGTAATTACATGGTGCCTGG + Intronic
1005928026 6:30460870-30460892 CAGGACAATAACATTGTTTCTGG + Intergenic
1008431204 6:51419419-51419441 CAGGCTAAGCACATCCTTTCTGG + Intergenic
1009965183 6:70570413-70570435 CAGGAGAATCACTTGATTTCGGG - Intronic
1011785167 6:90835669-90835691 CAGGTAAGACACATGGTTTCTGG - Intergenic
1013051458 6:106539448-106539470 CAGGGTATTCACCAGGTTCCAGG - Exonic
1013832844 6:114294754-114294776 CATGGTATTAACATTGTTTCAGG - Intronic
1016372474 6:143389783-143389805 CAGTAGAATCACATGGCTTCAGG + Intergenic
1016873214 6:148839068-148839090 CAGAGTAATCACCTGGAATCTGG + Intronic
1023927382 7:44679530-44679552 CAGGGTAATCACAAGAACTCAGG + Intronic
1028902571 7:96117942-96117964 CAGGGTAATCAAATGCTTTCAGG - Intergenic
1030097287 7:105911574-105911596 CAGGGGAATCACCTGAGTTCAGG + Intronic
1030756712 7:113294905-113294927 CAGGGTAATCCCCAGGCTTCTGG - Intergenic
1032449573 7:132018273-132018295 CAGGGTAATCACTTGAATCCAGG - Intergenic
1032853515 7:135815333-135815355 CAGCTCAGTCACATGGTTTCAGG - Intergenic
1033573528 7:142657374-142657396 CAGAGTCATCACATGGCTTGGGG - Intergenic
1035585885 8:773231-773253 CAGTGTTTTCACATGGTCTCTGG + Intergenic
1035892421 8:3359311-3359333 CAGGATCATCACATGGCTCCAGG + Exonic
1046588043 8:116171711-116171733 CAGGGCAATCACATGAATCCAGG + Intergenic
1047412409 8:124634653-124634675 CAAGGAAATCAGAAGGTTTCTGG - Intronic
1052224164 9:26064381-26064403 CAGGGTCGTGATATGGTTTCTGG - Intergenic
1053227910 9:36377476-36377498 AAGGGAAATGACATGGTTTTTGG - Intronic
1060051951 9:120384108-120384130 GAGCTTAATTACATGGTTTCAGG - Intergenic
1060751056 9:126169841-126169863 CAGGGGAAGCACATGCGTTCTGG + Intergenic
1061121573 9:128646434-128646456 CAGGCTGATCACCTGGGTTCAGG - Intronic
1061877593 9:133552547-133552569 CAGGGGAATGAAATAGTTTCTGG + Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1195317304 X:103691611-103691633 CAGTGTTTTCCCATGGTTTCTGG + Intergenic
1195327656 X:103771105-103771127 CAGAGAAATGAGATGGTTTCCGG - Intergenic
1195637634 X:107135493-107135515 CAGGGTAATCTCACAGTATCAGG - Intronic
1197022472 X:121708113-121708135 CAAGATAATCATATGGTTTTAGG + Intergenic
1197146562 X:123178656-123178678 GATGGAAATCACATGGCTTCAGG - Intergenic
1198822939 X:140668248-140668270 CAGGATAATCACTTGAATTCGGG - Intergenic
1199691098 X:150309588-150309610 CAGGATAATCTCCTCGTTTCAGG + Intergenic
1201576951 Y:15470996-15471018 CATGGAAATCACATGATTTTGGG - Intergenic