ID: 1189037322

View in Genome Browser
Species Human (GRCh38)
Location X:37506143-37506165
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 2, 1: 2, 2: 3, 3: 39, 4: 392}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189037314_1189037322 -7 Left 1189037314 X:37506127-37506149 CCATCTGCATGCAGCTCAGGATC 0: 5
1: 1
2: 1
3: 19
4: 202
Right 1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG 0: 2
1: 2
2: 3
3: 39
4: 392
1189037312_1189037322 -5 Left 1189037312 X:37506125-37506147 CCCCATCTGCATGCAGCTCAGGA 0: 5
1: 0
2: 1
3: 31
4: 334
Right 1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG 0: 2
1: 2
2: 3
3: 39
4: 392
1189037310_1189037322 -1 Left 1189037310 X:37506121-37506143 CCTGCCCCATCTGCATGCAGCTC 0: 4
1: 1
2: 7
3: 38
4: 440
Right 1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG 0: 2
1: 2
2: 3
3: 39
4: 392
1189037308_1189037322 8 Left 1189037308 X:37506112-37506134 CCATTCAGCCCTGCCCCATCTGC 0: 2
1: 1
2: 5
3: 50
4: 521
Right 1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG 0: 2
1: 2
2: 3
3: 39
4: 392
1189037313_1189037322 -6 Left 1189037313 X:37506126-37506148 CCCATCTGCATGCAGCTCAGGAT 0: 6
1: 0
2: 1
3: 15
4: 177
Right 1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG 0: 2
1: 2
2: 3
3: 39
4: 392
1189037307_1189037322 20 Left 1189037307 X:37506100-37506122 CCAGCAGTCTTTCCATTCAGCCC 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG 0: 2
1: 2
2: 3
3: 39
4: 392
1189037309_1189037322 0 Left 1189037309 X:37506120-37506142 CCCTGCCCCATCTGCATGCAGCT 0: 4
1: 0
2: 3
3: 42
4: 441
Right 1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG 0: 2
1: 2
2: 3
3: 39
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900507262 1:3035982-3036004 CAGGCTGTGTGGGGGTGGTGAGG - Intergenic
900546368 1:3231500-3231522 CAGGGGATGCGGGGGTCGAGAGG + Intronic
901171872 1:7265004-7265026 CAGGGCCTGCAGGGGTGGGGAGG + Intronic
902936698 1:19769726-19769748 CGGGAGCTGTGGGGGTGGGGAGG + Intronic
903930144 1:26857212-26857234 CCTGATCTGAGGGGGTGGAGGGG - Exonic
904659323 1:32073006-32073028 CAGGAGCTGCGGCGGCGAAGCGG + Exonic
904676247 1:32200957-32200979 CGGGGTCTGCGGGTGTGGGGAGG - Intronic
905228415 1:36494903-36494925 CAGGAGCTGTGGGGGTGAGGGGG - Intergenic
905337491 1:37255567-37255589 CAGTCTCTGCTGGCGTGGAGGGG + Intergenic
905352331 1:37356377-37356399 TAGGTCTTGCGGGGGTGGAGTGG - Intergenic
906090231 1:43172524-43172546 AAGGAGCCGCGGGGGTGGGGTGG + Exonic
906102437 1:43272167-43272189 GAGGAGCTGTGGGGATGGAGGGG - Exonic
906105198 1:43287365-43287387 CACCATCTGCAGGGGTGCAGTGG - Intergenic
906528234 1:46508825-46508847 CAGGGACTGCAGGGGTGGTGGGG - Intronic
906686420 1:47766076-47766098 CAGGGGCAGCGGGGGTGGTGAGG + Exonic
910771372 1:90835708-90835730 CAGGAACTGGGGAGGAGGAGCGG + Intergenic
911210401 1:95132869-95132891 CAGGATCTGATGTTGTGGAGAGG + Intronic
911598351 1:99822234-99822256 CAGGATCTGTGTGGGGGTAGTGG - Intergenic
912458481 1:109815661-109815683 CAGGATGCCAGGGGGTGGAGTGG + Intergenic
913058233 1:115181545-115181567 CAGGTTCTTGTGGGGTGGAGGGG - Intergenic
915130566 1:153693010-153693032 CAGGGACTGTGGGGGTGGACAGG - Intronic
915591836 1:156875282-156875304 TGGGCTCTGTGGGGGTGGAGGGG + Intronic
916051377 1:161039009-161039031 CAGGTGCTGCGGGGGCGGCGCGG - Intergenic
917021011 1:170586887-170586909 CAGACTTTGCGGGGGTGGAGGGG + Intergenic
917194520 1:172451234-172451256 CAGGAATTGAGAGGGTGGAGTGG - Intronic
917532654 1:175850829-175850851 CAGGAGCTGTGGGGGATGAGGGG + Intergenic
917630295 1:176884961-176884983 CAGGATCTGCCGTGCTGGTGGGG + Intronic
917703997 1:177613075-177613097 CAGGATCTGCTGTGGGAGAGAGG - Intergenic
917971225 1:180209078-180209100 CAGGCACTGGGGGGCTGGAGGGG + Intergenic
918120110 1:181530828-181530850 CAGGAGCTGCTGGGCTGGAGAGG + Intronic
918811508 1:189127443-189127465 CAGTATCTGCAGGGCTTGAGAGG + Intergenic
920194017 1:204214056-204214078 CGTGGTGTGCGGGGGTGGAGCGG - Exonic
922192746 1:223333701-223333723 CAGGTTCTGCAGAGGTGGGGAGG + Intronic
922345641 1:224694069-224694091 CTGGATCTGTGGAGGAGGAGAGG + Intronic
922689317 1:227675231-227675253 CAGGATGGGCAGGAGTGGAGGGG - Intronic
922998397 1:229985122-229985144 CAGGTGCTGTGGGGGTGGGGTGG - Intergenic
923513084 1:234670341-234670363 CAGGATTTGCTGTGGTGGAGAGG - Intergenic
924949338 1:248867817-248867839 CAGGGTCTGCTGGGGTGGCCTGG - Intergenic
1062848531 10:726157-726179 TAGGAACTGAGGGTGTGGAGGGG + Intergenic
1063188351 10:3670266-3670288 CAGGAGGTGAGGAGGTGGAGAGG - Intergenic
1063375910 10:5554064-5554086 GAGGATCTGTGGGGGAGCAGGGG - Intergenic
1063644442 10:7865136-7865158 CAGGAGCTTCAGGAGTGGAGAGG + Intronic
1065099154 10:22316582-22316604 CTGGATCCGCCGGGGTGGAGGGG + Intronic
1068535379 10:58235660-58235682 CAGGGGCTGCGGGGCTGGGGAGG + Intronic
1068752577 10:60612176-60612198 CAGGAGCTGCAGGGGCTGAGTGG + Intronic
1070175437 10:73965745-73965767 GAGAGTTTGCGGGGGTGGAGGGG + Intergenic
1070503923 10:77096511-77096533 CAGGTTCTGCGAGGGCGGGGAGG + Intronic
1070780182 10:79132981-79133003 CAGGCTCTGGGGTGGGGGAGGGG + Intronic
1070965799 10:80529535-80529557 TAGGATCTGCGGAGATGGACAGG - Exonic
1071506320 10:86233912-86233934 CAGGAAATGAGAGGGTGGAGAGG + Intronic
1071959443 10:90795832-90795854 AGGGATCTGTGGGGGTTGAGGGG + Intronic
1073351358 10:102822382-102822404 CTGGCTCTGCGGGGACGGAGTGG + Intergenic
1073967813 10:109011724-109011746 CAGGATCTGAAGCTGTGGAGGGG + Intergenic
1074461422 10:113641326-113641348 CAGGGTCTGTTGGGATGGAGTGG - Intronic
1075675676 10:124294226-124294248 CGGGAGCAGTGGGGGTGGAGGGG - Intergenic
1076358434 10:129869393-129869415 CAGGAGCTGGCGGGGTGGTGGGG - Intronic
1076679242 10:132163195-132163217 CAGGATGTGCTGGGGCGGAAGGG - Exonic
1076992777 11:284434-284456 CAGGAGCTGCTGGGGTGGCGGGG - Intronic
1077013869 11:391564-391586 CAGAGCCTGCGTGGGTGGAGGGG - Intergenic
1077130829 11:971575-971597 CTGGGTCAGTGGGGGTGGAGGGG + Intronic
1077474746 11:2781015-2781037 CTGGATCTGCGGGTGTGGGTGGG - Intronic
1079452561 11:20609831-20609853 CTGGATCTGTGGGTGGGGAGAGG + Intronic
1080604438 11:33853077-33853099 CAGGATGGCGGGGGGTGGAGTGG + Intergenic
1081099043 11:38978706-38978728 GAGCATTGGCGGGGGTGGAGAGG - Intergenic
1081757926 11:45557788-45557810 CAGGATCTTGGGGGGTGGGGTGG - Intergenic
1082269564 11:50155268-50155290 CAGGAGCTGAGGGGATGGGGAGG - Intergenic
1082687421 11:56258228-56258250 CAGGATGTATGGGGGAGGAGGGG + Intergenic
1083267964 11:61555608-61555630 ATGGATGTGCGGGGGTGGGGCGG + Intronic
1083939757 11:65889284-65889306 CAGCATCAGTGGGGGTGGAGAGG - Intergenic
1083968290 11:66056687-66056709 CTGGAAGTGTGGGGGTGGAGGGG + Intronic
1084063023 11:66687941-66687963 AAGGATGTGCGGGGGTGGAGGGG + Intronic
1084171197 11:67401793-67401815 CAGGAGCTGCTGGGCTGGAGCGG - Exonic
1084719421 11:70894726-70894748 CAGGATCTGTGGAGCTGGCGGGG + Intronic
1086147804 11:83572713-83572735 GAGCATCTGCTGAGGTGGAGAGG + Intronic
1086863012 11:91947488-91947510 CAGGATGGGGTGGGGTGGAGTGG - Intergenic
1088814260 11:113410600-113410622 CAGGGCCTGCCGGGGTGAAGAGG + Exonic
1089184872 11:116607976-116607998 CAGGAACTGAGAGGGTTGAGAGG + Intergenic
1089347297 11:117798615-117798637 CAGGAGCTGGGGGAGGGGAGGGG - Intronic
1089392415 11:118111200-118111222 CAGGAGTTCCGGGGGTGGTGAGG + Intronic
1089560708 11:119341767-119341789 CAGGCTCTGCGGAGGGAGAGTGG + Exonic
1089560764 11:119341979-119342001 CCAGCTCTGCAGGGGTGGAGGGG + Exonic
1089640357 11:119843780-119843802 CAGGATTTGGGGAGGAGGAGGGG + Intergenic
1090058938 11:123447130-123447152 CAGGATCTGCTGGGTGGGAGAGG + Intergenic
1090445395 11:126760647-126760669 CAGGATCTGCAGGAGTTGAGAGG + Intronic
1090660044 11:128875670-128875692 CAGGATCTGCTGTGCTGGGGAGG + Intergenic
1092104377 12:5911007-5911029 CAGCATCTGCGGGCAGGGAGAGG + Intronic
1094829938 12:34295496-34295518 TAGGATCTGTGGGGGTTGTGCGG + Intergenic
1095668780 12:44834734-44834756 CGGGATCTGCTGGGGTGGGATGG - Intronic
1095752599 12:45728969-45728991 GAGGATCTGCCGGGGCGGTGTGG + Intergenic
1095942903 12:47738088-47738110 GAGGCACTGCGGGGGTGGGGAGG + Exonic
1097167687 12:57094317-57094339 CAGGAGCTGCGGGGGTGGTTTGG - Intronic
1097918192 12:65042024-65042046 CTGCATCTGGGGGAGTGGAGAGG + Intergenic
1099172889 12:79386503-79386525 CAGGGTCTGTGGGGGTTGGGGGG - Intronic
1100226081 12:92557058-92557080 AAGGTTTTGCGGGGGTGGGGTGG + Intergenic
1101365287 12:104064757-104064779 CTGGAGCTGCGGAGGGGGAGGGG + Intronic
1102302914 12:111783838-111783860 AAGGATCTGGGGGAGGGGAGAGG + Intronic
1102457894 12:113082213-113082235 CAGCATCTGCGTGGGTGGGGAGG - Intronic
1102702030 12:114847702-114847724 CAGGAGTTGGGGGGGTGGCGGGG + Intergenic
1103843662 12:123886354-123886376 CAGGAGCTGCTGGGGAGGGGAGG + Intronic
1104140806 12:125984198-125984220 CAGTATCTGGTGGGGTGGCGGGG + Intergenic
1104854921 12:131896994-131897016 CCGGGTCTGCGGGGGTCGTGCGG - Intronic
1105473969 13:20715251-20715273 CAGAATCTCTGGGGGTGGGGGGG + Intronic
1106131469 13:26943164-26943186 CAATATCTGCAGTGGTGGAGAGG - Intergenic
1108059385 13:46517526-46517548 CCGGAGCTGCAGTGGTGGAGTGG - Intergenic
1110602374 13:77389344-77389366 CTGGACTGGCGGGGGTGGAGTGG + Intergenic
1113037280 13:106063887-106063909 CAGGAAGTGCAGGAGTGGAGAGG - Intergenic
1113904096 13:113811370-113811392 CTGGGTCTGCGGTGGGGGAGGGG + Intronic
1114450451 14:22822115-22822137 CAGGTTGGGCGGGGGCGGAGAGG - Intronic
1114664969 14:24372360-24372382 CTGGATCTGTGAGGGAGGAGGGG - Intronic
1115769943 14:36657999-36658021 CAGGATCTGCGCTGCGGGAGGGG - Intronic
1117512737 14:56470188-56470210 CAGGATCCGTGAGGATGGAGTGG + Intergenic
1117545741 14:56794065-56794087 AAGGACTTGCGGGGGTGGGGTGG + Intergenic
1117809815 14:59534408-59534430 CAGGATGAGCGAGGGTGGACTGG - Intronic
1118137408 14:63045209-63045231 CAGGATCCGCGGCGGGGGAGGGG + Exonic
1118672874 14:68148975-68148997 GAGGATCTGCAGGTGTGTAGTGG + Intronic
1118926137 14:70191091-70191113 CAGCATGTGCGGGGGTGGCGGGG + Intergenic
1119230370 14:72974743-72974765 TGGGAGCTGCAGGGGTGGAGGGG - Intronic
1119408413 14:74412772-74412794 CAAGATGGGCAGGGGTGGAGGGG - Intronic
1120893405 14:89509032-89509054 CAGTATCAGTGGGGGTAGAGCGG - Intronic
1122207405 14:100154881-100154903 CAGGAGGGGCAGGGGTGGAGTGG - Intronic
1122236762 14:100335118-100335140 CAGGCTCTGCATGGGTGGTGTGG - Intronic
1122258810 14:100500281-100500303 CAGGACCTGCGGGGGCTGCGGGG + Intronic
1122794649 14:104200116-104200138 CAGGAGCTGCGGTGGGGGTGAGG + Intergenic
1123125668 14:105944341-105944363 CAGGATGGGCCGGGGTGGGGCGG - Intergenic
1123586487 15:21765053-21765075 AAGGAACTGTGGGGGTGGGGGGG - Intergenic
1123623126 15:22207618-22207640 AAGGAACTGTGGGGGTGGGGGGG - Intergenic
1124342863 15:28901332-28901354 CTGGATCTGGGAGGGTGGGGCGG - Intronic
1124653394 15:31488806-31488828 GAAGAGGTGCGGGGGTGGAGAGG - Intronic
1124890106 15:33724957-33724979 CAGTCTTGGCGGGGGTGGAGAGG + Intronic
1125160463 15:36637559-36637581 CAGTATCTGCTGAAGTGGAGAGG + Intronic
1125502537 15:40248479-40248501 CAGGACCTGCCGGGGAGGTGGGG - Intronic
1126113258 15:45187670-45187692 CAGGATGTCCGGGGGCGGCGCGG + Intronic
1127184674 15:56465596-56465618 CAGCTTCTGCGGGGGGGGGGGGG - Intergenic
1127644485 15:60946117-60946139 CAGGATCAGCGGGTGTGCTGAGG + Intronic
1128072831 15:64807983-64808005 CTGGAGCTGCGGGGGAGGAGTGG + Intergenic
1129245486 15:74276508-74276530 CAGGGTCTGTGGGGATGGAAGGG - Intronic
1129490316 15:75918830-75918852 CAGGATCTGGGGTGGTTGGGAGG + Intronic
1129693134 15:77724945-77724967 CAGGCTCTCCTGGGGTGGGGCGG - Intronic
1130563712 15:84977953-84977975 CTGGAGCTGAGGGGGTGAAGGGG + Intergenic
1132482275 16:172647-172669 CGGGATGGGCGGGAGTGGAGTGG + Intergenic
1132483123 16:176451-176473 CGGGATGGGCGGGAGTGGAGTGG + Intergenic
1132644296 16:991721-991743 CTGGGTCTGCGGGGGGGGTGGGG - Intergenic
1132758994 16:1499920-1499942 CAGCTTCTGCGGGAGGGGAGGGG + Intronic
1133231655 16:4369841-4369863 TAGGGGCTGTGGGGGTGGAGGGG - Intronic
1133503741 16:6390306-6390328 CAGGATTTGGGGGTGGGGAGGGG - Intronic
1135970888 16:27071022-27071044 CAGGGTCACCCGGGGTGGAGGGG + Intergenic
1136350149 16:29701486-29701508 CAGGATGGGTGGGGGTGGACAGG - Intergenic
1137617898 16:49857840-49857862 CAGGAGCTGCGGGGGACGCGCGG - Intronic
1139468544 16:67166494-67166516 CTGGAAGTGCGGGGGTGGGGGGG + Intronic
1139592564 16:67941682-67941704 CAGGATGTGTGGGGATGGTGGGG + Intronic
1140485607 16:75290753-75290775 CAGGATCTTAGGAGGTAGAGAGG + Intergenic
1140514280 16:75530895-75530917 CAGGATCTGGGGGGATTGGGGGG + Exonic
1141464455 16:84196799-84196821 CAGGGACTGCAGGGCTGGAGAGG - Intronic
1142400541 16:89856056-89856078 CAGGACCTGCGGTGGGGAAGCGG - Intronic
1142977861 17:3656190-3656212 AAGGACTGGCGGGGGTGGAGGGG - Intronic
1142977932 17:3656356-3656378 GAGGACTGGCGGGGGTGGAGGGG - Intronic
1142977946 17:3656392-3656414 GAGGACTGGCGGGGGTGGAGGGG - Intronic
1143439398 17:6957447-6957469 CAGGTTCTGCGGGGGTTTAGTGG - Intronic
1143527983 17:7483360-7483382 CAGCAGCTGCGGTGGGGGAGGGG + Exonic
1143786336 17:9258545-9258567 CAGGCACTGGGGGTGTGGAGAGG + Intronic
1144353515 17:14422447-14422469 CAGGATTTGGGGGTGTGGAGTGG - Intergenic
1144782903 17:17816795-17816817 CAGGCTCTGGAGGGGTGGTGGGG + Intronic
1145277793 17:21445106-21445128 CAGGACCTCCTGGGGTGCAGAGG + Intergenic
1145315623 17:21730985-21731007 CAGGACCTCCTGGGGTGCAGAGG + Intergenic
1145714060 17:27002924-27002946 CAGGACCTCCTGGGGTGCAGAGG + Intergenic
1145739701 17:27262897-27262919 CAGGAGCTGGGGGTGTGGGGTGG + Intergenic
1146463717 17:33068136-33068158 CTGGACCTGGGGGGGTGGAAGGG + Intronic
1146561037 17:33870975-33870997 CAGCATCTCAGGGGGTGGGGTGG - Intronic
1147263621 17:39222809-39222831 CAGGATATGGGGAGGTGGGGAGG - Intronic
1148736219 17:49866492-49866514 CAGATTCTTCAGGGGTGGAGGGG - Intergenic
1149640692 17:58200497-58200519 CAGGATGTGCAGGAGTGCAGAGG + Intronic
1149867577 17:60159213-60159235 CAGGATCTGCGGAAGTGATGGGG - Exonic
1150286854 17:63959522-63959544 CAGAGGCTGCGGGGGCGGAGGGG + Intronic
1151342435 17:73480597-73480619 AAGGATCTGCTGGGGGTGAGTGG + Intronic
1151443808 17:74150442-74150464 CAGGTTCTGCAGGGGAGGTGGGG - Intergenic
1151832788 17:76565178-76565200 CAGCAGCTGGGGGGGAGGAGGGG - Intronic
1152194396 17:78908633-78908655 AAGGCTCTGCGGGGGAGGTGAGG - Intronic
1152360054 17:79828618-79828640 CAGGAGCTGAGGGAGTGCAGAGG + Intergenic
1152466579 17:80469962-80469984 CAGGATCTGAGGAGGTGGGAAGG + Exonic
1152533560 17:80937144-80937166 CAGGAGCTAAGCGGGTGGAGAGG + Intronic
1152655406 17:81517159-81517181 CTGGAGCAGCGGGGGTGGGGCGG - Intronic
1152710862 17:81870075-81870097 CAGGAATCGCGGGGGTGGAGAGG - Intronic
1152719948 17:81918549-81918571 CGGGATCTGCTGGGGTGGGATGG - Exonic
1152864028 17:82711654-82711676 CAGGCTCTGCGGCGGTGTCGTGG + Intergenic
1153817943 18:8807111-8807133 CAGGATATGTGGCGGGGGAGCGG + Intronic
1154002509 18:10494506-10494528 GAGGATGGGAGGGGGTGGAGAGG - Intergenic
1154012519 18:10587901-10587923 GGGGCTCTGTGGGGGTGGAGTGG + Intergenic
1154157547 18:11955827-11955849 CAGGATCTGGGGGCCTGGGGAGG + Intergenic
1155141214 18:23046358-23046380 CAGAAATTGGGGGGGTGGAGGGG + Intergenic
1156486796 18:37471544-37471566 CAGGATCTAGGTGGATGGAGGGG - Intronic
1157565195 18:48675043-48675065 GGGGGTCGGCGGGGGTGGAGTGG + Intronic
1157592108 18:48842223-48842245 CAGGGGCTGCGGGGATGGGGAGG + Intronic
1160316123 18:77849396-77849418 TATGATCGGCGGGGGTGGTGGGG - Intergenic
1160696295 19:486201-486223 GAGGATTTGGGGGGCTGGAGAGG + Intergenic
1160773424 19:843876-843898 TGGGGTCTGCGGGGGTGGGGTGG - Exonic
1161290527 19:3491428-3491450 AAAGCTCTGCGGGGGAGGAGCGG + Exonic
1161318843 19:3631876-3631898 CAGGATGTGAGGAGCTGGAGTGG - Exonic
1161329557 19:3679771-3679793 CAGGACCTGCAGGGTTGGAGGGG + Intronic
1161374328 19:3931401-3931423 CAGGATCTGTGGCAGTGCAGCGG - Intergenic
1161417703 19:4156981-4157003 CAGGACCTGCTGGGGTGGACAGG - Exonic
1161428216 19:4216212-4216234 CAGGAGGTGGGGGGCTGGAGTGG - Intronic
1161496100 19:4586690-4586712 CAGGGTCTGCGGGGCTGCAGAGG - Intergenic
1161580427 19:5077749-5077771 CAGGGGCTGCAGGGGTGGAAGGG + Intronic
1164589664 19:29499761-29499783 CAGGAACTCCGGAGCTGGAGTGG - Intergenic
1164594637 19:29525390-29525412 CAGGGGCGGCGGGGGTGGGGTGG - Intergenic
1165017347 19:32890729-32890751 CAGGGCCTGCAGGGGTTGAGGGG - Intronic
1165740861 19:38204303-38204325 CAGGAGGTGTGGGGGTGGGGTGG - Intronic
1166420178 19:42630524-42630546 TAGGATCTGAGGGGGAGGACTGG + Intronic
1166676707 19:44745588-44745610 GAGGAGCTGGTGGGGTGGAGGGG - Intergenic
1167423055 19:49415032-49415054 CAGCCTCTGTGGGTGTGGAGTGG - Intronic
927669799 2:25059563-25059585 CAGGGACTGCGGGGGGGGGGGGG + Intronic
929252806 2:39778393-39778415 TAGGAGCTGCCAGGGTGGAGGGG + Intronic
931168827 2:59780457-59780479 CAGGGTATGCTGGGGTGGAGGGG + Intergenic
931207718 2:60164048-60164070 CAGATTCTCCTGGGGTGGAGTGG - Intergenic
931681180 2:64751053-64751075 GAGGAGCTGAGGGGGCGGAGCGG + Intergenic
932073657 2:68644197-68644219 CAGAAGCTTCGGGGGTGGAGAGG - Intronic
934125901 2:88889767-88889789 CAGGGCCTGCGGGGGGAGAGCGG - Intergenic
934756554 2:96828383-96828405 GAGGTTTTGCAGGGGTGGAGTGG - Intronic
934851848 2:97706884-97706906 CAGGGTGTGGGGGTGTGGAGGGG + Intergenic
936255844 2:110910148-110910170 CTGGCTCTGCTGTGGTGGAGAGG - Intronic
937352014 2:121171920-121171942 CAGGAACTGTGGGGGCAGAGAGG - Intergenic
938140649 2:128791875-128791897 CAGACCCTGCGGGTGTGGAGCGG + Intergenic
938407330 2:131039847-131039869 CAGGACTTGCGTGGGTGGCGTGG + Intronic
939965944 2:148610438-148610460 CAGGTTCAAGGGGGGTGGAGGGG + Intergenic
939993432 2:148898008-148898030 CAGGGTTTGAGGGAGTGGAGAGG + Intronic
942497356 2:176553825-176553847 CAGGATCTGCAGGCGGGGCGGGG - Intergenic
944926940 2:204475033-204475055 AAGGATCTGCTGGAGTCGAGTGG + Intergenic
945052411 2:205836572-205836594 CAGAAGCAGCGGGGGTGGGGTGG - Intergenic
945680423 2:212906877-212906899 CAGGATCTGGGTGGCTGGTGGGG - Intergenic
946023723 2:216659396-216659418 CAAGATCTGGGTGGGTGCAGAGG - Intronic
947010075 2:225555910-225555932 CAGGATCTGTAGGGGTGCAGGGG - Intronic
947032190 2:225809189-225809211 CAGGGGCTGAGGGGGTGGGGAGG + Intergenic
947739022 2:232476475-232476497 CAGGTTCTGCGGGGGGAGATTGG - Intergenic
948516614 2:238508037-238508059 CAGGAGCAGAGGGGGTGCAGGGG - Intergenic
948524979 2:238566056-238566078 CAGACTCTGCTGGGATGGAGTGG + Intergenic
948573147 2:238930062-238930084 CAGGACCTGTGAGGATGGAGAGG + Intergenic
948736877 2:240014574-240014596 GGGCATCTGCAGGGGTGGAGGGG - Intronic
948806123 2:240454004-240454026 GAGGTTCTGCGGCGGCGGAGGGG + Intronic
948978446 2:241479265-241479287 CATGATCTTCGGGGATTGAGTGG - Intronic
1168992071 20:2103382-2103404 CAGGCCCTGCGTGGGTGGAAAGG - Intronic
1170043644 20:12064076-12064098 CAGAATCTCTGGGGGTGGTGGGG - Intergenic
1170400216 20:15974504-15974526 CAGGAGTTGTGGGGGTGGGGAGG + Intronic
1171249865 20:23638731-23638753 ATGGAGCTGAGGGGGTGGAGTGG - Intergenic
1172205262 20:33158850-33158872 CAGGAGCTGCAGGAGGGGAGAGG - Intergenic
1172390300 20:34560974-34560996 CAGGATCTGGGGGGAGAGAGAGG + Exonic
1172645245 20:36465164-36465186 CAGGGCATGCGGGGGTGGGGGGG - Intronic
1172782185 20:37443464-37443486 CAGGGGCTGAGGGGATGGAGAGG - Intergenic
1173262658 20:41450731-41450753 CAGGTTCTGCGGGAGAGCAGAGG + Intronic
1173472102 20:43332165-43332187 AAGGATCTGGTGGGGTGGGGCGG + Intergenic
1173619288 20:44424269-44424291 CAGGAGGGGCGGGGTTGGAGTGG + Intronic
1174101178 20:48127321-48127343 CTGGAGCTGAGCGGGTGGAGAGG - Intergenic
1174306137 20:49615589-49615611 TGGGATCTGCAGGGCTGGAGGGG + Intergenic
1176253456 20:64138156-64138178 CAGGGTCTGTGGGGGTGGGGAGG + Intergenic
1176382351 21:6119733-6119755 CAGGACTTGCCGTGGTGGAGGGG - Exonic
1177580917 21:23021317-23021339 CAGGATGTGGGGGGGGGGGGGGG - Intergenic
1178068879 21:28938892-28938914 CAGGAGCTGCGGGGTTTGAGAGG + Intronic
1178696208 21:34794778-34794800 CATGATTTGCTGGGGTGGAGGGG + Intronic
1178744774 21:35238255-35238277 CATGAACAGCAGGGGTGGAGGGG + Intronic
1179299089 21:40090439-40090461 CAGCATCAGTGGGTGTGGAGGGG - Intronic
1179741121 21:43418506-43418528 CAGGACTTGCCGTGGTGGAGGGG + Exonic
1179889048 21:44326622-44326644 CAGGGTCGGGGGGGGTGGGGGGG + Intronic
1179940503 21:44636692-44636714 CAGGGTCTGAGGGTGGGGAGGGG - Intronic
1179998526 21:44984895-44984917 CAGTTTCGCCGGGGGTGGAGGGG - Intergenic
1180142192 21:45899432-45899454 CAGAATCTGCTGGTGGGGAGGGG - Intronic
1180169760 21:46051896-46051918 CAAGATCTGTGGGTGTGGGGTGG + Intergenic
1180181552 21:46120611-46120633 GGGGATCTGAGGGGGTGCAGGGG + Intronic
1180224296 21:46380582-46380604 CAGTAGCTGCTGGGGTGGGGTGG - Intronic
1180626874 22:17199442-17199464 TGGGATCTTCGTGGGTGGAGGGG - Intronic
1180629983 22:17221785-17221807 CAGGCTCTGCAGAGGTGCAGGGG + Intronic
1180857866 22:19059612-19059634 CTGGATCTGCTGGGGTGGCAGGG - Intronic
1182764001 22:32745385-32745407 CCAGATGTTCGGGGGTGGAGGGG + Intronic
1182923267 22:34099432-34099454 CAGGAACTGTGTGGGTGGGGTGG + Intergenic
1183060803 22:35335339-35335361 CTGGATTTGTGGGTGTGGAGAGG - Intronic
1183154901 22:36067106-36067128 CAGGAGGTGGGGGTGTGGAGTGG + Intergenic
1183596818 22:38817899-38817921 CAGGTGCTGCAGGGGTGGGGTGG + Intergenic
1183693576 22:39405604-39405626 CAGTGTGTGCAGGGGTGGAGGGG + Intronic
1183732318 22:39625620-39625642 AAGGACCTGCAGGGGTGGGGTGG - Intronic
1184103461 22:42353868-42353890 CATGAACTGCCGGGGTGCAGAGG + Intergenic
1184188448 22:42879457-42879479 GAGGACCAGCGGGGGTGGCGAGG + Intronic
1184950569 22:47839780-47839802 CAGGAGCGGAGGGGGAGGAGCGG - Intergenic
1185113055 22:48912967-48912989 CAGAATCTGGGGCGGGGGAGGGG - Intergenic
1185221199 22:49630026-49630048 CAGAATCTAAGGGGTTGGAGAGG - Intronic
1185336387 22:50272449-50272471 CAGGACCAGCGGGGGTGGGGTGG - Intergenic
950573913 3:13819418-13819440 CAGGATCTGCAGGGGAGGGCGGG + Exonic
950826528 3:15828649-15828671 TAGTATCTGGGGGGGTGGGGGGG + Intronic
952914302 3:38221228-38221250 GATGATATGTGGGGGTGGAGAGG + Intronic
954326898 3:49868886-49868908 CAGGATCTGCCTGGGAGGTGCGG + Intronic
954582500 3:51710667-51710689 CAGGATTTGAGGGGGTGGGAAGG + Intronic
954756057 3:52840605-52840627 CAGGATCTGAGGCAGTAGAGAGG + Exonic
955489984 3:59472153-59472175 CAGGAGGTACAGGGGTGGAGTGG + Intergenic
956631745 3:71323385-71323407 CAGAAACTGGGAGGGTGGAGAGG + Intronic
961550867 3:127669974-127669996 CAGCACCTTCGGGAGTGGAGAGG - Intronic
961635298 3:128329415-128329437 GAGCATCAGCGGGGGTGGGGGGG - Intronic
961816875 3:129555679-129555701 CAGGAGCAGGGAGGGTGGAGGGG - Exonic
961818387 3:129562938-129562960 CAGGTTCTGCAGGGGGAGAGTGG + Exonic
963727358 3:148937385-148937407 AGGGATCTGGGTGGGTGGAGTGG - Intergenic
963742895 3:149097802-149097824 CAGGATGGGGGGGGGTGGGGGGG + Intergenic
963924025 3:150932347-150932369 CAGGATCTGTGGGAGTCCAGAGG + Intronic
965709598 3:171543939-171543961 TAGGATCTGCGGCTGTAGAGGGG + Intergenic
965945024 3:174230676-174230698 CAGCTACTGAGGGGGTGGAGGGG + Intronic
966780493 3:183580110-183580132 CTGCATCTGCGGGGGAGGAAGGG - Intergenic
967033717 3:185631606-185631628 CAGGGGCTGCGGGGGGGGGGGGG - Exonic
969515856 4:7648017-7648039 CAGGAGCAGCCGAGGTGGAGTGG + Intronic
969692376 4:8710699-8710721 CAGGAGTTGAGGGGTTGGAGGGG - Intergenic
978406850 4:108389211-108389233 CAGGGCCTGCGGGGGGGTAGGGG + Intergenic
980091490 4:128447602-128447624 CAGAAGCTGAGGGGGTGGTGTGG + Intergenic
981116995 4:141003334-141003356 CAGTATGTGTTGGGGTGGAGAGG - Intronic
981323051 4:143414979-143415001 CAGGCCCTGCGGAGGGGGAGGGG - Intronic
985971417 5:3381344-3381366 CAGGGTCAGGGCGGGTGGAGGGG - Intergenic
986192525 5:5510253-5510275 CAGCACCTGCCAGGGTGGAGGGG - Intergenic
986859216 5:11905571-11905593 CAAGCTCTGCGGGGGTGGGGGGG - Intergenic
988501415 5:31786660-31786682 CAAGATTTGGGGGGGTGTAGGGG + Intronic
989643327 5:43603678-43603700 CAAGATCGGGGGTGGTGGAGAGG + Intronic
990557706 5:56952053-56952075 CAGGAGCAGCCGGGCTGGAGCGG - Intronic
990606584 5:57416786-57416808 CAGGATATGCAGGGGAGGTGGGG + Intergenic
991257282 5:64629135-64629157 TAGTATCTGTGGGGGTGGTGGGG - Intergenic
996779822 5:127172871-127172893 CAGCAGCTCCTGGGGTGGAGGGG - Intergenic
997519394 5:134512836-134512858 CAGGAGCTGTGGAGATGGAGGGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998381597 5:141729837-141729859 TGGGATATGCGGGGGTGGGGTGG - Intergenic
998495085 5:142581678-142581700 CAGGATATGGGGGGTTGGAGAGG - Intergenic
999271296 5:150297757-150297779 CAGGATCTCCGTGCGTGGTGAGG + Exonic
999277256 5:150339421-150339443 CAGAATATGTGGGGGTGGAGGGG + Intergenic
1001141735 5:169150205-169150227 CAGGATATTAGGGGTTGGAGCGG - Intronic
1002334113 5:178466239-178466261 CAGGACCTGTGGGGGTGGTGAGG + Intronic
1002340902 5:178516049-178516071 CAGGATCTGCCAGGGAGGTGAGG - Intronic
1002405463 5:179026874-179026896 CAGGAGCTTCTGGGGTGGGGAGG + Intronic
1002574071 5:180161659-180161681 CAGGAGCCGCGGGGCTGGGGAGG - Intronic
1003127626 6:3368206-3368228 CAGGGTGTGAGGGGCTGGAGAGG - Intronic
1003915715 6:10784729-10784751 CAATATCTACGCGGGTGGAGGGG - Intronic
1005183708 6:23137681-23137703 CAGGATCTGCAAGGGTCAAGGGG + Intergenic
1006377668 6:33680489-33680511 CAGGAGGTGTGGGAGTGGAGGGG + Intronic
1006411725 6:33877817-33877839 CTGGCTCTGCAGGGGTGGTGGGG - Intergenic
1006463893 6:34179483-34179505 CCGAGCCTGCGGGGGTGGAGGGG + Intergenic
1007211523 6:40196586-40196608 AAGGCTATGTGGGGGTGGAGTGG + Intergenic
1007829825 6:44629673-44629695 CAGGGTCTGCTGGGGTGCTGGGG + Intergenic
1008555763 6:52671498-52671520 CTGGATCTGGGGTGGTGGGGTGG + Intronic
1008920545 6:56839877-56839899 CAGGGGGTGAGGGGGTGGAGTGG + Intronic
1009936672 6:70242295-70242317 CAGGCAGTGCGGGGGTGGCGGGG - Intronic
1011965890 6:93156907-93156929 CAGGCTGTGTGGGGGTGGGGTGG - Intergenic
1013267212 6:108511756-108511778 CAGAATCTGCTGGGAGGGAGAGG + Intronic
1016035004 6:139375311-139375333 CAGGAGCTGGGGGCGGGGAGGGG + Intergenic
1016330032 6:142945763-142945785 CTGGAGGTGAGGGGGTGGAGAGG - Intergenic
1016354996 6:143209108-143209130 CAGGAACTGCAGGGGTGAGGTGG - Intronic
1016471546 6:144379898-144379920 GAGGATCTGCTGTGGAGGAGTGG + Intronic
1016648200 6:146434414-146434436 CAGGTGCTGCGGAGGTGGCGGGG - Exonic
1018225994 6:161629394-161629416 CAGCAACTGCCGGGGTGCAGGGG - Intronic
1018924653 6:168197810-168197832 CAGGGCCTGTGGGGGTGGGGAGG + Intergenic
1019042449 6:169118419-169118441 CTGCAACTGTGGGGGTGGAGTGG - Intergenic
1019148596 6:169989242-169989264 CAGGACCTGCAGGTGCGGAGTGG + Intergenic
1019325680 7:437039-437061 CAGGCTCTGAGTGGGTGCAGTGG - Intergenic
1019589705 7:1824636-1824658 CAGGACCCGCGGGAGAGGAGAGG + Intronic
1019710845 7:2517563-2517585 CAGGAGTTGCGGGGGTGGGGCGG + Intronic
1019711380 7:2519649-2519671 GTGGGTCTGCGGGCGTGGAGCGG + Intronic
1020007205 7:4789225-4789247 CAGGACCTGCCGGGATGAAGGGG - Intronic
1022396099 7:29989396-29989418 CGGGGACTGCGGGGGTGCAGTGG - Intronic
1022989702 7:35695229-35695251 CAGGATCGGCAGGGATGGCGGGG - Intronic
1024532866 7:50407569-50407591 CATGCTCTGTGGGGCTGGAGGGG - Intergenic
1024585073 7:50835130-50835152 CTGGAGTTGCGGTGGTGGAGAGG + Intergenic
1027138149 7:75639087-75639109 CGGGATCTCCAGGGGTGGGGGGG - Intronic
1028986237 7:97010808-97010830 CAGGGTTTGGGGGGGTGGGGTGG - Exonic
1029111689 7:98216027-98216049 CAGGCTCTGCTCGGTTGGAGAGG - Exonic
1030102009 7:105955402-105955424 CAGGATGTGGGGGGGTGGGCGGG - Intronic
1031484451 7:122310760-122310782 CAGGACCTGCGGGAATGCAGAGG - Intergenic
1032194497 7:129781264-129781286 CCAGATCTGCGGGGGTCGATTGG - Intergenic
1032316820 7:130845602-130845624 CAGGGCATGCGGGGGTGGAGAGG - Intergenic
1033237435 7:139649327-139649349 CAGCATCTGCGGGTGTGCACCGG - Intronic
1033418449 7:141185034-141185056 CAGGATGTGCGATGGTGGTGTGG + Intronic
1033810146 7:145002324-145002346 CAGGGTCTGGGAGGGTTGAGGGG + Intergenic
1034931246 7:155165767-155165789 CAGGATGGGGGGGGGTGGTGTGG - Intergenic
1035728797 8:1840857-1840879 CGGGTGCTGCTGGGGTGGAGAGG + Intronic
1036739253 8:11346896-11346918 CAGAATCTCCGGGGCTGGGGGGG - Intergenic
1036777137 8:11621182-11621204 CAGGATTTGAGGTGATGGAGTGG - Intergenic
1038036589 8:23691435-23691457 CAGGACCTGGGGGACTGGAGAGG + Intergenic
1038780676 8:30566463-30566485 CAGAATCACCTGGGGTGGAGGGG - Intronic
1039734048 8:40310556-40310578 AACGATCTGAGGGGCTGGAGTGG - Intergenic
1041381075 8:57254959-57254981 CTGGATCCCTGGGGGTGGAGGGG - Intergenic
1041418091 8:57635927-57635949 CATGATCTGTGGGGGTGGAAAGG + Intergenic
1042091161 8:65161325-65161347 CAGGATCTGGGTTGTTGGAGAGG + Intergenic
1042926485 8:73972829-73972851 CAGGACCCTCGCGGGTGGAGTGG - Intronic
1044123285 8:88425030-88425052 CAGGCTGAGCGGGGGAGGAGAGG + Intergenic
1046518696 8:115296882-115296904 CAAAATTTGAGGGGGTGGAGAGG + Intergenic
1047204631 8:122793331-122793353 CAGGATCAGTGGGGCTGAAGAGG - Intronic
1047611167 8:126522240-126522262 CAGGAACTGAAGGGCTGGAGAGG + Intergenic
1048906832 8:139096691-139096713 CTGGCTCTGCAGGGGTTGAGTGG + Intergenic
1048972886 8:139655116-139655138 CAGTATCTGAGGGAGGGGAGTGG - Intronic
1049082841 8:140456913-140456935 GAAGGTCTGCAGGGGTGGAGGGG + Intronic
1049352575 8:142171977-142171999 GAGGCTCTGCAGGGGGGGAGAGG + Intergenic
1049597181 8:143490117-143490139 CAGGGGCGGCGGGGGTGAAGGGG + Intronic
1049739832 8:144233358-144233380 CAGGAGCTGCGGGGGAGGGAAGG - Intronic
1049739844 8:144233394-144233416 CAGGAGCTGCGGGGGAGGGAAGG - Intronic
1049762454 8:144337392-144337414 CGGGATCTGCGGGGGCGGGCGGG + Intergenic
1052316758 9:27123348-27123370 AAGGATATGCGGGGGTGTAAAGG + Intronic
1053576043 9:39357975-39357997 CAGGGTGTGGGGTGGTGGAGGGG + Intronic
1054097614 9:60916666-60916688 CAGGGTGTGGGGTGGTGGAGGGG + Intergenic
1054119016 9:61192296-61192318 CAGGGTGTGGGGTGGTGGAGGGG + Intronic
1054588736 9:66990266-66990288 CAGGGTGTGGGGTGGTGGAGGGG - Intergenic
1054906784 9:70419723-70419745 CATGGGCTGCGGGGGTGGGGAGG + Intergenic
1055986750 9:82061431-82061453 CAGGATGTGGGGTGGTGGAGGGG - Intergenic
1056841590 9:90002361-90002383 CAGGATCAAGGGGGCTGGAGAGG - Intergenic
1057160425 9:92884783-92884805 CAGGGTGTGGGGTGGTGGAGGGG + Intergenic
1057173006 9:92975149-92975171 CCGGCTCTGCGGGGGTGCGGAGG - Intronic
1057231680 9:93325163-93325185 CAGGATCTTCAGGTGGGGAGAGG + Intronic
1058017243 9:100048165-100048187 CAGGAGTTGGGTGGGTGGAGGGG + Intronic
1058288226 9:103206381-103206403 CAGCAGCTGGGGGGGAGGAGGGG - Intergenic
1058877677 9:109258702-109258724 CAGGGTCTGCAGTGCTGGAGAGG + Intronic
1059153154 9:111967121-111967143 CAGGATCTGCTGGGGGAGGGAGG - Intergenic
1059383996 9:113950007-113950029 CAGGATCTACGGGGGTTTAATGG - Intronic
1059391854 9:114004314-114004336 CAGGAAAGGCGGGGCTGGAGGGG - Intronic
1060507963 9:124212593-124212615 CAGCGTTTGTGGGGGTGGAGAGG - Intergenic
1060519984 9:124288832-124288854 CAGGCTGTGGGGAGGTGGAGAGG - Intronic
1060599738 9:124869700-124869722 CGGGACCTGCGGGGGTGCCGAGG - Intronic
1060974334 9:127755434-127755456 CTGGAGCTGCGGGCGCGGAGCGG + Intronic
1061406027 9:130393508-130393530 CAGGATAGGCGGGGGCAGAGAGG + Intronic
1061480996 9:130897708-130897730 CAGGAGTTCCAGGGGTGGAGGGG - Intergenic
1061782865 9:133006043-133006065 CAGGATCTGGGGGAGGGGAGTGG + Intergenic
1062067415 9:134536202-134536224 CAGGGGCTGGGGGGCTGGAGGGG - Intergenic
1062070074 9:134550637-134550659 CAGGAGCTGAGAAGGTGGAGTGG - Intergenic
1062544649 9:137055985-137056007 CAGGAGCTGAAGGGGTGGAGGGG + Intergenic
1062546616 9:137066422-137066444 CAGGCTCTGCTGAGGTGCAGCGG + Intronic
1062583919 9:137240593-137240615 CGGGGGCTGCGGCGGTGGAGGGG - Intergenic
1062618968 9:137411091-137411113 CAGGTTCTGCGGTGGTCCAGGGG - Intronic
1062646096 9:137549067-137549089 CAGGCTCTCCTGCGGTGGAGCGG + Intronic
1203361374 Un_KI270442v1:221003-221025 GAGGATCCGCGGGTGGGGAGGGG + Intergenic
1186862920 X:13690883-13690905 CAGGTTGTGATGGGGTGGAGCGG + Intronic
1188524083 X:31071107-31071129 CAGGATTTGCAGGGGTGGAGTGG - Intergenic
1189010567 X:37042724-37042746 CAGGATCTGCGGGGGTGGAGGGG - Intergenic
1189012797 X:37063330-37063352 CAGGATCTACTGGGGTGGAGGGG - Intergenic
1189030239 X:37442353-37442375 CAGGATCTGTGGGGGTGGAGGGG + Intronic
1189035840 X:37492831-37492853 CAGGATCTGCGGGGGTGGAAGGG + Intronic
1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG + Intronic
1189157443 X:38773005-38773027 CGTGATCTACTGGGGTGGAGGGG + Intergenic
1189776007 X:44470627-44470649 TAGGAACTGCAGGGGTGGACGGG + Intergenic
1190806641 X:53844203-53844225 CGGGGTCTGTGGGAGTGGAGAGG - Intergenic
1195174887 X:102305807-102305829 GAGGCTCTGAGGGGGTGGGGTGG + Intergenic
1195183978 X:102381286-102381308 GAGGCTCTGAGGGGGTGGGGTGG - Intronic
1197594842 X:128452175-128452197 CAGGATTTGCAAGGGTGAAGAGG + Intergenic
1200239206 X:154485069-154485091 CAGCAGCTGCGGGGGTCGGGGGG + Exonic