ID: 1189039874

View in Genome Browser
Species Human (GRCh38)
Location X:37530906-37530928
Sequence TTTTGGATCACCAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189039874 Original CRISPR TTTTGGATCACCAGGCAAGA TGG (reversed) Intronic
904008045 1:27373983-27374005 ACCTGGACCACCAGGCAAGATGG - Exonic
909960741 1:81838849-81838871 TTTTGGCTCATCAGGCCAGGGGG + Intronic
911632542 1:100199590-100199612 TTTTGGATTCCCAGGCAAGATGG + Intronic
911661410 1:100505921-100505943 TTGTGTATCACATGGCAAGAGGG + Intronic
915519027 1:156430627-156430649 TTAGGGATCGCCAGGCCAGAAGG - Intronic
917632597 1:176904726-176904748 TTTGGGAGGACCAGGAAAGATGG - Intronic
920297608 1:204968547-204968569 TTTTGGATAATGAGGAAAGAAGG + Intronic
922825353 1:228513722-228513744 TTTTGAATCATCAAACAAGAAGG - Intergenic
1065866356 10:29918663-29918685 TTCTGGCTCACCAGTTAAGACGG - Intergenic
1067329547 10:45301986-45302008 TTTTGGAGGATCTGGCAAGATGG - Intergenic
1068000956 10:51333601-51333623 TTTTGGATAAACAGGGAAAATGG - Intronic
1069083393 10:64112427-64112449 TTTGGGCTCATCAGGAAAGACGG + Intergenic
1069645024 10:69989364-69989386 TTTGGGATGCCCAGGCAAAAGGG + Intergenic
1073558897 10:104480595-104480617 TTTTGGATTAGCAGGAAAAATGG + Intergenic
1073637752 10:105216925-105216947 TTGTAGATCACCCTGCAAGATGG - Exonic
1075154061 10:119959357-119959379 TTTTGGATTACAAAGCCAGAAGG - Intergenic
1076023573 10:127093913-127093935 CATGGGATGACCAGGCAAGAAGG - Intronic
1076181249 10:128410537-128410559 TTTTGTAGCACCAGGAAAGGTGG - Intergenic
1077573956 11:3364627-3364649 TTTTGGATCACCTTGAAAAATGG - Intronic
1078363387 11:10687500-10687522 GTTTGGATCAACAGGCAAGTAGG - Intronic
1080630289 11:34068261-34068283 GTTTGGATCACCAGCAAACAAGG + Intronic
1086237892 11:84654114-84654136 TTTTGGATCTTCAGAAAAGAGGG - Intronic
1086421803 11:86644754-86644776 GTTAGGATTCCCAGGCAAGATGG + Intronic
1086587030 11:88463974-88463996 TTTTGGGACACTAGCCAAGATGG - Intergenic
1087278564 11:96184813-96184835 TTTTGGATCACGAGGTCAGGAGG - Intronic
1087427671 11:98012076-98012098 GTTAGGATTCCCAGGCAAGATGG + Intergenic
1088195633 11:107270610-107270632 TTTTCAATCAGCAGGAAAGAAGG - Intergenic
1089670299 11:120052280-120052302 TCTTGGGTAACCAGGCAGGACGG - Intergenic
1093539075 12:20259292-20259314 TCTGGGATCAGCAGGTAAGAGGG + Intergenic
1098297845 12:69022357-69022379 TTTAGGATCTGCAGGCTAGATGG - Intergenic
1103882360 12:124175835-124175857 TTTTGGATCGTCAGGCAATCAGG + Intronic
1106007666 13:25786365-25786387 GTTTGAAAAACCAGGCAAGAAGG - Intronic
1109792130 13:67262817-67262839 ATAAGTATCACCAGGCAAGAAGG - Intergenic
1110596413 13:77325914-77325936 TTTTGGATAAGCAGGCCCGAGGG - Intronic
1114861873 14:26532903-26532925 TTTTAGATCACCATGCTATATGG + Intronic
1117234689 14:53759402-53759424 TTATGCATCACAAGGCAAAATGG + Intergenic
1117872385 14:60214607-60214629 TATTGGATCACAAGGTAAAATGG + Intergenic
1118580393 14:67290185-67290207 TTTTGGAAGACTAGGAAAGAGGG + Intronic
1118603701 14:67488158-67488180 CTGTGGATGACCAGGCAGGATGG + Intronic
1122377998 14:101279736-101279758 TCCTGGAACACCAGGAAAGAAGG + Intergenic
1123694293 15:22865929-22865951 CTCTAGCTCACCAGGCAAGAGGG - Intronic
1128709210 15:69859288-69859310 TCTTGGATCTCCAGGCCAGCAGG + Intergenic
1129097755 15:73226324-73226346 CTTTGGATCACCATGGCAGACGG - Intronic
1132300308 15:100771236-100771258 TTATGGAGCACCTGCCAAGAGGG - Intergenic
1134103463 16:11469246-11469268 TTTTGCACCCCCAGGAAAGATGG - Exonic
1135898758 16:26435183-26435205 TTTTTGATCTCCAGGCATCAGGG - Intergenic
1138382712 16:56614556-56614578 TTCTGGATCAACAGGCAAAGAGG - Intergenic
1138899324 16:61249980-61250002 ATTTGGATCATCAGGCAGGTGGG + Intergenic
1140306867 16:73811308-73811330 TTTTAGATCACCCAGAAAGAAGG - Intergenic
1140960688 16:79909529-79909551 TTTTCCAGCATCAGGCAAGAAGG + Intergenic
1141843704 16:86592467-86592489 TTTTGGTTCACTAGTCTAGAAGG - Intergenic
1142088268 16:88196230-88196252 TTGTGGACCACCAGGCTAGCAGG + Intergenic
1142377385 16:89712869-89712891 TTTTGGAAGGGCAGGCAAGAAGG - Intronic
1144034881 17:11356188-11356210 GTTTGCATCAACAGGGAAGATGG - Intronic
1144723662 17:17489888-17489910 TGATGGATCGCCAGGAAAGATGG + Intronic
1146151851 17:30479872-30479894 TTTTGGAGGCCCAGGCAGGAGGG + Intronic
1146326667 17:31892043-31892065 TGTTGTATCTGCAGGCAAGAAGG - Intronic
1147652926 17:42072395-42072417 TTCCCGGTCACCAGGCAAGAAGG + Intergenic
1152402886 17:80079632-80079654 TACTGGATCACCAGGCACGGTGG + Intronic
1152528184 17:80901741-80901763 TTCTGGGGCACCAGGAAAGATGG - Intronic
1153352559 18:4097150-4097172 ATTTGAATCCCAAGGCAAGAAGG - Intronic
1158829609 18:61263295-61263317 TTTTGGATCATCATGGCAGATGG + Intergenic
1168200673 19:54813201-54813223 TTTTGGAGCACCAGCGATGAAGG - Intronic
926732145 2:16043697-16043719 TTCTTGATCCCAAGGCAAGAAGG + Intergenic
927332206 2:21878589-21878611 TTTTGGACCAGCAAGAAAGATGG + Intergenic
929403634 2:41614460-41614482 ACTTGAATCTCCAGGCAAGAGGG + Intergenic
931047887 2:58377075-58377097 TTTTGGATGACCAGTAGAGAAGG + Intergenic
932837562 2:75051437-75051459 ATTTTGACCACCTGGCAAGAGGG + Exonic
934168048 2:89314192-89314214 TTTTGCCTCACCAGGCACAATGG + Intergenic
934199237 2:89868389-89868411 TTTTGCCTCACCAGGCACAATGG - Intergenic
934702631 2:96454420-96454442 TTTTGGGGGACCTGGCAAGATGG + Intergenic
937771195 2:125722310-125722332 TTATGGAGGACCTGGCAAGATGG + Intergenic
938142423 2:128807236-128807258 TTTTGGAGCAGCTGGAAAGAAGG - Intergenic
938913359 2:135907331-135907353 TTTGGGATCACGAGGGAACATGG + Exonic
939957062 2:148535929-148535951 CTTTGAAACACCTGGCAAGATGG - Intergenic
941572728 2:167191802-167191824 ATTAGGTTCACCAGGCAACAAGG - Intronic
944081533 2:195793868-195793890 TTTAGCGTCACCAGGCAAGCAGG - Intronic
947319194 2:228897517-228897539 TTTATCATCAACAGGCAAGACGG - Intronic
1169061763 20:2665453-2665475 TTTTGGATCACCTATCCAGATGG + Intergenic
1171398022 20:24851786-24851808 CTCTGCATCACTAGGCAAGAGGG + Intergenic
1173712649 20:45174419-45174441 TTTTGCAGGACCAGGGAAGAAGG + Intergenic
1174784109 20:53416628-53416650 TTTTGGATCTGCAGGCCATAGGG - Intronic
1176113388 20:63420826-63420848 TTTGGGGTCCCCAGGCACGAAGG + Intronic
1177508190 21:22045782-22045804 TTGTGGATTATCAGGCAAAAAGG - Intergenic
1178475812 21:32936068-32936090 TCTTGGATCACCATCTAAGAGGG - Intergenic
1182460046 22:30477057-30477079 TTTGGGATCAGCAGAAAAGAAGG - Intergenic
951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG + Intronic
951944087 3:28114500-28114522 TTTTGGCTCCCCAGGAAAGTTGG + Intergenic
953264177 3:41370344-41370366 GTGGGGATTACCAGGCAAGATGG + Intronic
953365868 3:42344495-42344517 TTTTGGATCATCAACCATGAAGG + Intergenic
955728724 3:61960701-61960723 TTCTGGATCAGAAGACAAGATGG + Intronic
957695624 3:83635492-83635514 TTTGGGATTCCCAGGCAAGATGG + Intergenic
958011883 3:87889637-87889659 GTTTGGATTATCAGGCAAGACGG - Intergenic
958871166 3:99560744-99560766 TATTGGATGACAAAGCAAGAAGG + Intergenic
959142896 3:102507117-102507139 ACTTGGATCATCAGGCAAGAAGG + Intergenic
961975080 3:131015537-131015559 GTTTGCTTTACCAGGCAAGAAGG - Intronic
963587699 3:147214114-147214136 TTTTGAGTCATCTGGCAAGAAGG + Intergenic
964757666 3:160103398-160103420 TGTTGGATAACCAGGCAACCAGG + Intergenic
966291087 3:178360804-178360826 TTTTGGATTCCTGGGCAAGATGG + Intergenic
970927584 4:21470901-21470923 GTTTGGATCAGCAGCCAGGATGG + Intronic
971437063 4:26638880-26638902 TTTTGGATCCACAGTTAAGAAGG - Intronic
973332942 4:48928051-48928073 TTCAGGATCACCAGGCCAGCTGG + Intergenic
973718133 4:53698055-53698077 AATTGGAACACCAGGCAAGCAGG + Intronic
973955867 4:56062437-56062459 TTTCGTATCACCAGGGAAAAAGG - Intergenic
975149530 4:71005412-71005434 TTTTAGATTCCCAGGCAAGATGG - Intronic
977185746 4:93933206-93933228 TGTTGTATTCCCAGGCAAGATGG - Intergenic
977961637 4:103091709-103091731 TCTTGGTTCCCCAGGCTAGAGGG - Intronic
978523599 4:109641448-109641470 TTTTGGGGCACCAGGAAACATGG - Intronic
979819483 4:125152282-125152304 ATTTGGATCAGATGGCAAGATGG - Intergenic
981248197 4:142565342-142565364 TTTAGGATCACCAATCAAGTTGG - Intronic
981591048 4:146361423-146361445 TCCTGGATTACCAGGCAAGTCGG - Intronic
984493570 4:180468103-180468125 TTTGGGATTCCCAGGCAAGATGG + Intergenic
984500325 4:180550502-180550524 CTATGGATGACCAGACAAGAGGG - Intergenic
992171209 5:74103818-74103840 TTGTGGCTGACCAGGCAGGATGG + Intergenic
992746739 5:79827905-79827927 GTTTGTATCTCCAGGCAAGGGGG + Intergenic
995897113 5:117027669-117027691 TATTTGATCACGAGGCAAGTTGG - Intergenic
997104072 5:130998007-130998029 TTTTGAATCACCTGGCAGGAAGG - Intergenic
999614282 5:153405478-153405500 TTTCGGACCAGCAGGGAAGATGG - Intergenic
1000466370 5:161582743-161582765 TTGTTGATCACCAGGGCAGAGGG - Intronic
1004313171 6:14563783-14563805 TATTGGCTTACCAGCCAAGAGGG - Intergenic
1004976529 6:20973558-20973580 TGTTGGATCACCTGGCAGGATGG - Intronic
1008316876 6:50054525-50054547 ATTTGGATCACCAGGCCCGCAGG + Intergenic
1008996447 6:57665333-57665355 TAGTGGATCACTAGGCATGATGG - Intergenic
1009338009 6:62517964-62517986 TTTTGTACCACCACACAAGATGG + Intergenic
1014278733 6:119417660-119417682 CTGTGGATTCCCAGGCAAGATGG + Intergenic
1015867173 6:137739362-137739384 TCTTGGACCAGCAGGCAACAGGG - Intergenic
1016151904 6:140750942-140750964 TTCTGAATCAACAGGCAATAAGG + Intergenic
1017576696 6:155813317-155813339 TCTTGGGACACCAGGCATGAAGG - Intergenic
1018247519 6:161836937-161836959 ATTTGGCTCACCTTGCAAGAGGG + Intronic
1018304262 6:162438383-162438405 TTTTGGAACACTAGGAAGGAGGG - Intronic
1022117394 7:27274138-27274160 ATTTGGTGAACCAGGCAAGAAGG + Intergenic
1022961467 7:35430364-35430386 TGGAGGATCCCCAGGCAAGATGG - Intergenic
1025108498 7:56193032-56193054 TTTGGGATGAGCAGGGAAGATGG + Intergenic
1026100877 7:67383698-67383720 TCTTTGATCACAAAGCAAGAAGG + Intergenic
1028146602 7:87326912-87326934 TTCTGGTCCCCCAGGCAAGAAGG - Intergenic
1030559269 7:111064565-111064587 TATTGGATCACTAGGGATGATGG - Intronic
1033119505 7:138654707-138654729 TTACTGCTCACCAGGCAAGATGG + Intronic
1033969245 7:147018731-147018753 ATTTGGATAACCAGGCACTAAGG + Intronic
1034284028 7:149873031-149873053 TTTTTGATCGCCAGAGAAGAAGG + Exonic
1034813743 7:154154127-154154149 TCTTGGATCACCAATCAATATGG - Intronic
1037258387 8:16980261-16980283 CTTTGGATTCCTAGGCAAGATGG - Intergenic
1039133744 8:34297265-34297287 TCTAGGATTCCCAGGCAAGATGG + Intergenic
1039881657 8:41629083-41629105 ATTTGGAACACAGGGCAAGAGGG - Intergenic
1040356051 8:46619369-46619391 TTTGGGAGCCCAAGGCAAGAGGG + Intergenic
1042646334 8:70990880-70990902 TTTTACTTCACCAGGGAAGAGGG - Intergenic
1044738251 8:95300959-95300981 TTTGGGATCAACTGGGAAGATGG + Intergenic
1046979008 8:120315976-120315998 TGATGGCTCACCAGGCCAGAGGG + Exonic
1047214286 8:122864173-122864195 TTCTAGATCACCAGGGAACAGGG - Intronic
1048800818 8:138192372-138192394 GTCTAGTTCACCAGGCAAGAAGG - Intronic
1050294655 9:4193663-4193685 TTTTGAATAACTAGGGAAGATGG + Intronic
1053004716 9:34596874-34596896 TTTGGGATCACCCAGCAGGAGGG - Intergenic
1053654976 9:40209142-40209164 TTTTAGAGCACCTGGAAAGATGG + Intergenic
1053905362 9:42838347-42838369 TTTTAGAGCACCTGGAAAGATGG + Intergenic
1054367091 9:64355358-64355380 TTTTAGAGCACCTGGAAAGATGG + Intergenic
1054529623 9:66167173-66167195 TTTTAGAGCACCTGGAAAGATGG - Intergenic
1054674720 9:67845099-67845121 TTTTAGAGCACCTGGAAAGATGG + Intergenic
1056512991 9:87323384-87323406 TTTTTTATCACCAGGCAAATTGG + Intergenic
1056847268 9:90051117-90051139 CTTTGGAACATCAGGAAAGAAGG - Intergenic
1058669764 9:107350951-107350973 GTTAGGATGACCAGGAAAGAGGG + Intergenic
1058879411 9:109273578-109273600 CTTTGGACCACCATGCAAGGAGG + Intronic
1059572162 9:115450889-115450911 TTTACCATCACCAGACAAGATGG - Intergenic
1062380668 9:136285206-136285228 GTCTGGAGCAGCAGGCAAGAGGG + Intronic
1185840379 X:3383878-3383900 TTTGGGATCAGCAGGAAAGAAGG - Intergenic
1188922037 X:35988055-35988077 ATTTGAATTCCCAGGCAAGATGG - Intronic
1189039874 X:37530906-37530928 TTTTGGATCACCAGGCAAGATGG - Intronic
1193131276 X:77922260-77922282 TTTGGGAGGACCAGGCAGGAGGG + Intronic
1196535207 X:116836106-116836128 TTTTGGATCCCCAGGCTAATGGG - Intergenic
1197074240 X:122336387-122336409 TAGTGGATCACTAGGGAAGATGG + Intergenic
1200901800 Y:8440167-8440189 TTGTGGATACCCAGGCAGGAAGG + Intergenic