ID: 1189044082

View in Genome Browser
Species Human (GRCh38)
Location X:37572264-37572286
Sequence ACGCTCGTATACCACGCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189044066_1189044082 30 Left 1189044066 X:37572211-37572233 CCGACACCCGCGCCGCCTTCCTG 0: 2
1: 0
2: 1
3: 21
4: 221
Right 1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG 0: 2
1: 0
2: 0
3: 1
4: 33
1189044077_1189044082 11 Left 1189044077 X:37572230-37572252 CCTGCTCGGGGGCGCGGGCGTGT 0: 2
1: 0
2: 0
3: 9
4: 127
Right 1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG 0: 2
1: 0
2: 0
3: 1
4: 33
1189044073_1189044082 18 Left 1189044073 X:37572223-37572245 CCGCCTTCCTGCTCGGGGGCGCG 0: 2
1: 0
2: 0
3: 9
4: 119
Right 1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG 0: 2
1: 0
2: 0
3: 1
4: 33
1189044070_1189044082 23 Left 1189044070 X:37572218-37572240 CCGCGCCGCCTTCCTGCTCGGGG 0: 2
1: 0
2: 4
3: 17
4: 223
Right 1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG 0: 2
1: 0
2: 0
3: 1
4: 33
1189044076_1189044082 15 Left 1189044076 X:37572226-37572248 CCTTCCTGCTCGGGGGCGCGGGC 0: 2
1: 0
2: 0
3: 11
4: 150
Right 1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG 0: 2
1: 0
2: 0
3: 1
4: 33
1189044068_1189044082 24 Left 1189044068 X:37572217-37572239 CCCGCGCCGCCTTCCTGCTCGGG 0: 2
1: 0
2: 2
3: 22
4: 212
Right 1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG 0: 2
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189044082 Original CRISPR ACGCTCGTATACCACGCCCT GGG Exonic
903345708 1:22682875-22682897 ACGCTTGTAGACAAAGCCCTTGG + Intergenic
1105239786 13:18598911-18598933 GCGCTCGTACACCGCGTCCTGGG - Intergenic
1114065164 14:19053991-19054013 GCGCTCGCACACCACGTCCTGGG - Intergenic
1114097099 14:19346011-19346033 GCGCTCGCACACCACGTCCTGGG + Intergenic
1118124728 14:62889118-62889140 AAGTTCCTATACCACACCCTAGG + Intronic
1123491459 15:20785176-20785198 GCGCTCGTACACCGCGTCCTGGG + Intergenic
1123547961 15:21354267-21354289 GCGCTCGTACACCGCGTCCTGGG + Intergenic
1202956291 15_KI270727v1_random:81497-81519 GCGCTCGTACACCGCGTCCTGGG + Intergenic
1154449043 18:14459863-14459885 GCGCTCGTACACCGCGTCCTGGG + Intergenic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
938482419 2:131672993-131673015 GCGCTCGCACACCACGTCCTGGG - Intergenic
1170749714 20:19134733-19134755 ACACTCCTACACCACGCCCTAGG - Intergenic
1180483654 22:15776611-15776633 GCGCTCGCACACCACGTCCTGGG - Intergenic
958529074 3:95301214-95301236 ATGCTTGTATAACAGGCCCTGGG + Intergenic
964396928 3:156255545-156255567 ACTCTCTTTTACCACTCCCTCGG + Intronic
1035603816 8:915769-915791 ACACACGGAAACCACGCCCTGGG - Intergenic
1039480577 8:37870335-37870357 ACCATCGTATACCTCTCCCTGGG - Intronic
1043890315 8:85646184-85646206 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043891930 8:85658374-85658396 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043894174 8:85724323-85724345 ACCCTCCTCTACCCCGCCCTGGG + Intergenic
1043894530 8:85727408-85727430 ACCCTCCTCTACCCCGCCCTGGG + Intergenic
1043894886 8:85730493-85730515 ACCCTCCTCTACCCCGCCCTGGG + Intergenic
1043895242 8:85733578-85733600 ACCCTCCTCTACCCCGCCCTGGG + Intergenic
1043897434 8:85748230-85748252 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043897790 8:85751318-85751340 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043898146 8:85754403-85754425 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043899760 8:85766598-85766620 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043901367 8:85778791-85778813 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043901722 8:85781876-85781898 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043903332 8:85794066-85794088 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043904943 8:85806259-85806281 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1043906554 8:85818450-85818472 ACCCTCCTCTACCCCGCCCTGGG - Intergenic
1058070744 9:100598669-100598691 ACTCTCGAATACCACGCACCTGG + Intergenic
1189004944 X:36985680-36985702 ACGCTCGTATACCACGCCCTGGG - Intergenic
1189044082 X:37572264-37572286 ACGCTCGTATACCACGCCCTGGG + Exonic
1191797234 X:65034558-65034580 ACGGTCGTATCCCAAGTCCTCGG + Intronic