ID: 1189046364

View in Genome Browser
Species Human (GRCh38)
Location X:37596105-37596127
Sequence TAATTACATCAGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189046360_1189046364 10 Left 1189046360 X:37596072-37596094 CCTTCTCCTAGTGAATAAAGACA 0: 1
1: 0
2: 0
3: 18
4: 222
Right 1189046364 X:37596105-37596127 TAATTACATCAGAAGTTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 211
1189046361_1189046364 4 Left 1189046361 X:37596078-37596100 CCTAGTGAATAAAGACACCTGAA 0: 1
1: 0
2: 2
3: 19
4: 252
Right 1189046364 X:37596105-37596127 TAATTACATCAGAAGTTGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189046364 Original CRISPR TAATTACATCAGAAGTTGGA AGG Intronic
903086825 1:20868510-20868532 TAATTACATTAGGAGGTGGGTGG - Intronic
904847134 1:33428983-33429005 TAGTAAGATCAGAAGCTGGAAGG - Intronic
908046399 1:60174327-60174349 CAATTACATCAGAAGCTCTATGG + Intergenic
910619695 1:89239351-89239373 AAATTACATTAGTAGTTTGATGG + Intergenic
910784264 1:90977673-90977695 TTATTACATCAGAAGTTAAAGGG + Intronic
913374380 1:118134552-118134574 TAATTCCATGGGAAGTTGGAGGG - Intronic
913447264 1:118962862-118962884 TAATTAAATTACAAGTTGGTAGG + Intronic
915429666 1:155856595-155856617 TAATTACATCAGTTGATTGAGGG - Intronic
915962171 1:160275886-160275908 AATTGACATCAGAAGTTGGGGGG + Intergenic
916201650 1:162277329-162277351 TAATAAAATCAGAATTTGGAGGG - Intronic
916512804 1:165488026-165488048 TAATTAAATCAGAATTTGGGGGG - Intergenic
916529236 1:165639913-165639935 AAATTCCATGAGAAGTTGGCTGG + Intronic
916532225 1:165668012-165668034 TAGTTACCTCTGAAGTAGGAGGG + Intronic
920987940 1:210908165-210908187 TAATTACCTCAGAAAATGAATGG + Intronic
921436286 1:215127131-215127153 AAATGACATTAGAAGTTGGGAGG + Intronic
921582736 1:216913843-216913865 TAATTACAGCAGTAGTTGCAAGG + Intronic
922307806 1:224359153-224359175 GGATTACATCAGATTTTGGAGGG + Intronic
923200173 1:231703810-231703832 TTACTACATCAGAAGTTTCAGGG + Intronic
924023847 1:239812521-239812543 TAATTAAATACAAAGTTGGATGG + Intronic
924646160 1:245878794-245878816 TGATGTCATCAGCAGTTGGAGGG + Intronic
1063755478 10:9002389-9002411 TAATTATATAATAAGTTGAATGG + Intergenic
1065613520 10:27497281-27497303 TAATTTCTTTAGAAGTTGCATGG - Intergenic
1067938764 10:50634662-50634684 TAATCACATCAGAACCTGAAGGG + Intergenic
1068104293 10:52593983-52594005 TAATTGCATCAGTATTTGCAAGG - Intergenic
1068813825 10:61287217-61287239 TAATTACATCTGTCTTTGGAAGG + Intergenic
1069297490 10:66864378-66864400 TCATTACATGGGAAGGTGGAAGG - Intronic
1071033899 10:81218770-81218792 TAATTATATCAAAAGTAGAAGGG - Intergenic
1071987081 10:91062716-91062738 CAATTACATCAGAATTTCTAGGG + Intergenic
1074811445 10:117109174-117109196 TAATTATATCAGAAATTCTAGGG - Intronic
1075580791 10:123616584-123616606 TAAAAACAACAGAAGTTGGCCGG - Intergenic
1075692928 10:124412042-124412064 AAATGTCATCAGAGGTTGGAGGG + Exonic
1077452448 11:2656778-2656800 TAATGACATCAGCATTAGGATGG - Intronic
1078296343 11:10075051-10075073 AAATTAAACCAGAAGTTGGATGG + Intronic
1080177418 11:29382147-29382169 TACTTACATAAGTAGTTGTAGGG - Intergenic
1082927691 11:58568304-58568326 TAATTAAGTCAGAATTTGGCTGG + Intronic
1084196813 11:67527436-67527458 TTAGTAGATGAGAAGTTGGATGG + Intergenic
1086208730 11:84292766-84292788 AAAGTACTTCAGAAGTGGGAAGG + Intronic
1089512247 11:119006932-119006954 TAATCACAGCAGAAGGTGAAAGG - Intronic
1090718347 11:129450576-129450598 TTATAACAGCAAAAGTTGGAGGG - Intronic
1091810165 12:3390255-3390277 TAATCACATCACAAGCTGGAAGG + Intronic
1094085043 12:26581104-26581126 AAATTACATAAAAATTTGGATGG - Intronic
1094465829 12:30753760-30753782 TAATTACTTTAAAAGTAGGATGG - Exonic
1094482997 12:30899888-30899910 TAATCACATCACAAGCTGGAAGG - Intergenic
1096006000 12:48172429-48172451 GAATTCCATCAGAGGTTTGATGG + Intronic
1096006688 12:48179046-48179068 ATATTGCATGAGAAGTTGGAAGG + Intronic
1099387796 12:82038226-82038248 TAATTAGCTCACAAGTTGGTGGG + Intergenic
1099663939 12:85601930-85601952 AGATTATATCAGAGGTTGGATGG - Intergenic
1101989654 12:109474501-109474523 CAATTACATCAGAATTTTCATGG - Intronic
1106972533 13:35159801-35159823 TCATTCCATCTGAAGTTGTATGG - Exonic
1108842566 13:54638372-54638394 TTAATACATAACAAGTTGGAAGG + Intergenic
1111645152 13:91023056-91023078 TATTTACCTAAGAAGTAGGAGGG + Intergenic
1111645323 13:91025195-91025217 TATTTACCTAAGAAGTAGGAGGG - Intergenic
1113152993 13:107285316-107285338 TCATTTCCTCAGAAGTTGTATGG - Intronic
1113189891 13:107732568-107732590 TCATTTCCTCAGAAGTTGTATGG + Intronic
1114071462 14:19112078-19112100 TAAAGACATCTGAAGTTTGATGG - Intergenic
1114090800 14:19287890-19287912 TAAAGACATCTGAAGTTTGATGG + Intergenic
1118682771 14:68260358-68260380 TAATTACCTCACAAGTTTCATGG + Intronic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1120281141 14:82439352-82439374 CAATTACAGCAGAAGGTGAAGGG - Intergenic
1123736835 15:23193374-23193396 TAATTACATATTAAGTTAGAAGG - Intergenic
1124287534 15:28416351-28416373 TAATTACATATTAAGTTAGAAGG - Intergenic
1124288055 15:28422052-28422074 TAATTACATATTAAGTTAGAAGG - Intergenic
1124295170 15:28495275-28495297 TAATTACATATTAAGTTAGAAGG + Intergenic
1127794743 15:62427832-62427854 TAATTACCACAGAGTTTGGAGGG - Intronic
1128079360 15:64847004-64847026 TACTAACAGCAGAAGTTGTAAGG - Intronic
1130295012 15:82640577-82640599 AAATAACATCAGAAGTAGGCAGG - Intronic
1130778202 15:87007602-87007624 TAACTATATAAGAAGTTGGGAGG + Intronic
1131168854 15:90162201-90162223 GAGCTACAGCAGAAGTTGGAAGG - Intronic
1131716433 15:95115691-95115713 TATCTCCATCAAAAGTTGGAAGG - Intergenic
1132827566 16:1912759-1912781 TAATTACATCAGGGGAGGGAGGG - Intronic
1133420599 16:5643170-5643192 AAATGACATCAGAAGCAGGAGGG + Intergenic
1134135598 16:11674591-11674613 GAATGACGCCAGAAGTTGGAGGG - Intronic
1140950391 16:79811286-79811308 TATTTGCAACAGAAGTTTGATGG - Intergenic
1141308664 16:82891547-82891569 TAAGTGCATGAGCAGTTGGAGGG - Intronic
1147035452 17:37676507-37676529 TCATTACATCTGCAGGTGGAGGG - Intergenic
1148511446 17:48173760-48173782 AAATTGGATCCGAAGTTGGAGGG + Intronic
1148946209 17:51263734-51263756 TAACTACATCAGAATTTTGTTGG + Intronic
1149109377 17:53008831-53008853 TAATTGCTTCAGGAGTTGAAAGG + Intergenic
1149267106 17:54938931-54938953 TTGTTACATCAGAACTTGGAAGG - Exonic
1152182244 17:78830059-78830081 TATTTACATCATAATTTGAAAGG - Intronic
1156505964 18:37593159-37593181 TAACTCCATCACAAGTTGTAAGG - Intergenic
1156867860 18:41908674-41908696 TCATCCCATCAGAAGGTGGAGGG - Intergenic
1157735945 18:50049185-50049207 TATTTTCATCATAAGTTGGATGG + Intronic
1158220700 18:55147583-55147605 TAATTATGTTAGAAGTTAGAAGG - Intergenic
1163925198 19:20334686-20334708 TATTTACATAAAAAGTTGTATGG - Intergenic
1164554408 19:29240011-29240033 TAATTACCTCATAAGTTGTGGGG + Intergenic
925847984 2:8051035-8051057 TAATCACAGCAGAAGGTGAAGGG - Intergenic
925848641 2:8058045-8058067 CACTTCCATCAGAGGTTGGATGG + Intergenic
929927198 2:46223752-46223774 TAATTACAGTAGAACATGGAAGG - Intergenic
930535717 2:52643740-52643762 TAATGAAATCAGACTTTGGAGGG - Intergenic
930752503 2:54946566-54946588 TCATAACATCAGATGTGGGAGGG - Intronic
931877809 2:66533059-66533081 TAATTACAGCAGCATTTGGTTGG + Intronic
931945062 2:67297386-67297408 TAATTGCACAAGAAGTGGGAGGG + Intergenic
933286827 2:80393810-80393832 TAATGACATCATTAGTTTGATGG + Intronic
934898064 2:98135695-98135717 TGATCACATCTGAATTTGGAGGG + Intronic
935159113 2:100513792-100513814 TAAAGAAAGCAGAAGTTGGAAGG - Intergenic
935211733 2:100944569-100944591 AAATTACATCGGCAGTTGAACGG - Intronic
936926172 2:117739213-117739235 TCATTTCAGCAGAAGTTTGAAGG - Intergenic
938077946 2:128350693-128350715 TAAGGACATCTGAAGTTTGATGG + Intergenic
938270388 2:129965071-129965093 TAATGACCTCAGAACTTGGAGGG - Intergenic
938633406 2:133194961-133194983 TAATTACATTAGAAGTTCTGAGG - Intronic
939206944 2:139118879-139118901 TAGTTACATCAGGAGATGAAAGG - Intergenic
940149528 2:150584115-150584137 AAATTATATCAGAAGTAGGCTGG - Intergenic
940263964 2:151817036-151817058 TAACTACATCACAAGTTGAAGGG + Intronic
940409362 2:153342700-153342722 CAACTAAATCAGAAGATGGAGGG - Intergenic
941673198 2:168317104-168317126 TAATAGCATCAGAAGTTAGAAGG - Intergenic
942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG + Intergenic
943821369 2:192326902-192326924 TACTTATTTCAGAACTTGGAAGG + Intergenic
943996054 2:194766943-194766965 TAATTACAACAGAAAACGGATGG + Intergenic
944099594 2:196008969-196008991 TAATTACGGCAGAAGGTGAAGGG + Intronic
945381567 2:209146968-209146990 CAATAACATCAGAAGCTAGAGGG - Intergenic
945431766 2:209772498-209772520 GAATTACAGCAGGAGATGGAGGG - Intronic
945735947 2:213600598-213600620 CAATTACAGCATAAATTGGATGG - Intronic
946074187 2:217060233-217060255 TGATTACATCAGAATTTGGATGG - Intergenic
947181451 2:227415034-227415056 TAGTTACAACAGAAGCTGTATGG + Intergenic
1169462330 20:5806529-5806551 TAATTCCTTCAGAACTTGGGAGG - Intronic
1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG + Intronic
1173082642 20:39883938-39883960 TAATTCCATCAGAAGTTATCGGG - Intergenic
1176986526 21:15443895-15443917 TTATCACATCTGAAGTTGAAGGG - Intergenic
1177766270 21:25460863-25460885 TTATTATATCAGAAGTGGAAAGG - Intergenic
1178079378 21:29047396-29047418 TAATTGTATCAGGATTTGGATGG + Intronic
1180489906 22:15834410-15834432 TAAAGACATCTGAAGTTTGATGG - Intergenic
1182234598 22:28865453-28865475 GAATTACATGAGATGATGGATGG - Intergenic
1182265213 22:29109349-29109371 CAATTACATCATAAGATTGAGGG - Intronic
1182822476 22:33229630-33229652 TAATAACATAAGAAGGTGCAAGG + Intronic
1183097420 22:35561628-35561650 TAAATATATCAGGAGTTGGATGG + Intergenic
949784257 3:7723422-7723444 AAATTACATCACAAGTTGTCTGG + Intronic
950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG + Intronic
951257978 3:20472681-20472703 TCATTACATGAGAACTTCGAAGG - Intergenic
952496327 3:33919001-33919023 TGATTAGATCAGGAGTTGGCAGG + Intergenic
952743542 3:36757255-36757277 TAATTACATAAGAAGTAAAATGG - Intergenic
954963979 3:54594225-54594247 TAGTTACAGCAGAAATTGTATGG - Intronic
955694794 3:61624950-61624972 TAATTCCTTCTGAAGCTGGAAGG + Intronic
956857870 3:73293770-73293792 TAATTACAACAGAAACTGTATGG + Intergenic
957823487 3:85409805-85409827 TAAGTATAGCAGAAGTTAGATGG + Intronic
958552102 3:95628772-95628794 TATTTACTTCAGAAGTGGTAGGG - Intergenic
958968730 3:100587551-100587573 GAATTACATAAGAACTTGGGAGG - Intergenic
959218629 3:103484866-103484888 TAAATACATCAACAGTTGAAAGG + Intergenic
959829999 3:110849882-110849904 TAATTACATAATATGTTAGAAGG + Intergenic
960216638 3:115046948-115046970 TAATTAAATTTTAAGTTGGAAGG - Intronic
961076594 3:123988393-123988415 TAATGAAATCAGAAGTAGGAAGG - Intronic
962818574 3:139024250-139024272 AAATTACATCAGAAGTAGATCGG - Intronic
962966042 3:140355475-140355497 TAAATACGTCAGTAGGTGGAGGG + Intronic
963512329 3:146263139-146263161 TAAATACAACAGAATTAGGAAGG - Intergenic
965521103 3:169668873-169668895 TATACACATCAGAAGTTGGATGG - Intergenic
970515406 4:16824720-16824742 TAAATTCTTCAGAAATTGGATGG - Intronic
973577355 4:52303447-52303469 TAAATCCATCTGTAGTTGGAAGG - Intergenic
974758537 4:66245177-66245199 TAAATACATCAGAAGTACAAAGG + Intergenic
976502984 4:85813967-85813989 CAATTACAGCAGAAGGTGAAAGG + Intronic
976534933 4:86201355-86201377 TGATTACATCAAATGTTGGCAGG - Intronic
977408392 4:96630554-96630576 TAATTACAACAGAAAGTGGAAGG + Intergenic
978453187 4:108859419-108859441 TAACTATATCTGAAGGTGGAAGG + Intronic
978497822 4:109378767-109378789 TGATCATATCAGAAGTTGCATGG - Intergenic
979927996 4:126591942-126591964 TCAGTACATGAGAAGCTGGAAGG + Intergenic
981155574 4:141431065-141431087 TAATTACATCAGAAGGGGCAGGG + Intergenic
982694488 4:158583925-158583947 TAATGACAACAGCAGTTTGAGGG - Intronic
984270838 4:177546996-177547018 TAAATATTTCAGAAGTTTGATGG + Intergenic
984886635 4:184455446-184455468 TGGTTGCATCAGAAGGTGGAAGG - Intronic
984937673 4:184903488-184903510 TATTTTCATCAGAATTTGGAAGG + Intergenic
985007396 4:185547563-185547585 TAAGTACATTATAAGTTAGAGGG - Intergenic
987230416 5:15888147-15888169 TCAGTTCATCAGAATTTGGAGGG - Intronic
989636420 5:43540855-43540877 TAATTACACCAGAATTTCAAAGG + Intronic
989723474 5:44557950-44557972 TAATTAACTCAAAAGTTGGGTGG + Intergenic
992486914 5:77206323-77206345 TAATTATATAATAAGTTGAAAGG + Intergenic
992879802 5:81096590-81096612 TAATTATATCATAAGGTAGAAGG - Intronic
993048205 5:82893111-82893133 TAAATACATCAGAAGTTCCAGGG + Intergenic
993399950 5:87436961-87436983 TAATTAAATCAGAAGATTTAGGG + Intergenic
993929378 5:93918918-93918940 TAATTACATCAGAATTTCTGGGG - Intronic
994039424 5:95241661-95241683 AAATTACTTCAGAAGTTTGCAGG - Intronic
994494430 5:100491958-100491980 TAACTACAATAGAAATTGGAGGG - Intergenic
996005623 5:118417948-118417970 TATTTAGACTAGAAGTTGGATGG - Intergenic
996618070 5:125465825-125465847 TAAATACACCAGAATTTGCAAGG + Intergenic
997641877 5:135454699-135454721 CAATAACATCAAAAGTGGGAGGG + Intergenic
1004781146 6:18910021-18910043 TAATCATAGCAGAAGTTGAAGGG - Intergenic
1007914303 6:45546800-45546822 AAATTATAACAGAAGATGGAGGG - Intronic
1008251143 6:49241448-49241470 TTAAGACATCAGAAGTTAGAGGG + Intergenic
1009956432 6:70460401-70460423 TAATTCCAACAGAGTTTGGAAGG - Intronic
1010863817 6:80947488-80947510 AAATAACTTCAGAAGTTGCAGGG - Intergenic
1012019821 6:93904742-93904764 TAAGTACATGAGATTTTGGAGGG - Intergenic
1012228270 6:96730073-96730095 TCAGGACATCAGAAGTTTGAGGG + Intergenic
1014363640 6:120511488-120511510 TAAGTACATCAGAAGGTAGCTGG - Intergenic
1014859639 6:126449269-126449291 TAATTACATTACAAGGTAGATGG - Intergenic
1017074720 6:150607037-150607059 TAATCACACGAGAAGTTGGAGGG - Intronic
1017416683 6:154228356-154228378 TTATTACATCAGGATTTCGAGGG - Intronic
1019673601 7:2297252-2297274 TAATTACATCAAAAAGGGGACGG + Intronic
1021693995 7:23258759-23258781 TAGTTCCATCAGAAGTTATAAGG - Intronic
1024192617 7:47028257-47028279 TACTCCCATCAGAAGATGGAAGG + Intergenic
1024776005 7:52786876-52786898 TAAATACATGGAAAGTTGGAAGG - Intergenic
1026176019 7:67997783-67997805 TTATTAGATCAAGAGTTGGAAGG - Intergenic
1028735884 7:94211476-94211498 TAAATACAGCAGAAGGTAGACGG - Intergenic
1029879336 7:103790551-103790573 TAATGACATATGAATTTGGAGGG - Intronic
1030825271 7:114148184-114148206 GAATCTCATCAGAAGTTTGAAGG + Intronic
1030912295 7:115265618-115265640 TAGTTACATCATGAGTTGAAGGG + Intergenic
1032951589 7:136920938-136920960 AAGTAACATCAGAAGTTAGAAGG - Intronic
1034083855 7:148305604-148305626 TAATCACAGCAGAAGGTGAAGGG + Intronic
1038229851 8:25689740-25689762 CAATTACATCAGAATTTCTAGGG - Intergenic
1038803535 8:30770506-30770528 TAATTACATCAGCAGTAAGCTGG + Intergenic
1039221241 8:35333387-35333409 AAATTAAATCAGGATTTGGAAGG - Intronic
1039359742 8:36863194-36863216 TAATTACATCAAAAGAAAGAGGG + Intronic
1039800174 8:40947514-40947536 GAATTTCATCAGATGTTAGAAGG + Intergenic
1041398239 8:57414544-57414566 TAATTACATGGGAAGTTGAGGGG + Intergenic
1042757242 8:72228949-72228971 TAATTACATCATAACTGGAATGG - Intergenic
1043224949 8:77714574-77714596 TAAGGACATCAAACGTTGGAGGG - Intergenic
1043336596 8:79183615-79183637 TAATTAGATAAAAAGTTGAAGGG + Intergenic
1044918964 8:97147954-97147976 TAATCACAGCAGAAGGTGAAAGG - Intronic
1045194163 8:99913117-99913139 TCTTTCCCTCAGAAGTTGGAAGG + Intergenic
1046257502 8:111720860-111720882 TAATCACAGCAGAAGGTGAATGG + Intergenic
1046410978 8:113842721-113842743 TTATTATATTTGAAGTTGGAGGG + Intergenic
1048372480 8:133791568-133791590 TACTAACACCAGAAATTGGAGGG - Intergenic
1049867529 8:144948482-144948504 TTATTACATCACCACTTGGATGG - Intronic
1051182926 9:14429819-14429841 TTATTACATCAGAATCTGAATGG - Intergenic
1052258219 9:26484260-26484282 TAAGTACATCAGCAGATGAATGG - Intergenic
1052433319 9:28394636-28394658 TAAATCCATCAGAAGATGTATGG + Intronic
1052660556 9:31423636-31423658 AAAGTACATCAGAAGTTTGATGG - Intergenic
1053217290 9:36282749-36282771 TAATCTCATCAGAACCTGGAAGG + Intronic
1057989614 9:99754672-99754694 TAATTATGTCAGAAAGTGGAAGG - Intergenic
1059671357 9:116495466-116495488 TAATGTCATCAGAACTTGGTTGG - Intronic
1185885305 X:3777036-3777058 TAATTAGATTAGTAGTAGGAAGG + Intergenic
1185963379 X:4571658-4571680 TAATTACATAAGGAATGGGAGGG - Intergenic
1187040381 X:15588829-15588851 AACTCACATCAGAAGTTTGAAGG + Intronic
1188026939 X:25219811-25219833 TATTTGCCTCAGAGGTTGGAGGG - Intergenic
1188991757 X:36829451-36829473 GAATTGCATCACATGTTGGAGGG + Intergenic
1189014379 X:37080838-37080860 TAATTACATGAGAATTAGGCTGG + Intergenic
1189046364 X:37596105-37596127 TAATTACATCAGAAGTTGGAAGG + Intronic
1189556518 X:42151035-42151057 TAATAACAACAAAAGATGGAGGG - Intergenic
1191218650 X:57961135-57961157 TAATTATTTCAGAAGCAGGAGGG + Intergenic
1191865059 X:65697328-65697350 TACTCACGTAAGAAGTTGGAAGG - Intronic
1194216002 X:91130976-91130998 TAATCACTTCAGAAGTTTTAAGG - Intergenic
1194543941 X:95208364-95208386 TAATTAAAACAGAAATTGGCTGG + Intergenic
1196603699 X:117631169-117631191 AAATTAGATCAAAAATTGGAAGG + Intergenic
1197170382 X:123427350-123427372 CAATTAAATCAGAACTTGGGAGG - Intronic
1198507288 X:137313257-137313279 GAATTATGTCAGAAGTTGTAAGG - Intergenic
1198718640 X:139591087-139591109 TAATAACATGATAAGCTGGAAGG + Intronic
1199810774 X:151346510-151346532 TGATTGCTTCAGAAGTTTGAGGG + Intergenic
1201886279 Y:18886280-18886302 TAATTACATAAGTAATGGGAGGG - Intergenic
1201913465 Y:19157234-19157256 TAATTAGATTAGCAGTAGGAAGG - Intergenic