ID: 1189046921

View in Genome Browser
Species Human (GRCh38)
Location X:37603199-37603221
Sequence CAGGATCTAAAAGATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189046917_1189046921 5 Left 1189046917 X:37603171-37603193 CCAAAAGAAAATGTGAAATAACT 0: 1
1: 1
2: 11
3: 107
4: 792
Right 1189046921 X:37603199-37603221 CAGGATCTAAAAGATGAGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 215
1189046916_1189046921 12 Left 1189046916 X:37603164-37603186 CCTGCTTCCAAAAGAAAATGTGA 0: 1
1: 0
2: 1
3: 35
4: 406
Right 1189046921 X:37603199-37603221 CAGGATCTAAAAGATGAGCAGGG 0: 1
1: 0
2: 1
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189046921 Original CRISPR CAGGATCTAAAAGATGAGCA GGG Intronic
901108093 1:6773337-6773359 AAGAATATAAAAGATTAGCAAGG - Intergenic
901260623 1:7868076-7868098 CAGGATGTAGAAGCTGTGCAGGG - Intergenic
902371000 1:16006803-16006825 TGTGATCTAAAAGATGAGAAGGG + Exonic
904070195 1:27789760-27789782 CTGGATCTAAAAGAGGGGCGGGG + Intronic
904271108 1:29350603-29350625 TGGGATCTAAAAGATAAGGAGGG - Intergenic
904345190 1:29863397-29863419 GAGGAGATAAAAGATGAGCCTGG + Intergenic
905155409 1:35974867-35974889 CAGGAAATATAAGATGAGCAAGG - Intronic
905231683 1:36518462-36518484 CTGGGTCTAACATATGAGCAGGG - Intergenic
905926823 1:41757006-41757028 CAGGATCTCAAAGAGGAGGGCGG + Intronic
906611168 1:47204530-47204552 CAGCATCTCAAAGCTGGGCAAGG - Intergenic
910435352 1:87200544-87200566 CAGCAGCTAAAAGCTCAGCAGGG + Intergenic
911444832 1:97978682-97978704 CAGGCTGCAAAAGATGAGCTGGG - Intergenic
911907061 1:103583160-103583182 CAGTAACTAAAAGATTAGCATGG - Intergenic
913972132 1:143423519-143423541 TTGGGTCTGAAAGATGAGCAGGG + Intergenic
914066513 1:144249132-144249154 TTGGGTCTGAAAGATGAGCAGGG + Intergenic
914112640 1:144717222-144717244 TTGGGTCTGAAAGATGAGCAGGG - Intergenic
916022875 1:160809308-160809330 CAGGATTTAAAAGCTGGGCATGG - Intronic
918077993 1:181184920-181184942 CATGAACTTACAGATGAGCAGGG + Intergenic
918635573 1:186770440-186770462 CAGTATTTAAGAAATGAGCAAGG - Intergenic
919551495 1:198995335-198995357 CATGATTAAAAAGAAGAGCACGG - Intergenic
920180780 1:204130581-204130603 CAGAAACTCAAAGATGAGAAGGG - Intergenic
920833835 1:209489156-209489178 TAGGATTTCAAAGATGAGCAAGG - Intergenic
921167767 1:212519213-212519235 GAGGATCAAAAAGATAAGGAAGG + Intergenic
923069541 1:230549915-230549937 CAGGCTCTAAAACATGAGGGAGG - Intergenic
1063287529 10:4706798-4706820 CAGGATATAAAAAATGGGAAGGG + Intergenic
1063720137 10:8571766-8571788 CAAGATCATAAAGATGACCAGGG - Intergenic
1063749966 10:8932948-8932970 CAGAATCTAAAAGTTAAGCTTGG - Intergenic
1067259894 10:44680250-44680272 CAGGGGCTAGTAGATGAGCATGG + Intergenic
1068646036 10:59469529-59469551 TAGGAACTTAAAGATAAGCAAGG + Intergenic
1071495531 10:86165196-86165218 CAGGATGTAATAAAGGAGCATGG - Intronic
1074726999 10:116321343-116321365 TAGGATATAAAATATGAGCTGGG - Intergenic
1077307727 11:1875514-1875536 TTGGGTCTGAAAGATGAGCAGGG - Intronic
1080189861 11:29531490-29531512 TAGGATCTAAAATATAAGAATGG - Intergenic
1080521605 11:33072235-33072257 CATGATGAACAAGATGAGCATGG + Intronic
1080841764 11:35990337-35990359 CAGAATCTAAGAGAGAAGCATGG - Intronic
1080913564 11:36630785-36630807 CTTGATTTAAAGGATGAGCAGGG + Intronic
1081612632 11:44571953-44571975 CAGCAAGTAAAAGATGAGCTGGG - Intronic
1081990373 11:47334133-47334155 CAGGAGCTAAAGGAGGCGCAGGG - Intronic
1082762587 11:57142048-57142070 CAGGATCCAATAGATTGGCAGGG + Intergenic
1083624549 11:64065485-64065507 GAGGACTTAAAAGATGAACAAGG + Intronic
1084169738 11:67395256-67395278 AAGCATGCAAAAGATGAGCAAGG - Intronic
1085944205 11:81246754-81246776 CAGGATCTAAAAGCTGGAAAAGG - Intergenic
1086289191 11:85286839-85286861 CAGGAGACATAAGATGAGCATGG + Intronic
1086475737 11:87171150-87171172 CAGAATCTAAAAGGAAAGCAGGG + Intronic
1087022462 11:93616978-93617000 CAGGAGCTACAAGGTGAGTAAGG + Intergenic
1088070952 11:105784491-105784513 CAGGGTTTCAAAGATGAGAAAGG - Intronic
1096261385 12:50094357-50094379 CAGGGTCAAAAAGATGACCCAGG - Intronic
1096273876 12:50189239-50189261 GTGGATTTAAAAGGTGAGCAAGG - Intronic
1098393098 12:69990302-69990324 CAGGACCTGGAAAATGAGCAAGG - Intergenic
1098893983 12:76036770-76036792 CAGGGTATAAAAGATAACCAAGG + Exonic
1100252203 12:92838504-92838526 CAGGATATAAAAGGGGCGCAAGG + Intronic
1101386642 12:104264154-104264176 CAGGAGAGAAAAGATGAGTAAGG + Intronic
1102662509 12:114541978-114542000 CATGATGTAAAAGGTGACCAGGG + Intergenic
1102665232 12:114566327-114566349 CATGATGTAAAAGGTGACCAGGG - Intergenic
1103182551 12:118926303-118926325 AATGATCTAAAAGATGACAATGG + Intergenic
1104075821 12:125388761-125388783 CAGGAGCCAGAAGACGAGCAGGG - Intronic
1105348555 13:19596322-19596344 CAGGTGCTAAGAGAAGAGCAGGG - Intergenic
1106073924 13:26441175-26441197 CAAGATCTAAACTATGGGCATGG + Intergenic
1106096025 13:26644610-26644632 CTGGATGGAAAAGATGAGCTGGG + Intronic
1106185334 13:27404873-27404895 CAGGAGCTAAAACATGGGCAAGG + Intergenic
1106453849 13:29909768-29909790 AATGATCTAAAAGACGAGCAAGG + Intergenic
1107949880 13:45452380-45452402 CAGGATCAAAAAGAAGATGATGG - Intergenic
1111365068 13:87233140-87233162 CAGGATCTACAAGATCAAAAGGG - Intergenic
1112083576 13:96003909-96003931 CAGCATCTAATAAATGTGCATGG + Intronic
1112695761 13:101946075-101946097 CAAGGTATAAAAGATTAGCATGG - Intronic
1113165319 13:107433931-107433953 CAGGATCTCACAGACAAGCAAGG + Intronic
1114243382 14:20890287-20890309 CAGGTCCTAAAGGATAAGCAGGG - Intergenic
1116388504 14:44361980-44362002 CAATATCTAAAACATGAGGAGGG - Intergenic
1116673407 14:47873685-47873707 CAGGAACTGAAAGATGACAAGGG - Intergenic
1116785222 14:49280754-49280776 CAGGATGTGAGAGATTAGCAGGG - Intergenic
1117286302 14:54288731-54288753 AAGGAACACAAAGATGAGCAGGG + Intergenic
1118367651 14:65109376-65109398 CAGGAGCTGAAAGATGAGGTTGG - Intergenic
1118681188 14:68243495-68243517 CTGGATCAAAAAAATCAGCAAGG - Intronic
1119860862 14:77935073-77935095 TGGGATCTAAAACATCAGCATGG + Intergenic
1120293664 14:82610609-82610631 CAAGAACCAAAGGATGAGCAGGG + Intergenic
1121746506 14:96299107-96299129 CAGGCTCTATAGGATGAACATGG - Intronic
1121750035 14:96345289-96345311 CAGAAACTAACAGATGAACAAGG - Exonic
1125073213 15:35581008-35581030 CAGGACATAAAATCTGAGCAGGG + Intergenic
1125249837 15:37688088-37688110 CAGTAGCTAACAGATGATCAAGG + Intergenic
1129361638 15:75028230-75028252 TAGGATCTAAAAGGAGAACAAGG - Exonic
1129743837 15:78004245-78004267 AAGGAGTTAAAAGATGAGAAGGG + Intronic
1131870870 15:96763219-96763241 CAGGATATTAAAGATGAGAAAGG - Intergenic
1136030781 16:27501325-27501347 CAGGATTCAGAAGATGATCATGG - Exonic
1137278048 16:46950301-46950323 CAGGACCTTAAAGATAAGTATGG + Intergenic
1137812015 16:51361620-51361642 CAGGAACTCAAATATCAGCATGG - Intergenic
1138332439 16:56225921-56225943 CAGGATGCAAATGATGAGAATGG + Intronic
1141234489 16:82202985-82203007 CAGGAGCTATAAGACTAGCATGG + Intergenic
1141322958 16:83028954-83028976 CAGGTTGTAAATGATGAGCCAGG - Intronic
1143278696 17:5733908-5733930 AAGGATGCAAAAGATGGGCAAGG + Intergenic
1143630704 17:8138532-8138554 CAGGAAGTAAAAGCTGAGAAGGG + Intergenic
1144117656 17:12114971-12114993 CAGGCTTTGAAAGATGAGAATGG - Intronic
1144496332 17:15748368-15748390 CAGCATTTAAAACACGAGCATGG - Intronic
1144605914 17:16665767-16665789 CAGCATTTAAAACACGAGCATGG - Intergenic
1144797812 17:17904462-17904484 AAGGAGCTGAAAGATCAGCAGGG + Intronic
1145828627 17:27897194-27897216 TGGGATCTAAAGGAGGAGCAGGG - Intergenic
1146211263 17:30945459-30945481 CAGGAGCTCAAGGCTGAGCATGG + Intronic
1146805760 17:35864047-35864069 CTGGATCTAAAAGATAGGGAAGG - Intronic
1150647631 17:66989437-66989459 CAGGAGCTAAGAGAAAAGCATGG + Intronic
1151055823 17:71030518-71030540 CAGTATCTTAAAGAGGGGCAGGG + Intergenic
1151172157 17:72255991-72256013 CAGGATCTCAAATATGTGAAGGG - Intergenic
1153681555 18:7505601-7505623 CGGGCTCTAAAATATGAGCAAGG + Intergenic
1154375986 18:13810273-13810295 CAGGTGCTAAAGGATGAGGAGGG - Intergenic
1156120797 18:33840735-33840757 CAGCATGTAATAAATGAGCATGG + Intergenic
1156548121 18:37986367-37986389 TAGGATCTAAAATATCACCATGG + Intergenic
1157599892 18:48887425-48887447 CAGGAGCTCAACGCTGAGCAGGG - Intergenic
1159083893 18:63765688-63765710 CAGGATCTAAAATATAAGAATGG - Intronic
1159492878 18:69161642-69161664 CAGGACTGCAAAGATGAGCAAGG - Intergenic
1159743049 18:72197173-72197195 CATGATATAGAATATGAGCATGG + Intergenic
1161058931 19:2204776-2204798 GAGGACCTCAAACATGAGCAGGG - Intronic
1161817865 19:6510879-6510901 CAGAATCTCCAAGATGACCATGG - Intergenic
1165641682 19:37394378-37394400 CAGGATCAGAAAGATGGGCTGGG - Intergenic
1166702117 19:44888236-44888258 CTGGATCTAGAGGATGAGGAGGG + Exonic
1167753484 19:51395002-51395024 CTGGACCTAAAAGAGGAGAAAGG - Intergenic
927285067 2:21348636-21348658 TAGGATTTAAAAGATGAGGAAGG + Intergenic
928328916 2:30342262-30342284 CAGGACCCAAAAGATGAACAGGG + Intergenic
930107347 2:47650602-47650624 CAGGAGCTAGAAGACGGGCATGG - Intergenic
930544568 2:52750102-52750124 CAGGCTCTAAAAGCTGAAAAAGG + Intergenic
930950730 2:57141427-57141449 CAGTATCTAAAAACAGAGCATGG - Intergenic
931648865 2:64451048-64451070 CTGTAACTAAAAGTTGAGCAGGG - Intergenic
931786293 2:65622127-65622149 AGAGATCCAAAAGATGAGCAGGG + Intergenic
934176829 2:89584456-89584478 TTGGGTCTGAAAGATGAGCAGGG + Intergenic
934287136 2:91658816-91658838 TTGGGTCTGAAAGATGAGCAGGG + Intergenic
935563722 2:104584830-104584852 AAGGATCTAGAAGTTGTGCAGGG + Intergenic
936025711 2:109029604-109029626 CAGGCTCCAAAAGTAGAGCAGGG + Intergenic
939139325 2:138335031-138335053 AAAGAGCTAAAAGATGACCAGGG + Intergenic
940891724 2:159042116-159042138 CAGGACTTCAAAGATGAGAACGG - Intronic
941298683 2:163773409-163773431 CATGGTGTAAAAGATCAGCAGGG + Intergenic
941501176 2:166279018-166279040 CAGGATCAAGAAGATTGGCAGGG + Intronic
941721101 2:168813996-168814018 CATGATCTAAAAGCTGAGCAAGG - Intronic
941802913 2:169680684-169680706 AAGGATCCAGAAGAGGAGCAGGG + Intronic
943963857 2:194304967-194304989 CAGGAACTAAAAGAACAGCATGG + Intergenic
945428287 2:209734900-209734922 AAGGAGCTAAAAGATGAACAGGG - Intergenic
945969307 2:216220591-216220613 CAGAATCTACAAGATGAGAGGGG + Intergenic
946911097 2:224461951-224461973 AAGGAATGAAAAGATGAGCATGG + Intergenic
947105925 2:226667824-226667846 GAGAATCTCAAAGAAGAGCAAGG - Intergenic
1169597022 20:7212088-7212110 TAGGATTTAAAAGAGGAGCAAGG + Intergenic
1172563100 20:35906630-35906652 CAGCAGCTGAAAGATAAGCAAGG - Intronic
1174960548 20:55151851-55151873 GAAGATGTAAAAGATGAGGAGGG - Intergenic
1175006482 20:55688706-55688728 TATGATATAAAAGATGAACATGG - Intergenic
1176886981 21:14268914-14268936 CATGATCTAAAAGAAATGCACGG + Intergenic
1177930273 21:27273018-27273040 CAAGACCTGAAAGATGAGGATGG + Intergenic
1178831177 21:36058154-36058176 CAGGATCTAAAAGAATACAATGG + Intronic
1178860719 21:36286751-36286773 CAGGAGTTAAAAGATCAGCCTGG + Intronic
1179124761 21:38581013-38581035 CTGGGTCTGAAAGATGAGCAGGG - Intronic
1181313457 22:21957733-21957755 CAGGAGCCGAAACATGAGCAAGG - Intronic
1181346563 22:22223805-22223827 CAGGAGCCGAAACATGAGCAAGG - Intergenic
1184237215 22:43189322-43189344 CAGGATTTACAAAGTGAGCATGG - Intergenic
1185342493 22:50297967-50297989 CGGGGTCTAAAGGATGGGCAGGG - Intronic
949706529 3:6824447-6824469 CAGAATCCCAAAGATGAGCTGGG + Intronic
950187275 3:10952852-10952874 CAGAACCTCCAAGATGAGCAGGG + Intergenic
951707880 3:25561997-25562019 CAGGGTAAAAAAGTTGAGCAGGG - Intronic
956753214 3:72361459-72361481 CGGGAACTAAGAGAGGAGCAGGG - Intergenic
956810754 3:72861991-72862013 CAGGTTCTAAGAGTTGAGGATGG - Intergenic
956957378 3:74356389-74356411 CAGGACTTGAAAGATGACCAGGG - Intronic
959892351 3:111570756-111570778 CTGGATCTAGAGGATGAGGAGGG - Intronic
964419206 3:156483553-156483575 CAGAATTTATATGATGAGCATGG - Intronic
964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG + Intergenic
967022717 3:185536546-185536568 CAGGTTATTAAAGATGGGCAAGG - Intronic
967384661 3:188899536-188899558 CAGCAACTAAAAGATGGGCTAGG - Intergenic
968598968 4:1500272-1500294 TAGGATCTAAGGGATGAGCTGGG + Intergenic
970282659 4:14475117-14475139 CAGTATCTAAAAGATGCAAAAGG + Intergenic
971167724 4:24201622-24201644 TATAATCTAAAAGATGAACAAGG - Intergenic
972028175 4:34413773-34413795 CTTGTACTAAAAGATGAGCATGG - Intergenic
972080918 4:35147938-35147960 GAGGAGCTAATAGAGGAGCAAGG + Intergenic
973880539 4:55267399-55267421 TGGAATCTAAAATATGAGCATGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974847312 4:67366763-67366785 CAGCAATTAAAAGAAGAGCAAGG + Intergenic
975023730 4:69522601-69522623 CAGGAACAAAAAGATTACCACGG - Intronic
975202486 4:71607826-71607848 CAGGATCTCAAAGCCAAGCAGGG - Intergenic
976013922 4:80526792-80526814 CAGGATCTAAAAGGTGTGTAAGG - Intronic
976079149 4:81335411-81335433 TAGGGTCTAAAAAATGAGCAAGG - Intergenic
977737289 4:100432244-100432266 CTGGTTTTAAAAGATGAGAAAGG - Intronic
979639111 4:122991314-122991336 TAGGATTTAAAAGAGCAGCAAGG - Intronic
982019043 4:151185360-151185382 CAGGATAGGAAAGATGAGAAGGG - Intronic
984653775 4:182295858-182295880 CAGGACCTAAAAGTTAAACAAGG + Intronic
985026900 4:185747344-185747366 CAGGCTTTAAACGATGAACAAGG + Intronic
985392295 4:189502896-189502918 AAGGATTTCAAAGATGAGTAGGG + Intergenic
985694108 5:1330340-1330362 CAGGAACAGAAAGATGACCACGG + Exonic
986202371 5:5590044-5590066 CAGGTGGTAAAAGATGACCAGGG + Intergenic
987417177 5:17674626-17674648 CAGGGTCTAAAATATGTGTAAGG - Intergenic
990344125 5:54854666-54854688 CATGATCTACAAGCTGAGAATGG - Intergenic
990387372 5:55279325-55279347 CAAGTTATAAAAGATGAACAGGG + Intronic
990960706 5:61391007-61391029 CAAGATCTATAAGATCAGCCAGG - Intronic
991219591 5:64197970-64197992 CAAGATCTAAATGATGAGAAAGG + Intronic
993113797 5:83693706-83693728 CAGGATAAAAAATATCAGCAGGG + Intronic
993687087 5:90950965-90950987 GAGGATATAAAAGAAGAGCGAGG - Intronic
993808003 5:92436649-92436671 CAGGAGCTAATAGATGAATAGGG + Intergenic
999225078 5:150015133-150015155 CAGGACTTCAAAGGTGAGCAGGG + Intronic
999728717 5:154459214-154459236 CAGGATCTCAAAGTTGGGAAAGG + Exonic
1002329655 5:178432804-178432826 CAGGACCTCAAGGAAGAGCAGGG - Intronic
1003336157 6:5174836-5174858 GAGAATATAAAAGATAAGCAAGG + Intronic
1003989279 6:11469859-11469881 AAGGAGCAAAAACATGAGCATGG + Intergenic
1004964826 6:20836549-20836571 CAGTATTTCAGAGATGAGCAAGG - Intronic
1009275736 6:61676827-61676849 CAATATCTAAAATATTAGCATGG - Intergenic
1013382131 6:109584852-109584874 CACTATTTAAAAAATGAGCATGG - Intronic
1014028191 6:116672657-116672679 CAGTGTCTAAAAGATGAATATGG - Intergenic
1014475771 6:121870932-121870954 CAGGCTGTAAAAGAAGTGCATGG - Intergenic
1016509527 6:144825553-144825575 CATGACCTAAAAAATGAGAATGG - Intronic
1018458544 6:163975215-163975237 CAGAATCTAAAAGAAAGGCATGG + Intergenic
1023214417 7:37846950-37846972 GTGGACCTAATAGATGAGCACGG - Intronic
1024826864 7:53400494-53400516 CAGGAGCTAAAAGCTGGGGAGGG - Intergenic
1026180025 7:68030756-68030778 CTGGTTTTTAAAGATGAGCATGG + Intergenic
1026223674 7:68422360-68422382 CAGGCTAAAAAAGATGAGGAAGG - Intergenic
1027693866 7:81383889-81383911 CAGGATATAAAATACTAGCAAGG + Intergenic
1028184491 7:87767113-87767135 CAGGACCTGAAAGATGAGTTAGG - Intronic
1028484291 7:91341195-91341217 CAGAATCTAAGGGAGGAGCATGG + Intergenic
1031822104 7:126515638-126515660 CAGCCTCTAAAAGATGAAAAAGG - Intronic
1032912538 7:136449865-136449887 CAGCCTCTAAAAGCTGAGAATGG - Intergenic
1036529720 8:9573054-9573076 TAGAATCTAAAATATGAGAATGG - Intronic
1037895436 8:22649520-22649542 CCGCATCTAAAAGATGGCCAAGG + Intronic
1038313279 8:26462252-26462274 GAGGAGCTCAAAAATGAGCAAGG + Intronic
1039542719 8:38384761-38384783 CAGTATTTGAAAGATGAGCTAGG - Intergenic
1039851379 8:41368531-41368553 CAGGAAGAAAGAGATGAGCAGGG - Intergenic
1041864033 8:62548079-62548101 CAGGTTCTATGAGATGAACAAGG - Intronic
1046281646 8:112041052-112041074 GAGGATGTAAAAGATGAGGCAGG + Intergenic
1047657807 8:126997906-126997928 CAGGATCAAAAGGAAGAACAGGG + Intergenic
1047850688 8:128853921-128853943 CAAGATCTCAAAGATGGGCTGGG + Intergenic
1048187170 8:132251957-132251979 AAGGATCCAGAAGATGAGAAAGG - Intronic
1048828969 8:138457476-138457498 CAGAATGTAGATGATGAGCATGG + Intronic
1048871605 8:138803839-138803861 TAGAATATAAAAGATGAGCTGGG - Intronic
1050981486 9:12021510-12021532 CTTGATCTAAAAGAGTAGCATGG + Intergenic
1055034104 9:71799584-71799606 AAGGATCTAAAGGCTGAGCACGG + Intronic
1055076538 9:72220984-72221006 CAGGCCCCAAAAGATGATCAGGG - Intronic
1056849892 9:90073603-90073625 CAGGGTCTAAATGATGAAAAAGG - Intergenic
1057710807 9:97441913-97441935 CAAGATCTCAAAGTTGGGCAGGG - Intronic
1059784686 9:117568069-117568091 CTAGATCTGAAAGTTGAGCAGGG + Intergenic
1059851098 9:118341189-118341211 CAGGATCTAGCAGATAAGCAAGG - Intergenic
1061320569 9:129825799-129825821 CAGGAAATACAAGATGAGCCCGG - Intergenic
1186084983 X:5977757-5977779 CAAAAACTGAAAGATGAGCACGG + Intronic
1186289537 X:8081339-8081361 GATGATCTCAAAGATGAGCATGG + Intergenic
1186583873 X:10850596-10850618 CAGCCTCTAAAAGCTGAGAAAGG + Intergenic
1187562354 X:20414743-20414765 CAGAATCCACAGGATGAGCATGG - Intergenic
1189046921 X:37603199-37603221 CAGGATCTAAAAGATGAGCAGGG + Intronic
1189663433 X:43327517-43327539 CTGGATCTAAACTATTAGCAGGG - Intergenic
1189700404 X:43712836-43712858 CAAGATATAAAAGACGAGAAGGG - Intronic
1194959467 X:100218510-100218532 CAGGATCAAACAGCTTAGCAAGG + Intergenic
1196579668 X:117363912-117363934 CAGGATGTAAAAGCTGAGTCAGG - Intergenic
1197659488 X:129154770-129154792 CAGGGTGAAAAAGATGAGCAGGG + Intergenic
1199059625 X:143339523-143339545 CAAGATCTAAAATGTGACCATGG - Intergenic