ID: 1189047068

View in Genome Browser
Species Human (GRCh38)
Location X:37604671-37604693
Sequence CTCAAAATCAAGAGCAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189047061_1189047068 6 Left 1189047061 X:37604642-37604664 CCAGCTATTGACTGGTGTGACAG 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1189047068 X:37604671-37604693 CTCAAAATCAAGAGCAGGGATGG 0: 1
1: 0
2: 0
3: 32
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189047068 Original CRISPR CTCAAAATCAAGAGCAGGGA TGG Intronic
900699650 1:4037626-4037648 CCTAAAACCAAAAGCAGGGAAGG + Intergenic
900710770 1:4112168-4112190 CTCACAGTCAAGAACAAGGAAGG + Intergenic
901093042 1:6655806-6655828 CTCAAAAACAAGAACAGGCCGGG + Intronic
902300994 1:15502678-15502700 CTCAGTCTCAACAGCAGGGAGGG - Intronic
902725788 1:18335139-18335161 CTCCACAACAAGAGCAGGAAAGG - Intronic
902907085 1:19566336-19566358 TTAAAAATAAACAGCAGGGATGG + Intergenic
902994185 1:20211102-20211124 CTCAAGATCAAGGCCAGGGGAGG + Intergenic
903071004 1:20727005-20727027 CTCAAGATCTACAGCGGGGAGGG - Exonic
903232496 1:21930476-21930498 CTCAAGATCTAGAACAGGGCGGG + Intronic
905908618 1:41638711-41638733 CCCAAAATCATGAGGAGGGAGGG + Intronic
907710638 1:56877331-56877353 GGCAAAGTCAAGAGCAGGGGAGG - Intronic
909883882 1:80915513-80915535 GCCAAAATCAGGAGCAGGAAGGG - Intergenic
910000382 1:82334016-82334038 CTCAAAATCAACAGTAGGTGAGG + Intergenic
911475803 1:98370811-98370833 CTGATCATCTAGAGCAGGGATGG - Intergenic
912407616 1:109453578-109453600 CTCAGAAGAAAGAGAAGGGATGG - Intergenic
912937775 1:114019031-114019053 CTCAAAATCCAAGGCAGGGGTGG - Intergenic
914423940 1:147556897-147556919 CTCAGAACCTAGAGCAGTGATGG + Intronic
914913867 1:151806361-151806383 CTCCACAACAAGAGCAGGGCTGG + Intronic
915767657 1:158381709-158381731 CAGAAAATGCAGAGCAGGGATGG + Intergenic
917068698 1:171125762-171125784 CACAAGATCAAGGGTAGGGATGG - Intergenic
917250879 1:173059663-173059685 CTCAACATCAATGGCAGAGAGGG + Intergenic
919053993 1:192546088-192546110 ATCAAAATCATGAGCTGAGATGG + Intergenic
919375726 1:196791881-196791903 CTCACAATCAAGAACAGGAAAGG + Intronic
919384913 1:196909204-196909226 CTCATAATCAAGAACAGGAAAGG + Intronic
919385424 1:196916770-196916792 CTCACAATCAAGAACAGGAAAGG + Intronic
922214507 1:223509427-223509449 CCTAAACTCAAGAGCGGGGAGGG - Intergenic
922376858 1:224977524-224977546 CAATAAATCAAGAGGAGGGAAGG + Intronic
924577416 1:245292921-245292943 TTAAAATTCAGGAGCAGGGACGG - Intronic
924894474 1:248320889-248320911 CTCAATACCAAAAGCAGAGAAGG + Intergenic
1064007057 10:11707222-11707244 CTGAGAATCCAGATCAGGGAAGG - Intergenic
1064427567 10:15243649-15243671 CAAAAAATAAACAGCAGGGATGG + Intronic
1067920217 10:50448016-50448038 CTCAAAATGAAGAGATGGGATGG + Intronic
1068294624 10:55053943-55053965 CTAAAAACCATGAGCAGTGAAGG + Intronic
1069936424 10:71920573-71920595 CTCAGCACCTAGAGCAGGGATGG + Intergenic
1070044541 10:72819138-72819160 CTAAAAATCAATAGCAGAGAGGG + Intronic
1071113710 10:82192600-82192622 CAGGAAGTCAAGAGCAGGGATGG - Intronic
1071723828 10:88175843-88175865 CTCCAATACAATAGCAGGGAGGG - Intergenic
1071904825 10:90161299-90161321 CTCAAGATCAAGAGGAAGGCTGG - Intergenic
1072572694 10:96672619-96672641 CTCAAGCTGAAGAGCAGGTAGGG - Intronic
1074441764 10:113483803-113483825 ATGAAAAGCAAGAGCAGGAAAGG - Intergenic
1074727898 10:116333043-116333065 CTAGAAAACAAGAGCAAGGAAGG - Intronic
1075055269 10:119213770-119213792 CTCAAAATGAGAAGCAGGGGTGG - Intronic
1075424646 10:122332122-122332144 CACAAAATCAAGAGCAAGCAAGG - Intronic
1076156148 10:128207125-128207147 CTGAACACCAAGGGCAGGGAAGG + Intergenic
1076660332 10:132051468-132051490 CCCAGAATCATGAGCAGGCAGGG - Intergenic
1077662626 11:4083123-4083145 CTCAAACTTAAGAGCAAGGCAGG - Intronic
1078512280 11:11994430-11994452 CTCAAAATGGACAGAAGGGAAGG + Intronic
1078942729 11:16026388-16026410 GTCAAAAGCAATAGAAGGGAAGG + Intronic
1079460661 11:20675224-20675246 CTCAAAATCAAGAGATGGGGAGG + Intronic
1079935216 11:26608526-26608548 CTCAGAATTAAGAGGAGGAAAGG + Intronic
1080934737 11:36850915-36850937 ATAAAAATCAAGAGGAGAGAAGG - Intergenic
1081327714 11:41766431-41766453 CTGAAAATCAAGAACAGTGATGG - Intergenic
1081751928 11:45517515-45517537 CCCAGAAGCCAGAGCAGGGAGGG + Intergenic
1082666037 11:55977278-55977300 CTCAAAATGAAGAGTATAGAAGG + Intergenic
1083839388 11:65295288-65295310 CTCATAATCAAGATCAAGGAAGG - Intronic
1083876915 11:65529110-65529132 ATCAGAATCAGGAGCAGGGGAGG + Intronic
1084440500 11:69170054-69170076 CTCACAGTCAACAGCAGGGCAGG + Intergenic
1085452151 11:76640838-76640860 CACAGAATAAAGAGCAGGCATGG + Intergenic
1087536349 11:99451148-99451170 CTTAAAGTCAAGAGAAAGGATGG + Intronic
1087774057 11:102241703-102241725 TTTAAAATCAAGAGCAAGGCCGG + Intergenic
1087879183 11:103394528-103394550 CTCAATACCAAGAGGAGGGTAGG + Intronic
1088825381 11:113489584-113489606 CTCAAAGTCAAGACCCGGAAGGG + Intergenic
1089783189 11:120888949-120888971 ATCAAAAACAAGTCCAGGGAAGG - Intronic
1090524284 11:127513810-127513832 CTTAAAATATAGAGCAGGAAGGG - Intergenic
1091301693 11:134512068-134512090 CTCTGAATTAAGAGCAAGGAAGG + Intergenic
1091403154 12:193112-193134 CCCAGAAAGAAGAGCAGGGAAGG + Intronic
1092167890 12:6354297-6354319 CTGAAAAACAAGAGCAAGGAAGG + Intronic
1095839781 12:46680568-46680590 TTCAAAATTATGAGCAGGGTGGG - Intergenic
1098262155 12:68682653-68682675 TTCAAAATAAAAAGTAGGGAGGG + Intergenic
1098274773 12:68802336-68802358 ATCATTATCAAGAGAAGGGAGGG + Intergenic
1098282936 12:68879810-68879832 CACAAAACAAAGAGTAGGGAGGG + Intronic
1099770414 12:87045662-87045684 CTTAAAAACAAAAGCAGGAATGG + Intergenic
1101300279 12:103472555-103472577 CAGAAAATCTAGAGCAAGGAGGG - Intronic
1104665220 12:130642984-130643006 CTCAAACTCCAGAGCAGGTGGGG - Intronic
1105455368 13:20535935-20535957 CTCAAAAACAAGAGCAAGGCTGG + Intergenic
1106057172 13:26249271-26249293 CTCAAAGCAAAGAGCAGGGCTGG - Intergenic
1106159796 13:27190805-27190827 CCCAAGATCAAGAGCAAAGAAGG + Intergenic
1111949102 13:94695951-94695973 CCCAAAATCAAGAGCTAGGTAGG - Intergenic
1112678885 13:101739298-101739320 CTCAAGATCAAGAACAGTGATGG - Intronic
1112701849 13:102019176-102019198 CTCAAGATGAAGATCTGGGATGG - Intronic
1113372345 13:109734657-109734679 CTCAAAACCAAGTGCATGGCCGG + Intergenic
1114539759 14:23446310-23446332 CTTGAAATCAAGAGAATGGAGGG + Intergenic
1118255744 14:64204015-64204037 AGAAAAGTCAAGAGCAGGGAGGG - Intronic
1120477013 14:85001397-85001419 GTCAACATCAAGTGCAGGGATGG - Intergenic
1121307992 14:92918808-92918830 ATCCAAATCAATAGCAGGGCTGG - Intergenic
1121326869 14:93025242-93025264 CCGGAAATCAAGAGCAGGAATGG + Intronic
1122888361 14:104721580-104721602 CTGAAAAACAATAGCATGGATGG - Intronic
1124046688 15:26156916-26156938 CTTCATATCCAGAGCAGGGATGG - Intergenic
1124692669 15:31838752-31838774 CTCAAAATCAGGAGTAGTGGGGG - Intronic
1124862535 15:33456615-33456637 CTCCAAACCAAGATAAGGGATGG - Intronic
1125273583 15:37967799-37967821 CTCAAGTCCAAGGGCAGGGAGGG + Intergenic
1126134448 15:45377543-45377565 TATAAAATCTAGAGCAGGGAGGG + Intronic
1128280307 15:66388519-66388541 CTAAAAATCTAGAGAAAGGAAGG - Intronic
1129177960 15:73853574-73853596 CTCAGACTCAAAAGAAGGGAAGG - Intergenic
1131631643 15:94182786-94182808 TTAAAAATCAAGAGAAGGAAAGG - Intergenic
1131868361 15:96735431-96735453 CTCAGAATTTAGATCAGGGAAGG - Intergenic
1131994768 15:98123359-98123381 GTCTAAAGCAACAGCAGGGAAGG + Intergenic
1132798995 16:1742268-1742290 GCCATAAGCAAGAGCAGGGATGG - Intronic
1133569410 16:7026255-7026277 CTCCAAGTCAGGAGCAGGAAAGG - Intronic
1133923884 16:10179318-10179340 CTCCAAACCCAGAGCATGGAGGG - Intronic
1133958440 16:10468529-10468551 TTCCAGGTCAAGAGCAGGGATGG + Intronic
1134527530 16:14955790-14955812 CTAAAAATCAAGGCCAGGCACGG - Intergenic
1138326391 16:56174350-56174372 TTAAAAATAAAGAGCAGTGAGGG - Intergenic
1138708181 16:58939218-58939240 CTCAAACTAAGGACCAGGGAAGG - Intergenic
1138731554 16:59200902-59200924 CTCAACACCAAGAGCAGTGTTGG - Intergenic
1141684744 16:85563794-85563816 CCCCAAATCCAGAGAAGGGAGGG - Intergenic
1141965635 16:87440909-87440931 CTGAAAATGAAGGGCAGGGCTGG - Intronic
1143228915 17:5334230-5334252 CTCAAAAAAAAGAGAAGGAAAGG - Intronic
1144629833 17:16865385-16865407 CTCAAAATCAGGACCAGTGAGGG + Intergenic
1144651596 17:17010732-17010754 CTCAAAATCAGGACCAGTGAGGG - Intergenic
1147363565 17:39946028-39946050 CAGAAAAGCAAGAGCAGAGAAGG + Intergenic
1147770812 17:42866754-42866776 ATCAAAAACTAGAGGAGGGAAGG + Intergenic
1147986323 17:44309373-44309395 CTCAGATTCTGGAGCAGGGATGG + Intronic
1148782765 17:50130715-50130737 CACAAAATTAAGAGGAGGGAGGG + Intergenic
1149208577 17:54277682-54277704 CTAAAAATAATGAGCAGGGCTGG + Intergenic
1149558102 17:57588600-57588622 CTTAAATATAAGAGCAGGGAAGG - Intronic
1149874025 17:60212558-60212580 CTCAATATGAAGAGTAGGAATGG - Intronic
1150087804 17:62289826-62289848 CTCAATATGAAGAGTAGGAATGG - Intergenic
1151305132 17:73258304-73258326 CTCAAAAACAAGAGCTTGGCTGG - Intronic
1152172493 17:78761841-78761863 GTCCAAAGCAAGAGCAGGAAAGG + Intronic
1152359647 17:79825685-79825707 ATCATAACCAAGACCAGGGACGG - Intergenic
1152738769 17:82009886-82009908 TTCTAAATCATGAGCAGGGGAGG - Intronic
1153243192 18:3049664-3049686 TACAAAATAAAGAGCAGAGAAGG - Intergenic
1153565762 18:6415306-6415328 AGCAAAGTCAAGAGCAGGAAAGG - Intergenic
1156807497 18:41203156-41203178 CCCAAATTCAAGAGTAAGGAAGG + Intergenic
1157691771 18:49688777-49688799 CTCAAATTCCAGAGCAAAGATGG + Intergenic
1159506016 18:69336869-69336891 CTCAAAATCATTAGCAAGTAGGG - Intergenic
1159687193 18:71437186-71437208 TCCAAAATCAAGAGCATGGCAGG - Intergenic
1159793245 18:72810734-72810756 TTCAAGAACAAGAGCATGGAAGG + Intronic
1159938717 18:74389171-74389193 GTCACAATCAAGAGAAGGAATGG - Intergenic
1160091782 18:75833962-75833984 CTCAAAATCAAGAGAACAGCAGG + Intergenic
1160575465 18:79850642-79850664 CTCAAAACGACGAGCAGGAAAGG - Intergenic
1161520635 19:4721775-4721797 CTCAAAAACAAAAGAAGAGAGGG + Intronic
1162748956 19:12816456-12816478 CTCAAAAAAGAGAGCAGGGCAGG - Intronic
1163051194 19:14685392-14685414 CTGAAAGTCAACAGCAGAGAAGG + Intronic
1165179508 19:33955722-33955744 CTCAAAATAAAGAGAAAGGAAGG - Intergenic
1165379143 19:35465701-35465723 CTCACATTGAAGAGAAGGGAAGG + Intergenic
1168706748 19:58474628-58474650 TTCAAAATTAAGAGCAGAGGGGG - Intronic
925105564 2:1287870-1287892 CTTAAAGTCAACAGCTGGGAAGG - Intronic
925214968 2:2086636-2086658 CTCAGAACCAACAGCAGGGCAGG - Intronic
925305261 2:2843910-2843932 CTCAGATCCTAGAGCAGGGAGGG + Intergenic
925478944 2:4248698-4248720 CTCCAACTCAAGGGCAGGGCTGG + Intergenic
925988897 2:9237867-9237889 CTCAAAATCATGGGAAGAGATGG - Intronic
926817845 2:16818004-16818026 CTCAAAATCAATACCTGGGAAGG + Intergenic
927695151 2:25234841-25234863 CTCCCCATCAAGAGCAGGGAAGG + Intronic
927867393 2:26598854-26598876 CTCAGGATGGAGAGCAGGGAGGG - Intronic
928775809 2:34761991-34762013 TTCAGAATCAAGAGAAGGTATGG - Intergenic
929031251 2:37651860-37651882 CTTAAAATGATGAGGAGGGATGG - Intronic
929428285 2:41865916-41865938 TTCAAAAGTAAGAGGAGGGAAGG - Intergenic
929428513 2:41868219-41868241 TTCAAAAGTAAGAGGAGGGAAGG - Intergenic
930614042 2:53574784-53574806 CTTAATATCTAGAGCAGGGGTGG + Intronic
935681847 2:105645114-105645136 CTCAGAATAAAGTACAGGGAGGG - Intergenic
935856102 2:107275971-107275993 CCCAAAATCAAGAGGAAAGAAGG - Intergenic
937032276 2:118750676-118750698 CACAAAATCAGGAGCAGAGCTGG - Intergenic
938086572 2:128405893-128405915 CTCATAATCTAGGGAAGGGAGGG + Intergenic
939108145 2:137973806-137973828 TTCAGAAACATGAGCAGGGAGGG + Intronic
939401822 2:141704459-141704481 TTCAAATTCAAGAACATGGAGGG - Intronic
941175165 2:162188494-162188516 CTCAAAATCAAGAGGAGTCCAGG + Intronic
942097143 2:172544316-172544338 CTCAGAACCTAGATCAGGGATGG + Intergenic
942440331 2:176028340-176028362 CCCAAAATCAGGATCAGGGAGGG + Intergenic
944508554 2:200441288-200441310 ATCAAAATCAGTAGCAGGGAAGG - Intronic
947104023 2:226649733-226649755 ATCAAATGCAAGAGCATGGAAGG + Intergenic
947762739 2:232615484-232615506 CACATAAACAAGAGCAGGCAGGG - Intronic
947830233 2:233134378-233134400 CTCAAGATTTAGAGGAGGGATGG + Intronic
948314616 2:237017916-237017938 CTCATAATCTAGAACAGGGTGGG - Intergenic
1169462160 20:5805155-5805177 CTCAAAAACAACAGCAGCAAAGG - Intronic
1169947861 20:11008727-11008749 CTCAACATCAAAGGCAGGGCTGG - Intergenic
1170099004 20:12678197-12678219 CTCAAAATCATGAGCATATAAGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170870004 20:20196755-20196777 CCCAAAATCCAGAGAAGGCAAGG + Exonic
1172610862 20:36251518-36251540 CTAAAAATAAATATCAGGGATGG + Intronic
1173009591 20:39169878-39169900 CTCACATTCAAGGGCAGAGAGGG - Intergenic
1173078202 20:39840913-39840935 TTCACATTCTAGAGCAGGGAAGG - Intergenic
1173473419 20:43340965-43340987 CTCAAATTAAACAGCAGTGATGG + Intergenic
1173650851 20:44663129-44663151 CTTCAAAGCAAGAGGAGGGAGGG + Intergenic
1173675160 20:44828001-44828023 TTCAAAATTAAGAGCAGAGATGG - Intergenic
1173717551 20:45222453-45222475 GTCAAGATCAAGAGCATGGCCGG + Exonic
1173941387 20:46914043-46914065 CTCAAAACGAAGAGGAGGAACGG - Intronic
1174064698 20:47856065-47856087 CCCAAAATCATGAGAAGGGCAGG - Intergenic
1174250870 20:49218678-49218700 ATAAAAATCAAGACCAGGCAAGG - Intergenic
1176991574 21:15503560-15503582 CCCATAATCAAGAGAAGGAAGGG + Intergenic
1179659818 21:42867093-42867115 TTCAAAACCAAGAGCAGGCCGGG + Intronic
1179983030 21:44906193-44906215 CTCAAAATGAAAAGAAAGGAAGG - Intronic
1180090795 21:45533061-45533083 CTCCAACCCAGGAGCAGGGAGGG + Intronic
1182352719 22:29707791-29707813 CTGAAATTCAGGAGCAGGCAAGG + Intergenic
1182361024 22:29746579-29746601 TTCAAAATCCAGAGCAGGCAGGG - Intronic
1182681162 22:32081041-32081063 CTCCAAAACAATACCAGGGAGGG - Intronic
1183347549 22:37316210-37316232 CTCAAAATAAAAAGAAAGGAAGG + Intergenic
1184948598 22:47822697-47822719 ATCAAAATCTAGAACAGGGCAGG + Intergenic
951492354 3:23285706-23285728 CTCAAAAAGAAAAGCAGGGTGGG - Intronic
953240312 3:41142831-41142853 CTCAAAATCAAGAAAAGAAAAGG + Intergenic
954931292 3:54284738-54284760 CTTAAAATCAGGATCAGAGACGG + Intronic
955596688 3:60598265-60598287 CTCAAAATAATTAGCAGGAAAGG + Intronic
956193939 3:66633445-66633467 CTGCAAATCAAGAGCTGTGATGG - Intergenic
956432560 3:69201887-69201909 GTCAAAATCAAGAGAGGGGCTGG + Intronic
956623259 3:71242072-71242094 GTCACTTTCAAGAGCAGGGAAGG - Intronic
959745050 3:109766662-109766684 TTAAAAATCAAAAGCAGGGATGG - Intergenic
960955903 3:123030499-123030521 CTCATGCTCAAGAGCAGGAAAGG + Intergenic
961589494 3:127966031-127966053 CTCACTATCAAGAGTAGGGCAGG - Intronic
962130333 3:132666437-132666459 TTCAAAATCAAGAGTAGGAAAGG - Intronic
964450503 3:156808181-156808203 CCCAAAAAAAAGAGAAGGGAAGG + Intergenic
965892454 3:173531037-173531059 CTAAAAATGAAGAGCAGAGTAGG - Intronic
966231027 3:177652287-177652309 CTCAAAATCTGGAACAGGGAAGG - Intergenic
966319840 3:178689633-178689655 CTCAAAATAAAGAGAAGTTATGG + Intronic
966535014 3:181022522-181022544 CTCAAAATGAAGGGAAGGGAAGG - Intergenic
967783364 3:193463974-193463996 CTCAAAATGAATAGTAGTGATGG + Intronic
967909315 3:194528056-194528078 CTCAAAAGAAAGAGAAGGGCGGG - Intergenic
968783003 4:2597436-2597458 CTAAAATACAAGAGCAGGGCTGG - Intronic
969514185 4:7637401-7637423 CTCCAAAGCAGGACCAGGGACGG - Intronic
971796975 4:31240781-31240803 CTGAAAGTCAAAAGCAGGGAAGG - Intergenic
972993376 4:44850061-44850083 CTAAAAATTAAGGGAAGGGAAGG + Intergenic
975111028 4:70626663-70626685 CTTAAAATCTAGAGCAATGAGGG + Intergenic
975271441 4:72438826-72438848 CTCAAAATGTAGTGCAGAGAGGG - Intronic
975692391 4:76978817-76978839 GTCACAATCAACTGCAGGGAGGG - Intronic
975797619 4:78025677-78025699 CTTAGAATCAATAGAAGGGAGGG + Intergenic
976206141 4:82625270-82625292 ATCAGAAGCAAGAGGAGGGAAGG - Intergenic
977125958 4:93168199-93168221 CTCAAAAGAAAGAAAAGGGAAGG + Intronic
977387190 4:96356674-96356696 CTAAAAGTCATGACCAGGGATGG - Intergenic
980476310 4:133322294-133322316 TTCAAAATCCAGAGAAGGAAAGG - Intergenic
985622891 5:964814-964836 CTCTAAATCAATAACAGAGAAGG - Intergenic
985752601 5:1689649-1689671 ATCAATATCAAGAGAGGGGAGGG + Intergenic
985859799 5:2462039-2462061 TTAAACATCAAGAGCAGGGCAGG + Intergenic
990392167 5:55334996-55335018 GACAATACCAAGAGCAGGGAAGG - Intronic
990614640 5:57494972-57494994 CTCAGATTCAAGAGCTGGGGAGG + Intergenic
991345523 5:65662260-65662282 CTCAATATCAACATCAGAGAAGG - Intronic
991403947 5:66283668-66283690 CTCAAAATGAAGAGAATGGTGGG - Intergenic
992663402 5:78983773-78983795 CCTAAGATCAAGAGAAGGGAGGG - Intronic
994345539 5:98681232-98681254 CTGAAAGTCAAGAGCAATGAAGG + Intergenic
995093687 5:108211185-108211207 CTCAAAATAAAGGGAAGGGATGG - Intronic
996048222 5:118900633-118900655 CTCAAAATCAAGGGCCAGGCGGG + Intronic
996228889 5:121036510-121036532 CTAAAAATTAAGAGCAATGAGGG + Intergenic
996668048 5:126083766-126083788 CTGAAAATCCAGATCATGGAAGG + Intergenic
996915311 5:128704949-128704971 CTCAAAATAGAGAACAGGGAAGG - Intronic
997156626 5:131567315-131567337 CTCAAAAGCAAGCTCAAGGAAGG - Intronic
997880032 5:137581292-137581314 CTGAAACTCAAGAGCTGGGCTGG + Intronic
999471473 5:151858627-151858649 CTCATCATCAAGAGCAGGCTTGG - Intronic
1000681684 5:164193077-164193099 CTCAAAAACAATGGCAGGAAGGG + Intergenic
1001170023 5:169410503-169410525 CAAAAAAAGAAGAGCAGGGAAGG + Intergenic
1001952289 5:175824608-175824630 CTGAAAGTCAAGAGGAGGGCAGG + Intronic
1003303331 6:4904520-4904542 CCCAAAAGCCAGGGCAGGGAGGG - Intronic
1003735568 6:8874272-8874294 CTCAAAGTCCAGAGTAGGAAGGG + Intergenic
1004435240 6:15586052-15586074 CTCAAAATGGAGGGGAGGGAAGG + Intronic
1005976179 6:30801560-30801582 ATGGAAATCAAGAGCAGGGGAGG - Intergenic
1007150594 6:39686920-39686942 CCCAAAATAAAGAACAGGGCTGG + Intronic
1007914920 6:45552501-45552523 ATCCAAATCAAGTGAAGGGATGG - Intronic
1008598060 6:53062875-53062897 CACAAGATCAAGAGGAGAGAAGG - Intronic
1009735392 6:67670292-67670314 CTCAGAAGAAAGAGAAGGGATGG - Intergenic
1010991261 6:82482810-82482832 CTGAAAATCAAGACAAGAGATGG + Intergenic
1011649242 6:89490758-89490780 TTAGAAAACAAGAGCAGGGAAGG + Intronic
1011896502 6:92233781-92233803 CTCAAAATCAGGATCAGTTATGG + Intergenic
1016719366 6:147276014-147276036 CTCAAAATCAGAAGCAAGGTGGG - Intronic
1017092219 6:150770127-150770149 CGCAAAATCAAGAGCATCGTAGG - Intronic
1019314597 7:378744-378766 CCCAAGGCCAAGAGCAGGGAAGG + Intergenic
1019848393 7:3528890-3528912 CTCAAAAGCAAGGGGAGAGAAGG - Intronic
1019951737 7:4378668-4378690 CTCAGATTCAAGGGCAGGGGAGG + Intergenic
1020830690 7:13091181-13091203 CTAATAATTAAGGGCAGGGAGGG + Intergenic
1020854702 7:13404351-13404373 CTCAAAATAAAGAGAATGCATGG + Intergenic
1023387059 7:39669223-39669245 CTTAAAATCAAGTACAGAGATGG - Intronic
1023933054 7:44718477-44718499 CTCAAAAGAAACAGAAGGGATGG - Intergenic
1024295729 7:47840568-47840590 CTCAAAACAAAGAACAGGGGTGG + Intronic
1025996505 7:66530663-66530685 CTCAGAAGCAACAGCAGGGCCGG + Intergenic
1026988563 7:74570064-74570086 CTCAGAAGCAACAGCAGGGCCGG + Intronic
1028996451 7:97105410-97105432 CTCAAAAAAAAGAGGAGGCAGGG + Intergenic
1031676059 7:124613784-124613806 CTCAATACCAAGACCAGGCAAGG + Intergenic
1031681453 7:124680456-124680478 CTGAACATCAAGAGGAGGAAAGG + Intergenic
1031922663 7:127613212-127613234 AGCAAAAGCTAGAGCAGGGAGGG - Intronic
1032187347 7:129738285-129738307 ATCAAAATGAAGAGGAGTGAGGG + Intronic
1033735434 7:144217335-144217357 CTCACCATCAAGAGTAGAGAAGG - Intergenic
1033747620 7:144333634-144333656 CTCACCATCAAGAGTAGAGAAGG + Intergenic
1035684779 8:1515216-1515238 CTGAAACTCAAGTGCAGGGTGGG - Intronic
1039113857 8:34070515-34070537 CTTAAACACAAGAGCAGGGTTGG + Intergenic
1040385418 8:46912015-46912037 CACAAAAACAAGAGCTGGTAAGG - Intergenic
1040755721 8:50771807-50771829 CTCCACATCAAGAGCAGCCATGG + Intronic
1044695760 8:94920867-94920889 CTAAAAACTATGAGCAGGGATGG - Intronic
1044713118 8:95075909-95075931 CACAAAATCAAAATCAGGAAAGG + Intronic
1045520719 8:102900712-102900734 CCCAAAATAAAGCACAGGGAAGG - Intronic
1045843216 8:106603754-106603776 TTAAAAATCAAGAACAGGGCCGG + Intronic
1046922933 8:119752938-119752960 CCCAAAATGAGGAGCAGGCAGGG + Intronic
1047244207 8:123124629-123124651 CTTAAAATTAAGAGCTGGGCTGG + Intronic
1048891032 8:138946650-138946672 CTGAAAATGAATAGCAGAGATGG - Intergenic
1057106229 9:92420146-92420168 CTCAAAATGAAGAGTATGAAGGG - Intronic
1057306978 9:93918172-93918194 ATGAAAATCAAGACCTGGGAGGG + Intergenic
1057989685 9:99755686-99755708 TCCAAGATCAAGAACAGGGAAGG + Intergenic
1058575364 9:106395353-106395375 CTCAAGTTCATGAGCAGGCACGG + Intergenic
1058598562 9:106644282-106644304 CTCAGGATAAAGAACAGGGAGGG - Intergenic
1060029475 9:120202000-120202022 CTCAGACTCAAAAGCAGGCAGGG + Intergenic
1062096267 9:134705539-134705561 CTCCAAGTCACCAGCAGGGAAGG - Intronic
1186460000 X:9740303-9740325 CTCCAAACCACGTGCAGGGATGG + Intronic
1186533514 X:10322626-10322648 CTCAAAATCTAGCACAGGGAGGG + Intergenic
1187771761 X:22706376-22706398 CTCAAAGTAAATAGCAAGGATGG + Intergenic
1188269163 X:28117232-28117254 CTGAAAATCCAGAGCCTGGAAGG - Intergenic
1189047068 X:37604671-37604693 CTCAAAATCAAGAGCAGGGATGG + Intronic
1189235919 X:39487217-39487239 GCCAAAGTCAAGAGCAGTGAAGG + Intergenic
1189602125 X:42638327-42638349 CTCAAAAACAAGAGAATGGGTGG - Intergenic
1190652009 X:52576903-52576925 CACAAAATGAAGTTCAGGGAGGG - Intergenic
1191899114 X:66022786-66022808 ATCAAAATTGAGGGCAGGGACGG + Intronic
1195402469 X:104475964-104475986 CTCAAAATTAAAACCAGAGAAGG + Intergenic
1195575950 X:106450820-106450842 CTCAAAACTCAGAGAAGGGAAGG - Intergenic
1195874772 X:109528048-109528070 CTCCAAATCAAAAGCACAGAAGG + Intergenic
1196193335 X:112815984-112816006 TGCAAAATGAAGAGCAGGCAGGG + Intronic
1196436309 X:115677802-115677824 CTCAAAAACAAGAACAGGCCAGG + Intergenic
1196722262 X:118865482-118865504 CCCAAAAGCAAGAACAGGCAGGG - Intergenic
1198154656 X:133946912-133946934 CTCACAGTCAATAGAAGGGAAGG + Intronic
1198367163 X:135952441-135952463 CTCAAATTCAAATGCAGAGATGG - Intergenic
1201863835 Y:18628471-18628493 CACAAAATCTAGATCATGGATGG + Intergenic
1201869487 Y:18691907-18691929 CACAAAATCTAGATCATGGATGG - Intergenic