ID: 1189055920

View in Genome Browser
Species Human (GRCh38)
Location X:37699643-37699665
Sequence TGGATTGGTATACTGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189055920 Original CRISPR TGGATTGGTATACTGAAGAC AGG Intronic
908785905 1:67734306-67734328 TTGATAGGTTTTCTGAAGACTGG + Intronic
910516665 1:88069271-88069293 TGAATTGGTTTACTGGAGAAGGG + Intergenic
911190484 1:94943638-94943660 AGGAATGTTAGACTGAAGACCGG - Intergenic
913657341 1:120973873-120973895 TGGAGTGGTCCACTGAATACTGG - Intergenic
914008686 1:143756957-143756979 TGGAGTGGTCCACTGAATACTGG - Intergenic
914647316 1:149665608-149665630 TGGAGTGGTCCACTGAATACTGG - Intergenic
916384035 1:164247142-164247164 TGGAGTGGTATACGGAAGGTGGG + Intergenic
921118991 1:212120364-212120386 TGGATGGGTCTAAGGAAGACTGG - Intergenic
921295490 1:213697437-213697459 TGGAGTGGGTTACTGAAGAGAGG + Intergenic
1065982705 10:30917023-30917045 TGGAATGGTACACTTAAGATTGG - Intronic
1069556880 10:69404305-69404327 TGTATTGGTATACTGAAGGATGG + Intronic
1070107141 10:73445423-73445445 TATATTTGTATACTGAAGATGGG - Intronic
1072176225 10:92924843-92924865 TGGAGTGGTATAATGAACATTGG - Intronic
1079148356 11:17874775-17874797 TGGATTTGTAAACTGGAGCCTGG - Intronic
1081357496 11:42130374-42130396 TGGAGTGGTATAATGAACATGGG - Intergenic
1089010847 11:115130373-115130395 TGGATTAGGATCATGAAGACTGG + Intergenic
1089027901 11:115290919-115290941 TGTTTTGGTATGCTGAAGACGGG - Intronic
1089548650 11:119251949-119251971 TGGCTTTGTATACTAAAGCCTGG - Intronic
1091070073 11:132554634-132554656 TGGCCTGGTAGACTGGAGACAGG - Intronic
1097293472 12:57940122-57940144 TAGTTTGGAATACTGAAGGCAGG - Intergenic
1099164153 12:79281500-79281522 TAGAATGGTATAATGAACACTGG + Intronic
1100389875 12:94139149-94139171 AGGTTTGGTAAACAGAAGACAGG + Intergenic
1100682544 12:96943437-96943459 TGGATCTGCATTCTGAAGACTGG - Intronic
1102328699 12:112011661-112011683 TGGATTGGAATTGAGAAGACGGG - Intronic
1102514800 12:113439326-113439348 TGGATTGATACACTGATGAATGG - Intergenic
1108428906 13:50334170-50334192 TGGATTGGAAATCTGAAGCCTGG + Intronic
1110593042 13:77286825-77286847 AGTATTGGTATATTTAAGACTGG - Intronic
1111044075 13:82792117-82792139 TGGAATGGGATACTGAATCCTGG + Intergenic
1114477888 14:23010420-23010442 TGGATTGTTATGCTGGTGACTGG - Intergenic
1120531960 14:85642760-85642782 TGGATTGGTTGACTGAAATCTGG + Exonic
1120555643 14:85927507-85927529 TGTATGGGTATACTGAACTCAGG + Intergenic
1122168910 14:99854460-99854482 TGGATAGGTATTCTGTAGAGAGG + Intronic
1125220846 15:37333212-37333234 TAGATTGACATACTTAAGACAGG - Intergenic
1127640176 15:60908824-60908846 CTGCTTGGTATACTGAAGATGGG + Intronic
1128181087 15:65604765-65604787 TGCATTGAGATAATGAAGACAGG + Intronic
1129585631 15:76861519-76861541 TGGATAGAGATACAGAAGACAGG - Intronic
1131208949 15:90476490-90476512 TTGACTGGTGTACTGAAAACAGG + Intronic
1137231378 16:46570383-46570405 TGGAGTGCTGTACTGAAAACGGG - Intergenic
1139561162 16:67743318-67743340 TGGAATGGTATAGTGAGGAGAGG - Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1148087211 17:45001388-45001410 TTGATTGGTGAAGTGAAGACAGG - Intergenic
1152656726 17:81523341-81523363 TGGGTTGGTTTACTGAGGCCAGG - Intronic
1155388009 18:25302079-25302101 TGGAATGGAATGCTGAAGAATGG - Intronic
1157008109 18:43610981-43611003 TTGATGGTTATGCTGAAGACAGG + Intergenic
1158587136 18:58750291-58750313 TGGATTGGAAGACTGAATATTGG + Intergenic
1160284769 18:77531159-77531181 TGGAATGGTCTCCTGAAGACGGG - Intergenic
1165269392 19:34692012-34692034 TGGAGTGGTGTCCTGAAGAAAGG + Intergenic
1165942937 19:39424338-39424360 TGGATGGGTTGACTGCAGACAGG - Exonic
1167022632 19:46889484-46889506 TTGATTGGTTTACTAAAGAACGG - Intergenic
928716394 2:34065893-34065915 TGGAATGTTATATTGAGGACTGG + Intergenic
931727462 2:65125257-65125279 TTAGCTGGTATACTGAAGACAGG + Intronic
939757052 2:146127545-146127567 TGGAATGGAAAACTGAAGATGGG + Intergenic
942077182 2:172366797-172366819 TGGCTTAGCATACTGAAGATTGG - Intergenic
1172725453 20:37037080-37037102 TGCACTTGTTTACTGAAGACAGG - Intronic
1174944421 20:54969612-54969634 TGGATTTGTATACTTTAAACAGG + Intergenic
1177538968 21:22466744-22466766 TTGATTGGTTTAATGAAGTCTGG + Intergenic
1177786743 21:25679769-25679791 TTCATTGGTCTAATGAAGACAGG - Intronic
1177923486 21:27184130-27184152 TAGAATGGTAAACTGAAGAAAGG - Intergenic
1177927218 21:27233405-27233427 TGGATTGTTGTAGTGAACACAGG - Intergenic
1177951867 21:27548174-27548196 TGGACTGGCATTCTGAATACTGG + Intergenic
949336303 3:2978985-2979007 TGAAGTGGTATACTTAAGGCAGG - Intronic
949466717 3:4352107-4352129 GGGAGTGGTGGACTGAAGACGGG - Intronic
951385687 3:22039451-22039473 TGGAATGGTAGACTGGAGACAGG - Intronic
953221730 3:40977895-40977917 TGGATTAAGCTACTGAAGACTGG - Intergenic
953852317 3:46473872-46473894 TGGAGTGGTATGCTGAATAATGG - Intronic
954357501 3:50094535-50094557 TGCATTGCTATACTCCAGACTGG - Intronic
955557481 3:60153608-60153630 TGGATTGGTGTCCCTAAGACTGG - Intronic
958870163 3:99548926-99548948 TGGCTTGGTTTACTTAAGCCTGG - Intergenic
960292634 3:115904925-115904947 GGGATAGGTATTGTGAAGACAGG - Intronic
960723777 3:120649901-120649923 TGGATTGGTGTACTGAATGTAGG - Intronic
962549549 3:136475589-136475611 GGGATTGGATTACTGAAGGCTGG + Intronic
963445251 3:145396887-145396909 TTGACTGGGATAATGAAGACTGG + Intergenic
963529695 3:146459847-146459869 AGGATTGGAATACTTAAGTCAGG - Exonic
966040405 3:175478698-175478720 TTGATTGGTACACTGGACACAGG + Intronic
966248509 3:177835655-177835677 GTGATTGGTGTACTGAAGAAAGG + Intergenic
966718515 3:183037842-183037864 TGGATTGCTATACTGGGGAGAGG + Intronic
967242387 3:187453360-187453382 TGGTGTGGTATACTGAATAATGG + Intergenic
970118646 4:12727718-12727740 TGGTTGTGTATAATGAAGACAGG + Intergenic
970550765 4:17178662-17178684 TGGATTAGAATAAGGAAGACTGG + Intergenic
971803862 4:31328822-31328844 TGGTTTGAGTTACTGAAGACTGG - Intergenic
974177882 4:58347217-58347239 TGAATTGGTATTTTGAACACTGG + Intergenic
977571828 4:98636961-98636983 TGCTTTGGTATCCTGTAGACTGG - Intronic
977974552 4:103249042-103249064 TGGAGTGGTATAATGAACACTGG - Intergenic
978627162 4:110700368-110700390 AGGAATGGAATAATGAAGACTGG - Intergenic
981057581 4:140380593-140380615 TGAATTCATATACTGAATACAGG - Intronic
981390104 4:144179549-144179571 TGGATTAGTAGAGTGTAGACTGG + Intergenic
982314036 4:154013009-154013031 TGGACTGGAAGACTGGAGACCGG - Intergenic
998728030 5:145041429-145041451 TGGGTTGGTATAGGCAAGACTGG - Intergenic
1001976272 5:176002256-176002278 TAGATTGTTTTACTGAAGAATGG + Intronic
1002241150 5:177841515-177841537 TAGATTGTTTTACTGAAGAATGG - Intergenic
1003680794 6:8252999-8253021 TGGATTGGTTTTCTCAAGACTGG + Intergenic
1004472093 6:15938613-15938635 TGAATTGGGATTCTGAAGAGAGG + Intergenic
1007707016 6:43797361-43797383 TGGATTGGGAAACTGAAGCTTGG + Intergenic
1008096357 6:47343414-47343436 TGGATTTCTATAATGAAGAAGGG - Intergenic
1011584415 6:88909099-88909121 TGGACTGGTCTTCTGAAGAGAGG - Intronic
1011911266 6:92442871-92442893 GAGACTGGTATACTTAAGACAGG - Intergenic
1012719205 6:102720057-102720079 TGGAGTGGGATACTGAGAACAGG - Intergenic
1013651298 6:112197704-112197726 TGGATTTGCATGCTGAACACAGG - Intronic
1027845734 7:83371790-83371812 TGGATTGGTAGACAGTAGAAAGG - Intronic
1029344205 7:99966843-99966865 TGGATTTGGAGACCGAAGACTGG - Exonic
1029347292 7:99987679-99987701 TGGATTTGGAGACCGAAGACTGG + Intergenic
1030716282 7:112811461-112811483 TGCATTGCTATACTCAAGACTGG - Intergenic
1030737940 7:113072095-113072117 TGGTTTGGAATACTGAAGAAGGG - Intergenic
1030971681 7:116065004-116065026 TGGATTGTTCTCCTGAAAACAGG + Intronic
1038845912 8:31229473-31229495 TGGATTGGTTAACTGAAGCCTGG - Intergenic
1041305625 8:56455479-56455501 TGAATTGGAATAAAGAAGACTGG - Intergenic
1041472622 8:58227757-58227779 TGTATTGGTATTTTGAATACTGG - Intergenic
1041524931 8:58794802-58794824 TGGAGTGGTATAATGAACACTGG + Intergenic
1041538302 8:58953607-58953629 TTGAATGTTACACTGAAGACTGG + Intronic
1041788509 8:61663392-61663414 GGGATTGGTAAACTAGAGACTGG + Intronic
1043648050 8:82548018-82548040 CAGATTGGTATAATGAATACTGG + Intergenic
1050328854 9:4524821-4524843 TGGATTAGTATACTCAAGAGTGG - Intronic
1053730984 9:41056740-41056762 TGGACTGGAATATTGAAGAGAGG + Intergenic
1054697528 9:68375350-68375372 TGGACTGGAATATTGAAGAGAGG - Intronic
1055582194 9:77718110-77718132 TGCCTTGGTATGCTGAAGAAAGG + Exonic
1056218086 9:84423911-84423933 TGGGCTGGAAAACTGAAGACAGG + Intergenic
1058853290 9:109034319-109034341 TTTATTGGTTTCCTGAAGACTGG - Intronic
1189055920 X:37699643-37699665 TGGATTGGTATACTGAAGACAGG + Intronic
1189082924 X:37993772-37993794 TGGAGTGGTGTCCTAAAGACAGG + Intronic
1190480770 X:50874576-50874598 AGGATTGTCATAGTGAAGACTGG + Intergenic
1191849412 X:65574931-65574953 TGCATTGCTATACCTAAGACTGG + Intergenic
1193427160 X:81353759-81353781 TGCATGGGTATACTGCAGAGTGG + Intergenic
1193656515 X:84204979-84205001 TGTATAGGCATACTGAAAACTGG + Intergenic
1198273255 X:135075595-135075617 TGGATTAGTACATTGAAAACTGG - Intergenic
1198597564 X:138253495-138253517 TGGATAGGTATAGTGATGACAGG - Intergenic
1199700143 X:150369635-150369657 TGGGTTGGTATACAGATAACGGG + Intronic