ID: 1189058626

View in Genome Browser
Species Human (GRCh38)
Location X:37727881-37727903
Sequence CTGCACCAGAAGAGGATCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189058626_1189058637 25 Left 1189058626 X:37727881-37727903 CCCTGGATCCTCTTCTGGTGCAG 0: 1
1: 0
2: 0
3: 6
4: 166
Right 1189058637 X:37727929-37727951 GAGAAGGCCCTCAGTAGAGTGGG 0: 1
1: 0
2: 2
3: 11
4: 156
1189058626_1189058636 24 Left 1189058626 X:37727881-37727903 CCCTGGATCCTCTTCTGGTGCAG 0: 1
1: 0
2: 0
3: 6
4: 166
Right 1189058636 X:37727928-37727950 AGAGAAGGCCCTCAGTAGAGTGG 0: 1
1: 0
2: 2
3: 25
4: 225
1189058626_1189058633 9 Left 1189058626 X:37727881-37727903 CCCTGGATCCTCTTCTGGTGCAG 0: 1
1: 0
2: 0
3: 6
4: 166
Right 1189058633 X:37727913-37727935 ATTCCCTGAGAACATAGAGAAGG 0: 1
1: 0
2: 3
3: 22
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189058626 Original CRISPR CTGCACCAGAAGAGGATCCA GGG (reversed) Exonic
900003789 1:30577-30599 CTCCCCCAGAAGAGGAGGCAGGG - Intergenic
900023509 1:201091-201113 CTCCCCCAGAAGAGGAGGCAGGG - Intergenic
902669662 1:17964347-17964369 CTGCAGCACAAGGGAATCCATGG - Intergenic
905410094 1:37762735-37762757 CTGGACCACCAGAGGATCCCTGG + Intronic
906777031 1:48539095-48539117 TGGCCCCAGAAGAGGACCCAAGG + Intronic
907642435 1:56204677-56204699 AAGTACCAGATGAGGATCCATGG + Intergenic
908219108 1:61985671-61985693 CTGCACCTGCAGATGTTCCAGGG + Intronic
913974326 1:143442434-143442456 CTTCACCTGGAGAGGACCCATGG + Intergenic
914068716 1:144268048-144268070 CTTCACCTGGAGAGGACCCATGG + Intergenic
914110439 1:144698306-144698328 CTTCACCTGGAGAGGACCCATGG - Intergenic
915728411 1:158035392-158035414 CTCCATCAGCAGAGGGTCCAGGG + Intronic
915838215 1:159195021-159195043 CTCCACAAGAAGAGGATGAAGGG - Intronic
916485637 1:165256082-165256104 CTGACCCAGAAGATGAACCAAGG + Intronic
917699662 1:177567595-177567617 CTTCACCAGAGGAGGCTGCATGG + Intergenic
918246257 1:182662243-182662265 CAGCACCAGAAGAGGGACTATGG - Intronic
920251917 1:204627635-204627657 CTGCACCAAAAAAGGCTGCAGGG + Intronic
921041298 1:211435250-211435272 ATGTACCAGCAGAGGATACAGGG + Intergenic
922222345 1:223618333-223618355 TTGCACCAGGTGAGGACCCAGGG + Intronic
922567158 1:226608217-226608239 CTGCTCCAGCACAGGAACCAGGG + Exonic
923806926 1:237267703-237267725 CTGCACCTTAGCAGGATCCATGG + Intronic
1063889238 10:10612562-10612584 CTGCAGCAGAAGATGCTACAGGG + Intergenic
1066661584 10:37741913-37741935 CTGGGTGAGAAGAGGATCCAAGG + Intergenic
1067549703 10:47225801-47225823 CTGCACCTGAAGAGAATCTTTGG + Intergenic
1070597700 10:77844301-77844323 CTCCACCAGGAGAGGATTCTTGG + Intronic
1074947690 10:118297136-118297158 CTGCACCAGAAGGGGCCCCTTGG + Intergenic
1077179361 11:1205305-1205327 CTGAACCAACAGAGGAGCCATGG + Intergenic
1077723511 11:4650630-4650652 CAGCATCAGAAGAGGTCCCATGG - Intronic
1077973708 11:7223766-7223788 CTGGCCCAGAAGTGGATACAAGG - Intergenic
1078700962 11:13682451-13682473 CTGTACCAGAAAAGCAGCCATGG - Intronic
1079008274 11:16808027-16808049 CTGCACCACAAGAACCTCCAGGG - Intronic
1079244075 11:18740615-18740637 CTGCAGCAGGAAAGGGTCCAGGG + Exonic
1081777106 11:45683140-45683162 CTGCTCCAGGAGAAGCTCCATGG + Intergenic
1081988757 11:47326346-47326368 CTGCGCCGGAGGAGGATGCATGG + Intronic
1087027450 11:93663476-93663498 CTGGACCAGAAGCCAATCCAAGG - Intronic
1087233677 11:95695046-95695068 TTGGACCAGAAGAGGATAGAAGG + Intergenic
1091377208 12:32629-32651 CTCCCCCAGAAGAGGAGGCAGGG - Intergenic
1093909606 12:24731004-24731026 CTGCACCAGAACAGGATTCCAGG - Intergenic
1096862513 12:54540032-54540054 CTGCACCAGAACAGGGTGAAGGG - Intronic
1098442214 12:70531117-70531139 CTGCACAAGAAAAGAATTCAGGG + Intronic
1100739830 12:97579777-97579799 CTCTATCAGAAGAGGATACAAGG + Intergenic
1105428881 13:20319072-20319094 CTTTCCCAGAAGAGGATGCAAGG - Intergenic
1106729956 13:32530791-32530813 CTGCAGGATAAGAGGATGCAAGG - Intronic
1109640123 13:65180588-65180610 CTGTACCAGAAGTGGCACCAGGG - Intergenic
1110332894 13:74293242-74293264 CTGGGCCAGAAGAGATTCCAGGG + Intergenic
1113432476 13:110262613-110262635 CTGTACAAGAAGAGGAAGCATGG + Intronic
1118270680 14:64339334-64339356 TTGCCCCAGAACAGGAGCCAGGG - Intergenic
1118809977 14:69266117-69266139 CTTGACCAGAAGATGCTCCAGGG - Intronic
1119167574 14:72507821-72507843 CTTTACCAGAGGAGGATTCAGGG - Intronic
1121507917 14:94490545-94490567 CTCCTCCAGAGGAGGATCAAAGG - Intronic
1122871282 14:104640186-104640208 CTGCCCCATGGGAGGATCCAGGG + Intergenic
1123133583 14:106007582-106007604 CAGCACCAGGACAGGATCCCAGG + Intergenic
1125115896 15:36091321-36091343 CTTGACATGAAGAGGATCCAGGG - Intergenic
1129302171 15:74631729-74631751 CTGAACCAGAAGAGGCTTCCTGG - Exonic
1130956406 15:88630249-88630271 CGGCAGCAGAGGAGGAGCCAGGG + Exonic
1132121491 15:99179782-99179804 CTGCCCCAGAAGAACCTCCATGG + Intronic
1132449713 15:101960363-101960385 CTCCCCCAGAAGAGGAGGCAGGG + Intergenic
1133206814 16:4239020-4239042 CTGCACCAAATGAGGAGTCAGGG + Intronic
1133522249 16:6569999-6570021 CTAAACCAGAAGAGAATGCAAGG - Intronic
1136266833 16:29126252-29126274 CTGCAACAGCACAGGATGCAGGG - Intergenic
1139731867 16:68952737-68952759 CTGCCCCAGAGGAGGATTGAAGG + Intronic
1140754623 16:78056291-78056313 CTTGGCCAGGAGAGGATCCAGGG + Intronic
1141205479 16:81929855-81929877 GAGCACCAGAAGTGGATGCAGGG - Intronic
1147584757 17:41647860-41647882 CAGCAGCAGAAAAGGATGCATGG + Intergenic
1152825648 17:82463024-82463046 CTGCAGCAGAACAAGATCCCAGG + Intronic
1155765644 18:29629002-29629024 CAGCACTAGAAGATGATCCGGGG + Intergenic
1156491723 18:37500314-37500336 CTTCACCTTGAGAGGATCCAGGG + Intronic
1157128592 18:44981587-44981609 TTGCAAGAGAAGAGCATCCAGGG + Intronic
1159604102 18:70457291-70457313 CTGAGCCAGAAGAGGACCCAAGG - Intergenic
1160635542 19:72184-72206 CTCCCCCAGAAGAGGAGGCAGGG - Intergenic
1161035428 19:2081939-2081961 CTGCACCATAAGAAGGTCCAGGG + Intronic
1164934479 19:32200415-32200437 CTGCAGCAGCTGAGGCTCCAGGG - Intergenic
1165253852 19:34560717-34560739 CACCACCAGAAGACGTTCCAGGG - Intergenic
928438568 2:31272495-31272517 CTGCAGCAGGAGAGGCTTCATGG + Intergenic
929291096 2:40192863-40192885 ATGGAACAGAAGAGAATCCATGG + Intronic
931178350 2:59875571-59875593 CTCCTCCTGAAGAGGAGCCAAGG - Intergenic
933714317 2:85349238-85349260 CTGCCCCAGAGCAGGGTCCAGGG - Intronic
934179031 2:89603409-89603431 CTTCACCTGGAGAGGATCCATGG + Intergenic
934289316 2:91677679-91677701 CTTCACCTGGAGAGGACCCATGG + Intergenic
934715449 2:96540400-96540422 CTGCGCCAGAAGATGAGCCTGGG - Intronic
936565940 2:113582863-113582885 CTCCCCCAGAAGAGGAGGCAGGG + Intergenic
940019533 2:149142324-149142346 GTGCACCCGAAGAAGACCCATGG + Intronic
940746565 2:157574304-157574326 CTCCACCATAAGAGGACACAGGG - Intronic
942218042 2:173741806-173741828 CTGCACCAGAAGGGACTCCAAGG - Intergenic
944109093 2:196112198-196112220 CTTCACCATATGAGGATACAAGG + Intergenic
944373885 2:199017470-199017492 ATGCACTAGAAGAGGTGCCAAGG + Intergenic
945907991 2:215615572-215615594 ATGCAGCAGAAGAGGATGGAAGG - Intergenic
945985773 2:216352359-216352381 CTGCCCCAGCAGATGCTCCAGGG + Intronic
948344792 2:237286671-237286693 AAGCACCAGATGAGGGTCCATGG - Intergenic
1168893058 20:1306881-1306903 CAGCACAAGAAGAGGAGGCAGGG + Exonic
1169909477 20:10635901-10635923 ATGCACCAGAAGTGGAGCCTGGG - Intronic
1170362597 20:15562918-15562940 ATGCACCATAAGATGATCCCAGG - Intronic
1170427006 20:16245176-16245198 CAGCACAAGAATAGGAACCAAGG + Intergenic
1173177048 20:40772411-40772433 CTGACCCAGCAGAGAATCCAGGG + Intergenic
1175875725 20:62228356-62228378 CTGCAGGGGAAGAGGACCCAAGG - Intergenic
1177403581 21:20637778-20637800 CTCCACCATAAGAGGATGTAAGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1181037396 22:20176493-20176515 CTCCTGCACAAGAGGATCCAGGG + Intergenic
1181235328 22:21445001-21445023 CTGAACCAGCAGAGGACCAAGGG + Exonic
1182464116 22:30503848-30503870 CTCCACCAGAAGACCATGCAGGG + Intronic
1184103701 22:42355249-42355271 GTTCAACAGAAGATGATCCAGGG + Intergenic
1184147414 22:42619604-42619626 CTGCTCCCGAAGGGGCTCCAGGG + Exonic
1184511332 22:44934996-44935018 CTGCTCCAGAAGAAGTTCCCAGG + Intronic
1184554093 22:45223718-45223740 CAGCACCAGATGAGCACCCAGGG + Intronic
1184554125 22:45223910-45223932 CAGCACCAGATGAGCACCCAGGG + Intronic
1184581444 22:45420585-45420607 CAGATGCAGAAGAGGATCCAGGG - Intronic
950965230 3:17141389-17141411 GTGGCCCAGGAGAGGATCCATGG + Intergenic
952217677 3:31294098-31294120 CTGCAAAAGAACAGGCTCCAGGG - Intergenic
953174026 3:40532880-40532902 CTGAAGCAGAACAGGATCCCTGG - Exonic
965384494 3:168029891-168029913 TTGCACCAGCAGAGGCTGCAGGG - Exonic
966927480 3:184654779-184654801 CTGTTCCAGAAGAGGATGCCAGG + Intronic
968590157 4:1454467-1454489 CTGCCCCAGAACAGGCTACAGGG - Intergenic
969830251 4:9790216-9790238 CTTCACCTGGAGAGGACCCATGG - Intronic
971855254 4:32034519-32034541 CTTCAGCAGAAAAGGATCAAGGG + Intergenic
972245622 4:37243746-37243768 CTCCACCTGAAGTTGATCCAGGG - Intergenic
974551436 4:63379971-63379993 CTGGACCAGCCCAGGATCCATGG + Intergenic
980168267 4:129254190-129254212 TGGTACCAGAAGAGGCTCCAGGG + Intergenic
981720181 4:147793719-147793741 CCTCAGCAGAGGAGGATCCATGG - Intronic
982086698 4:151842850-151842872 CTGCCCCAGAATATGATTCATGG - Intergenic
984766695 4:183405446-183405468 CTGGACCAGGAGACGGTCCAGGG - Intergenic
986301143 5:6479236-6479258 CTGAACAGGAAGAGAATCCAGGG - Intronic
986628913 5:9750087-9750109 ATGCACCAGCAGGAGATCCAAGG + Intergenic
986847506 5:11772797-11772819 CTGCATCAGAATATGATTCAAGG + Intronic
988586216 5:32509899-32509921 GTGGACCAGCAGTGGATCCATGG - Intergenic
990605361 5:57403978-57404000 CAGGAACAGGAGAGGATCCATGG + Intergenic
994766589 5:103925607-103925629 TTGCCCCAGAAGAAGATGCAGGG - Intergenic
1001080428 5:168663350-168663372 CTGCTCTTGAAGAGGATCCTGGG - Intronic
1003492482 6:6635768-6635790 ATCCACGAGAAGAGGAGCCAAGG - Intronic
1005901806 6:30222676-30222698 CTGCAACAGAGGGAGATCCAAGG + Intergenic
1009054893 6:58322771-58322793 CTGCATGAGAAGATGAACCAGGG + Intergenic
1009236258 6:61127801-61127823 CTGCATGAGAAGATGAACCAGGG - Intergenic
1009619814 6:66061147-66061169 CTTCAACAGAAGAGTGTCCAGGG - Intergenic
1011735727 6:90309077-90309099 CTGGGCCAGAAGAGGAGCCTGGG + Intergenic
1018165567 6:161090948-161090970 CTGCCCCAGAAGAGAACCCCTGG + Intronic
1024606573 7:51027083-51027105 CAGACCCAGAAGAGAATCCATGG + Intronic
1024693323 7:51826943-51826965 CTGCACCACAAGAGATGCCAGGG - Intergenic
1026585871 7:71655781-71655803 TTGCACCAGAAGGGGTGCCAGGG + Intronic
1026932219 7:74229663-74229685 CTGGAGCAGAGGAGGATTCAGGG - Exonic
1029294883 7:99532478-99532500 CTAGACAAGAAGAGAATCCATGG + Exonic
1029467900 7:100737405-100737427 CACAACAAGAAGAGGATCCAGGG + Intronic
1029974021 7:104815755-104815777 CAGATCCAGAAGAGAATCCAGGG - Intronic
1030853253 7:114517441-114517463 CTGCACTAGAAGAAAATACAAGG - Intronic
1035216224 7:157369448-157369470 GTGCCCCAGAAGAGAAGCCATGG - Intronic
1035958102 8:4105596-4105618 CTACAGCAGAAGAGGAAACAGGG + Intronic
1038011427 8:23479565-23479587 CTGCATCTGAAGAGGAGCCCAGG - Intergenic
1038249269 8:25887913-25887935 CTGGACCACAGGAGGAGCCATGG - Exonic
1038679578 8:29654243-29654265 CCTCACCAGGAGAGGATCAATGG - Intergenic
1040551095 8:48438279-48438301 CTGCAAGAGAAGAGGAACCTTGG - Intergenic
1042977860 8:74490719-74490741 CTGATCCAGAAGAAGATCCATGG + Intergenic
1047413056 8:124640042-124640064 CTGCAGCTGGGGAGGATCCAGGG - Intronic
1049886486 9:30355-30377 CTCCCCCAGAAGAGGAGGCAGGG - Intergenic
1052956487 9:34256502-34256524 CTGTCCCAGGAGAGGATCCTAGG - Exonic
1056080101 9:83083727-83083749 TTACACCAGAAGAAAATCCAGGG - Intergenic
1056620799 9:88212330-88212352 CTGGGCCAGAAAAAGATCCAAGG - Intergenic
1057266430 9:93620966-93620988 CAGCACCTAACGAGGATCCAGGG - Intronic
1060533617 9:124365000-124365022 CAGAACCAGAAGGAGATCCAAGG + Intronic
1062082229 9:134630169-134630191 CTGCACCCCCAGAGGCTCCAGGG + Intergenic
1185870924 X:3664170-3664192 CCGCACCAGCAGCGCATCCATGG + Intronic
1186399220 X:9241417-9241439 CTGCGTAAGAAGAGGATGCAAGG + Intergenic
1186476760 X:9863461-9863483 CTGCACCACACGAGGCACCATGG - Intronic
1189058626 X:37727881-37727903 CTGCACCAGAAGAGGATCCAGGG - Exonic
1189292792 X:39897668-39897690 CTTCACCAGCAAAGAATCCAGGG + Intergenic
1192639218 X:72846917-72846939 CTGCAGTAGAAGAGGGTCAAGGG - Exonic
1192642493 X:72873888-72873910 CTGCAGTAGAAGAGGGTCAAGGG + Exonic
1193173060 X:78358656-78358678 CTGGGCCAGAAGAGCATTCACGG - Intergenic
1194171399 X:90588093-90588115 CTGCACAAGAAGAGAAACTAAGG + Intergenic
1195097929 X:101524048-101524070 CTGCACCAGAGCTGGAGCCAGGG + Intronic
1195799148 X:108687540-108687562 GTGCAACAGAGGAGGTTCCAGGG - Exonic
1197823654 X:130566317-130566339 CTTCACCATAAGAGCATGCATGG + Intergenic
1198124499 X:133629189-133629211 CTTCATTAGAAGATGATCCATGG - Intronic
1200517630 Y:4165847-4165869 CTGCACAAGAAGAGAAACTAAGG + Intergenic
1200793158 Y:7317339-7317361 CCGCACCAGCAGCGCATCCACGG - Intergenic
1200865303 Y:8037210-8037232 CTGTACAAGAAGGAGATCCAGGG - Intergenic
1201350919 Y:13040332-13040354 CTCCACCAGAAGCAGATCCTGGG - Intergenic