ID: 1189066173

View in Genome Browser
Species Human (GRCh38)
Location X:37811599-37811621
Sequence CCACTGTGCTTGGCAGAGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 1, 2: 8, 3: 75, 4: 553}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189066173 Original CRISPR CCACTGTGCTTGGCAGAGAG CGG Exonic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900994332 1:6112335-6112357 CCCCCGTGCTTGGCAGAGAGAGG - Intronic
901014503 1:6220343-6220365 GCCCTGTGCTGGGCAGAGTGTGG + Exonic
901196704 1:7444315-7444337 CCACAGTGCTGGGTACAGAGTGG - Intronic
901471420 1:9459360-9459382 CCACTGTGCTTGGCCCAAAATGG - Intergenic
901558501 1:10050628-10050650 GCACAGGGCTTGGCACAGAGTGG + Intronic
901635599 1:10668788-10668810 GCCCTGTGCTTGGCACAGACAGG - Intronic
902042832 1:13505175-13505197 CCGCTGTGCTTAGCAGAGGAGGG + Intronic
902709846 1:18231136-18231158 CCACTGTGCTGAGCAGGCAGTGG - Intronic
902834293 1:19036726-19036748 ACACTGTAATTGGCTGAGAGAGG - Intergenic
902915494 1:19636610-19636632 CCACTGCGCCTGGCCAAGAGTGG - Intronic
903745589 1:25584591-25584613 CCACTGGGCTTGGTTGAGAGGGG + Intergenic
904346802 1:29878025-29878047 GCACTGTGCTTGGCACTGTGGGG + Intergenic
904395262 1:30216189-30216211 GCATTGTGCTTGGCATAGTGGGG - Intergenic
904448545 1:30596003-30596025 ACACTGTGCTTGGCACTGTGGGG - Intergenic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905736110 1:40327285-40327307 CCACCGTGCCTGGCCGAGATCGG + Intergenic
905815890 1:40950574-40950596 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
906143936 1:43549099-43549121 CCACTGTGTGTGTCAGGGAGGGG + Intronic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907508988 1:54944528-54944550 CCACTGTGCCTGGCCAAGATGGG - Intergenic
908244142 1:62214411-62214433 CCACTGTGCCCGGCAGAGCAAGG - Intergenic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910671976 1:89782864-89782886 GGACTGTGCCTGGCAAAGAGTGG - Intronic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
913479525 1:119274164-119274186 TCACTGTGATTGACAAAGAGGGG + Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
915412283 1:155711203-155711225 CTACTGTGCCCGGCCGAGAGAGG - Intronic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
916604827 1:166330834-166330856 CCACTGTGCTCCAGAGAGAGAGG - Intergenic
916767664 1:167877359-167877381 GCACTGTGCTTGGCATACATAGG - Intronic
917512325 1:175678736-175678758 CCAAAGGGCTTGGCAGAGACAGG + Intronic
918116930 1:181505903-181505925 CCACTGTACTTGGCACACAGTGG - Intronic
918781195 1:188702522-188702544 CCAGTGTGCTTGGCTGGGATTGG - Intergenic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
920047846 1:203145288-203145310 CCCCTGTGCTGGGCAGATTGGGG - Intronic
920057741 1:203205186-203205208 CCCCTGTGCTTGGCCAAGAAAGG + Intergenic
920363084 1:205432719-205432741 CCACTGTGCCTGGCTGAGGTGGG - Intronic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
920700665 1:208216026-208216048 CCACTGTGGTTCCCAGTGAGGGG - Intronic
921058565 1:211563449-211563471 CCACTCTGCTGGGGTGAGAGTGG + Intergenic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922764430 1:228149891-228149913 CCATTGTGCTTGGTGGTGAGAGG + Exonic
922979661 1:229814796-229814818 CCATTGTCCTTAGGAGAGAGAGG + Intergenic
923964555 1:239122852-239122874 GCACTTTGGTTGGCAGAGATGGG + Intergenic
924431685 1:244002737-244002759 CAAATGTACTTGTCAGAGAGTGG + Intergenic
924871972 1:248056935-248056957 CCACTGTGCCTGGCCTTGAGGGG + Intronic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063589893 10:7385710-7385732 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1065152201 10:22833330-22833352 CCACTGTGCCTGGCCTGGAGAGG + Intergenic
1065467928 10:26045136-26045158 CCACTTTGCTGGGCAGATGGTGG - Intronic
1066266636 10:33782537-33782559 CCACTGTGCCTTGCCAAGAGTGG - Intergenic
1067295539 10:44973333-44973355 CCAGTGTGCTGGGTAGAGGGAGG + Intronic
1067330205 10:45308764-45308786 CAGTTGTGCTTGGCAGAGAGAGG - Intronic
1067337739 10:45378560-45378582 CCAGTGTACTTGGCCCAGAGAGG + Intronic
1068552654 10:58423717-58423739 TCCCTGGGCTTGTCAGAGAGTGG - Intergenic
1068825038 10:61427377-61427399 GCACTGAGCTAGGCAGAGATTGG - Intronic
1069114111 10:64483300-64483322 CAAATGTCCTTGGCAGAAAGAGG - Intergenic
1069415992 10:68201477-68201499 CCACTGTGCCTGGTGGAGAAGGG - Intronic
1069729540 10:70601938-70601960 CCACAGAGCTTGGCAGGGAGTGG - Intronic
1070546933 10:77459731-77459753 CCACTGTGCTATGCCAAGAGCGG - Intronic
1071786118 10:88902195-88902217 GCACAGTGCTGGGCAGTGAGGGG - Intronic
1072230696 10:93411789-93411811 GCACGGAGCTTGGCAAAGAGAGG - Intronic
1072296453 10:94013388-94013410 TTATTGTGCTTGGCAGGGAGGGG - Intronic
1072415180 10:95241343-95241365 CCACTGTGCCTGGCAACAAGGGG + Intronic
1072623812 10:97098364-97098386 CCAAGCTGCTAGGCAGAGAGGGG + Intronic
1072798536 10:98375294-98375316 CACCTGGGCTTGGCAGACAGAGG + Intergenic
1072825880 10:98605778-98605800 CCTCTGTGCCTGGCAGTGGGTGG + Intronic
1073350673 10:102817573-102817595 ACACAGTGCTGGGCAGAAAGTGG - Intergenic
1073366540 10:102947463-102947485 CCACTGTGCTCAGCAGTCAGTGG - Intronic
1073388581 10:103151174-103151196 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074591699 10:114820257-114820279 CCACTGTGGGTGGCAGAGCTGGG + Intergenic
1074718271 10:116240753-116240775 ACACAGTGCTTGGCATAGAGTGG + Intronic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1075815222 10:125259872-125259894 GCACTGTGCTGGGCACAGAGAGG + Intergenic
1075838565 10:125477433-125477455 TCCATGTGCTTGGCAGGGAGGGG - Intergenic
1076579052 10:131494685-131494707 CCACTGTGTTTGGAGGAGTGAGG - Intergenic
1076731402 10:132440804-132440826 CCTGTGTGCTGGGGAGAGAGTGG - Intergenic
1077024294 11:432444-432466 CCACTGTGCAGAGCAGAGACTGG + Intronic
1077076677 11:705437-705459 CCACTGTGGTGGGCAGAGGTGGG + Intronic
1077430159 11:2512327-2512349 CCACTGGGATTGGCAGAAAAGGG + Intronic
1077704228 11:4468566-4468588 CCACAGTGTTTGGCACAGAAAGG - Intergenic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078455839 11:11474344-11474366 CGAGTGTGATTGGCTGAGAGTGG + Intronic
1078476900 11:11638180-11638202 ACACTGTGCTTGGAGCAGAGTGG + Intergenic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1080648570 11:34204781-34204803 CCCCTGCTCTTGACAGAGAGAGG + Intronic
1080858317 11:36131117-36131139 CCACTGTGCCCGGCCTAGAGTGG - Intronic
1081207786 11:40294490-40294512 CCAGTGTGCTTGACTGGGAGAGG - Intronic
1081263177 11:40986213-40986235 CCACTGTGATTGGTGGAGTGGGG + Intronic
1081569739 11:44282304-44282326 CCACTGTGATAGGCACATAGTGG - Intronic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1082030053 11:47597304-47597326 CCACTGCGCCTGGCTGAGATAGG + Intergenic
1082275696 11:50219084-50219106 CCACTGTGCCTGGCCCACAGAGG - Intergenic
1083019204 11:59489053-59489075 GCAGTGTGGTTGGCACAGAGTGG - Intergenic
1083052679 11:59791156-59791178 CCCCTGTGCCTCTCAGAGAGGGG - Intronic
1083937291 11:65876565-65876587 CCACTGTGGCTGGCACAGAGTGG - Intergenic
1083978082 11:66140494-66140516 TCACGGTGCATGGCTGAGAGAGG + Intronic
1083998280 11:66282880-66282902 CCACTCTACTTGGGAGGGAGTGG + Intronic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084078957 11:66805740-66805762 CCACTGTGCTCGGCCTGGAGGGG + Intronic
1084328645 11:68416599-68416621 CCCCTGTCCTTAGCAGAGGGAGG + Intronic
1084664557 11:70569443-70569465 CTGCTGTGCTGGGCAGAGGGTGG + Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085702955 11:78761524-78761546 CCACTGTGCCTGGCCCAGGGTGG + Intronic
1085839141 11:79990542-79990564 GCACAATGCTTGGCACAGAGTGG - Intergenic
1086094755 11:83039389-83039411 CCACTGCGCTTAGCTGAGAATGG - Intronic
1086927166 11:92652873-92652895 CCACTGTGCCTGTCTGAGAAGGG - Intronic
1089004998 11:115083881-115083903 ACACTGGGCTTGGCACAGTGGGG - Intergenic
1089365091 11:117916566-117916588 CCACTGTGCTGGGCTCATAGTGG + Intronic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089559811 11:119338145-119338167 CCACTGTGCTGGGCATAGCCTGG - Intergenic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1090598371 11:128343503-128343525 ACACGATGCTTGGCACAGAGTGG - Intergenic
1091181040 11:133605040-133605062 TCACTGTGCCTGGAAGAAAGAGG + Intergenic
1091344642 11:134844504-134844526 ACACTGTGGTGGGAAGAGAGAGG + Intergenic
1091758713 12:3073112-3073134 CCACTGCGCCTGGCCGAGAGTGG + Intergenic
1092351672 12:7761067-7761089 CCACTGTGCCCGGCTGAGAATGG - Intergenic
1093391534 12:18630027-18630049 ACACAGTGCTTGGTAGAGGGTGG - Intronic
1094547071 12:31414643-31414665 CCACTGTGCCCGGCCGAGATGGG - Intronic
1094674085 12:32601202-32601224 GCACTGTGCTAGGCACATAGTGG - Intronic
1095503301 12:42864787-42864809 CCACTGCGCCTGGCCCAGAGGGG + Intergenic
1095814441 12:46406219-46406241 CTAATGTGGTTGGCAGGGAGTGG + Intergenic
1096085260 12:48861406-48861428 CCTATATGGTTGGCAGAGAGTGG - Intronic
1096216121 12:49798349-49798371 GCACTGTGCTGGGCAGAGAGAGG - Exonic
1096227002 12:49872447-49872469 GCACTCTGCTTGGTAGACAGGGG + Intronic
1096806152 12:54142367-54142389 CCACTGTGCCTGGCCGAGCCTGG - Intergenic
1096869720 12:54585715-54585737 CCACTTTTCTGGGCATAGAGAGG - Intronic
1097026774 12:56062230-56062252 CCACTGTGCCCGGCAAGGAGGGG + Intergenic
1097064624 12:56311837-56311859 CCACTGTGCCTGGCCTAGTGTGG + Intronic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1097753754 12:63386568-63386590 CATCTCTGCTTGGGAGAGAGGGG - Intergenic
1098224008 12:68301964-68301986 CCACTGTGCCTGGCCAGGAGAGG + Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1101708705 12:107244765-107244787 GCTCTATGCTTGGCAGAGGGAGG + Intergenic
1101768169 12:107722735-107722757 CAACTGAGCTTTGAAGAGAGTGG + Intergenic
1101877893 12:108607570-108607592 CCACTGTGCCTGGCTAGGAGGGG - Intergenic
1102017628 12:109658173-109658195 CCACTGGGCAGAGCAGAGAGAGG + Intergenic
1102474658 12:113180826-113180848 CCACAGTGCTGGGCCCAGAGTGG + Intronic
1102636769 12:114331462-114331484 CCAGTGAGGTTGGCAGAGACTGG - Intergenic
1103243563 12:119435550-119435572 GCTCAGTGCTTGGCACAGAGTGG + Intronic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103518414 12:121522142-121522164 CCACTGTGCCTGGCACAAGGTGG - Intronic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1103926232 12:124424858-124424880 CCTCTGTGCTTGGCCAGGAGGGG - Intronic
1104271132 12:127283332-127283354 ACACTGTGGGGGGCAGAGAGGGG - Intergenic
1105251512 13:18702904-18702926 CATATGTGCTTGGCACAGAGTGG + Intergenic
1106269786 13:28141290-28141312 CCACTGTGCTGGCCAGAAAGAGG + Intronic
1107119174 13:36778754-36778776 CAACTGTGCTGTGCAGGGAGTGG - Intergenic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107373557 13:39777946-39777968 GCACTGGGCTTTGCACAGAGTGG - Intronic
1107435595 13:40378030-40378052 GCCTTGTGCTTGGCACAGAGGGG + Intergenic
1107837792 13:44425752-44425774 CAGCTGTGCTGGGCAGGGAGAGG + Intergenic
1107928986 13:45290857-45290879 CCCCTGTGCCTGGCACACAGTGG - Intergenic
1108401508 13:50049390-50049412 GCACTGTGCTGGGCACAGAATGG - Intergenic
1108464160 13:50697476-50697498 CCAGTGTGCATGCCAGAGTGGGG + Intronic
1109320767 13:60807100-60807122 CCACAGAGACTGGCAGAGAGAGG + Intergenic
1110154121 13:72293310-72293332 GAACTGTGCTTGGGACAGAGGGG + Intergenic
1112490164 13:99855580-99855602 ACAGTGTGTGTGGCAGAGAGAGG + Intronic
1113071608 13:106426868-106426890 TCACTGTAAGTGGCAGAGAGGGG - Intergenic
1113697792 13:112359485-112359507 CCACTCTGCTTGTCACACAGTGG + Intergenic
1113818358 13:113191967-113191989 CCACTGTGCTTGGCTCATCGAGG - Intronic
1113987792 13:114332347-114332369 GCACTGTGCTTGGCCGGGCGTGG + Intergenic
1114293910 14:21312350-21312372 CCCCTGTCCATGGCAGGGAGGGG - Intronic
1117272463 14:54158882-54158904 CCACAGTGACTGGCATAGAGAGG - Intergenic
1117475281 14:56088150-56088172 CCAGAGTTCTTGGCAGAAAGAGG + Intergenic
1117871257 14:60202928-60202950 ACAATGTGTTTGGCAGGGAGTGG - Intergenic
1118270284 14:64337084-64337106 GCAGTGTTCTTGGCACAGAGTGG + Intronic
1118785685 14:69043880-69043902 CCATTGTCCCTGGCAGAGAGTGG + Intergenic
1119634116 14:76260299-76260321 ACACAGTGCATGGCACAGAGTGG - Intergenic
1120027922 14:79606807-79606829 CCACTGTTCTAGGCACAGCGTGG + Intronic
1120068237 14:80070952-80070974 CCACTAAGCTATGCAGAGAGAGG + Intergenic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120832924 14:89014109-89014131 CCGATCTGCTTGCCAGAGAGGGG + Intergenic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1121644023 14:95505400-95505422 CCACCTGGCCTGGCAGAGAGTGG - Intergenic
1122062492 14:99145858-99145880 GCATTGTGCTAGGCAGAGGGGGG - Intergenic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122401899 14:101472325-101472347 CCACTGGGCTTGGCTCAGAATGG - Intergenic
1122801138 14:104230139-104230161 CCACTGAGCTTAGCAGACAGTGG - Intergenic
1122954000 14:105061476-105061498 CCACTGGGCTGGCCGGAGAGAGG - Intronic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1124026913 15:25975252-25975274 CCACTGTGCTGGGCTCAGGGGGG + Intergenic
1124196872 15:27639239-27639261 CCACTGAGCTTCCCAGGGAGGGG + Intergenic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1125449108 15:39789672-39789694 ACACTGTTCTTGGCAAAGACAGG - Intergenic
1125596982 15:40893672-40893694 GAACAGTGCTTGGCACAGAGTGG + Intergenic
1125719886 15:41840251-41840273 CCCCTGTGCTGGGCTGAGGGAGG + Intronic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1126344058 15:47674578-47674600 CCACTGTGCTTGGAAGGGTGAGG + Intronic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1126926727 15:53597168-53597190 CCAGTGTCCATGGCAGAGAATGG - Exonic
1127631326 15:60829935-60829957 GCACTGTGCTTGGCATACAGTGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1127911988 15:63424154-63424176 CCACTGTGCCTGGCCTAAAGTGG + Intergenic
1128802145 15:70503754-70503776 GCTCTGTGCTGGGCAGAGACTGG - Intergenic
1128983223 15:72201018-72201040 TCACTGTCATTGGCAGCGAGAGG - Intronic
1129221735 15:74135212-74135234 ACACTGTGCTTGGCGGGGAAGGG - Exonic
1129317188 15:74752124-74752146 ACACTGTGATTGGCAGGGAGCGG + Exonic
1129539989 15:76341357-76341379 CCACTTAGCCTGGCAGAGAGGGG + Intronic
1129679855 15:77652661-77652683 CCACTTAGCTGGGCAGAGATGGG - Intronic
1131036485 15:89225895-89225917 CCACTGTGCTGGGCACAGACAGG - Intergenic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131254111 15:90850425-90850447 CCACTGCGCCTGGCTGAGAAAGG + Intergenic
1131818631 15:96248550-96248572 GCACTGTGCTTGGCACACTGTGG - Intergenic
1131842801 15:96455301-96455323 TTCCTGTGCTTGGAAGAGAGAGG - Intergenic
1132146991 15:99435031-99435053 CCACTTTGCTTGGGAGAAGGGGG - Intergenic
1132637439 16:959000-959022 CCACTGTGGATGGCAGACGGTGG + Intronic
1132806747 16:1778504-1778526 TGACTGTGCTGGGCAGAGCGAGG - Exonic
1132907812 16:2292310-2292332 GCACTGTGCCTGGCCGAGGGGGG - Intronic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1133411110 16:5569684-5569706 CCACTCAGCTTGGTAGAGTGGGG + Intergenic
1133562017 16:6959222-6959244 CCCCTGAGCTTAGCAAAGAGAGG - Intronic
1133741638 16:8656232-8656254 CCACTGTTCCTGGCGCAGAGAGG + Intergenic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1134110035 16:11509541-11509563 CCTCTGTGCCAGGCACAGAGTGG - Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134396654 16:13871332-13871354 CCACTGTGCCCGGCCCAGAGTGG - Intergenic
1134444619 16:14321457-14321479 CCACTGCGCCTGGCCCAGAGTGG + Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134664959 16:16012138-16012160 GGACAGTTCTTGGCAGAGAGTGG - Intronic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1134860319 16:17554903-17554925 CCCGTGTGCCTGGCAGAGATTGG + Intergenic
1135415354 16:22264636-22264658 CCCTTCTGCTTGGCAGAGAAGGG + Intronic
1136246540 16:28979385-28979407 CCACTGTGGGAGGGAGAGAGGGG - Exonic
1136291406 16:29274503-29274525 CCACTGTGCCTGGCAGCTGGGGG - Intergenic
1137640328 16:50023433-50023455 CCACTGTGCCTGGCCTAAAGAGG + Intergenic
1137802389 16:51273269-51273291 CCCCTGAGCTTGGGAGACAGAGG - Intergenic
1138153745 16:54684032-54684054 CTACTGTGCTGGGCAGTGGGTGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139708801 16:68760896-68760918 CCTCTGTTGTTGGCTGAGAGGGG + Intronic
1139740493 16:69031298-69031320 TCACAGTGCTTGGCACATAGTGG + Intronic
1140099371 16:71901833-71901855 ACACTGTGCTAGGCAGTGTGTGG + Intronic
1140161987 16:72505898-72505920 CCACTGAGCTTTCCAGTGAGGGG - Intergenic
1140685258 16:77427453-77427475 TCACTGTGCTAGTCAGAGGGAGG + Intronic
1141110926 16:81270102-81270124 CCACAGTGCCAGGCTGAGAGAGG + Intronic
1141180802 16:81752348-81752370 CCACTCTGCCTGACAGGGAGGGG + Intronic
1141700753 16:85640985-85641007 CCACTGTGCTATGCGGAGAAGGG - Intronic
1142097280 16:88248422-88248444 CCACTGTGCCTGGCAGTTGGGGG - Intergenic
1142104656 16:88295733-88295755 TCACTGTGCTTAGCAGTGCGAGG + Intergenic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1143202277 17:5121359-5121381 CCACTCTGCCTTCCAGAGAGAGG + Exonic
1143393412 17:6573922-6573944 CCACTGTGCCTGGCGAAGAGCGG + Intergenic
1143742365 17:8964101-8964123 CCACTGTGCCTGGCCCAGTGTGG - Intronic
1143743250 17:8969665-8969687 CCACTGTGCCTGGCTGACATTGG + Intergenic
1143900807 17:10173479-10173501 CCACCGCGCCTGGCCGAGAGAGG - Intronic
1143919252 17:10317952-10317974 CCACTGTGCCTGGCCGATTGGGG - Intronic
1144342774 17:14323987-14324009 CCGCTGAGCTTTTCAGAGAGAGG + Intronic
1144503273 17:15807797-15807819 CCACTGCGCTCGGCCAAGAGTGG + Intergenic
1144859349 17:18290638-18290660 CCACGGTGCTGGGCTGAAAGTGG + Exonic
1144879298 17:18422934-18422956 CCACTCTGCCTTCCAGAGAGAGG + Intergenic
1145152939 17:20521453-20521475 CCACTCTGCCTTCCAGAGAGAGG - Intergenic
1145165453 17:20610504-20610526 CCACTGCGCTCGGCCAAGAGTGG + Intergenic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1147456791 17:40542872-40542894 ACCCTGTGCTTGGCAGGGATGGG + Intergenic
1148047545 17:44753386-44753408 TCTCTGTGCTGGGTAGAGAGAGG + Intergenic
1148121000 17:45211171-45211193 CCACTGTGCCTGGCCTAGAATGG + Intergenic
1148886197 17:50774733-50774755 CCACTGTGCCTGGCAAAGTTAGG - Intergenic
1148963741 17:51416733-51416755 CCACTGTGCCTGGCGGTGAAAGG + Intergenic
1149399375 17:56279076-56279098 GCACTGTGCATGGCACAGAGAGG - Intronic
1150378455 17:64701630-64701652 CCACTGCGCCTGGCCTAGAGTGG - Intergenic
1151966690 17:77435177-77435199 CCTCTGAGCATGGCAGAGGGAGG + Intronic
1152258890 17:79255920-79255942 CCTCTGTGCTCGGCAGGCAGCGG - Intronic
1152748040 17:82050210-82050232 TCACCGTACTGGGCAGAGAGGGG - Intronic
1153085226 18:1278492-1278514 CCTCTGTGCTCTGCAAAGAGGGG - Intergenic
1153647781 18:7210776-7210798 CCACTGTGCCAGGCTGAGATGGG - Intergenic
1154123529 18:11670570-11670592 CCAGTGAGCTCGGCAGGGAGAGG - Intergenic
1154201182 18:12301871-12301893 CCACTGGGCTTTGGTGAGAGGGG - Intergenic
1155820439 18:30368955-30368977 CCACTGTGACTGGAAGATAGAGG - Intergenic
1157163939 18:45340728-45340750 ACACTGTGTTTGTCAGAAAGGGG + Intronic
1157213069 18:45760289-45760311 GCCCTGTGATTGGCAGTGAGGGG - Intergenic
1157287162 18:46384727-46384749 CCACTGTGCTTGGCCATGATGGG - Intronic
1157320743 18:46631970-46631992 CTCCTGTGCCTGGCAGACAGTGG - Intronic
1157386409 18:47262566-47262588 CCAGTGTGTCTGGCAGAGCGGGG - Intergenic
1157544447 18:48538373-48538395 AAACTGAGCTTGGCACAGAGAGG - Intergenic
1157802857 18:50635121-50635143 CTATGGTGCTTGGCACAGAGTGG + Intronic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1158132170 18:54164171-54164193 CCACTGTGTCTGGCAGAAAGAGG + Intronic
1158861646 18:61598330-61598352 TCCCTGTGCTTGGCAGAGAAAGG - Intergenic
1160688986 19:452051-452073 CCTCTGTGCTTCCCGGAGAGTGG + Intronic
1160723542 19:607864-607886 CTCCAGTGCTTGGCAGAGGGTGG + Intronic
1161225608 19:3143831-3143853 CCACTGCGCCTGGCCAAGAGAGG - Intronic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161319021 19:3632560-3632582 CCGCAGTGCTTGGCAGGGCGAGG + Exonic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161445866 19:4318852-4318874 CCTCTGTGGTGGGCAGGGAGTGG - Exonic
1161756571 19:6138447-6138469 TCAATGTGCTAGGAAGAGAGAGG + Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162425205 19:10590965-10590987 CCACCTTGCTTGGCTGAGGGAGG + Intergenic
1162439202 19:10682351-10682373 CCACTGTGGCTGGCAGGCAGAGG + Intronic
1162466063 19:10841503-10841525 CCACTGTGCCCGGCCGCGAGAGG - Intronic
1162815142 19:13189559-13189581 CCACTGTGCCCAGCAGAGATGGG + Intergenic
1162888786 19:13716863-13716885 CCACTGCACTCGGCAGATAGGGG - Intergenic
1163507677 19:17717958-17717980 CCACCGTGCCCGGCAGAGATGGG - Intergenic
1163984359 19:20931060-20931082 CCACTGCGCCTGGCAGAGATGGG + Intronic
1164978496 19:32593895-32593917 CCACTGTGCCTGGCAAAGCTAGG - Intergenic
1165359419 19:35326785-35326807 ACACTGTGTGTGGCAGAGAGAGG + Intronic
1165861827 19:38913070-38913092 CCACTATGCTTGGCTGAGAGTGG + Intergenic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166658329 19:44628330-44628352 CCTCAGTGCCTGGCACAGAGCGG - Intronic
1166752745 19:45172477-45172499 CCCCTGGGCCTGGCACAGAGTGG - Intronic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1167044547 19:47042018-47042040 CCACTGTGCCTGGCCTAGAAGGG - Intronic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1168144413 19:54412425-54412447 CCACTGGGCCTGGCCGAGACAGG + Intergenic
1168309705 19:55454342-55454364 CCACAGTGGCTGGCACAGAGTGG + Intronic
1168330748 19:55566533-55566555 CCACCTTGCTTGGCCCAGAGGGG + Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG + Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926161196 2:10490808-10490830 CCACTGAGCCCGGCTGAGAGAGG + Intergenic
926289124 2:11514868-11514890 GTGCTGTGCTTGGCACAGAGTGG + Intergenic
926579464 2:14618817-14618839 CCACCGTGCTCTGCAGACAGTGG - Intergenic
926975920 2:18516700-18516722 TCACTGAGCTAGGCAGAGAAAGG + Intergenic
927179637 2:20435603-20435625 CCACCGTGACTGGCCGAGAGAGG + Intergenic
927718488 2:25367930-25367952 CCCCTGCACTTGGCAGGGAGCGG + Intergenic
928385003 2:30859657-30859679 CCACTCTGCTTTGAAGAGATAGG - Intergenic
928496683 2:31840025-31840047 CCACTGTGCTTGGCCTTGACAGG - Intergenic
928543229 2:32303352-32303374 GCACTGTACTAGGCAGAGACAGG - Intronic
929533259 2:42765137-42765159 CCACTGTGCCTGGGACACAGAGG - Intergenic
929592729 2:43157706-43157728 GAACTGGGCTAGGCAGAGAGGGG + Intergenic
931396174 2:61889852-61889874 GCACTGTGCTTAGCAGATAACGG - Intronic
932219550 2:69989409-69989431 GGACAGTGCTTGGCACAGAGGGG + Intergenic
932715757 2:74100045-74100067 CGACTGGGCTGGGCACAGAGTGG + Intronic
932782822 2:74572892-74572914 CAACAGTGCTTGGCATACAGTGG + Intronic
932951902 2:76303291-76303313 ACAGTGTGCTTACCAGAGAGAGG + Intergenic
933897869 2:86827106-86827128 CCACTGTGCCTGGCTGACTGTGG + Intronic
936908998 2:117571468-117571490 CCACTGTGCTTGGGGGACCGAGG + Intergenic
937082155 2:119147835-119147857 CCACGGTGCTGGGCACACAGTGG + Intergenic
937206456 2:120239827-120239849 CCACTGAGCTTGGCAGTCATTGG + Intergenic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937885944 2:126900005-126900027 CCACTGACCTGGGCAGAAAGTGG - Exonic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
939021202 2:136960424-136960446 CCACTGTGCTTGGCCTGGAATGG + Intronic
940836618 2:158529007-158529029 GCACTGTGTGTGGCAGAGACAGG - Intronic
941279768 2:163535405-163535427 GAACAGTGCTTGGCACAGAGTGG + Intergenic
942713640 2:178866299-178866321 CCACTGTGCTGAGCTGAGATTGG - Intronic
942885929 2:180924136-180924158 TCAGTGTGCTTGCCAGAGAATGG + Intergenic
943248174 2:185483238-185483260 CCACTGAGCCTGGCAGGGACTGG - Intergenic
945618238 2:212100572-212100594 GCACTGTTCTTGGCACAGAGTGG - Intronic
945831056 2:214785427-214785449 CCACTGTGCTGGGCTGAGCTGGG - Intronic
946135421 2:217642736-217642758 CCACTGAGCTGCCCAGAGAGTGG + Intronic
946166387 2:217866701-217866723 CCACTGGGGCTGGCAGAGGGAGG + Intronic
946776015 2:223142032-223142054 GCACTGTGCAAGGCACAGAGGGG + Intronic
946929936 2:224661440-224661462 CCACCGTGCTTGGCCGTGAAAGG + Intergenic
947226617 2:227846569-227846591 CCACTGTGCCTGGCCCAGTGTGG + Intergenic
947491061 2:230594523-230594545 TCTCTGTGCTTGGCAGAGTCAGG - Intergenic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
948264158 2:236625306-236625328 CCACTGCACTTGGCACAGGGTGG - Intergenic
948623467 2:239251303-239251325 CCACTGTGCCTGGCTGGGAATGG - Intronic
948798411 2:240418919-240418941 ACAATGTGCTTTGCAGAGTGTGG + Intergenic
948912542 2:241011701-241011723 CCCCAGTGCTGGGGAGAGAGGGG + Intronic
1169105521 20:2991064-2991086 CCACTGTGCCTGGCAGGATGTGG - Intronic
1169783747 20:9336296-9336318 CCACTGTGCTTAGGAATGAGAGG - Intronic
1169859945 20:10140873-10140895 CCACTGTACTTGGCAGACAGAGG - Intergenic
1169977571 20:11347425-11347447 CCACTGTGATTATCAGGGAGCGG - Intergenic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1170517656 20:17148662-17148684 CCACTGTGGTTAGCAGAAAAAGG - Intergenic
1170542604 20:17404344-17404366 ACACTGCCCTTGGCAGAGAGTGG - Intronic
1172008441 20:31832776-31832798 CCACTGTGCCTGGCTGAGGTGGG + Intronic
1172142162 20:32730590-32730612 CCACTGTGTATGGCATAGTGGGG + Intronic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173342331 20:42163553-42163575 CCATAGTCCTTGGCACAGAGTGG - Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1174514838 20:51083704-51083726 CCAGTGTGGCTGGCAGAGAGTGG + Intergenic
1174767476 20:53267537-53267559 TCACAGTCCATGGCAGAGAGAGG + Intronic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1175839237 20:62016176-62016198 CGAGTGTGCTTGGGTGAGAGTGG - Intronic
1176024823 20:62980415-62980437 CCACCGAGCTGGGCAGCGAGGGG - Intergenic
1176040871 20:63065170-63065192 CCACAGGGCTCAGCAGAGAGAGG + Intergenic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1176837038 21:13802791-13802813 CATATGTGCTTGGCACAGAGTGG + Intergenic
1177047144 21:16184556-16184578 TCGCTCTGCTTGGCAGAGACTGG + Intergenic
1177187565 21:17814787-17814809 CCAGTGTTCTAGGCAGAGACTGG - Intronic
1178907057 21:36645329-36645351 CCACTGTGGCTGGCCGAGACTGG - Intergenic
1179637026 21:42719345-42719367 CCACTGTACTTGGCCTAGAATGG - Intronic
1179877281 21:44275491-44275513 CCTTTGTTCCTGGCAGAGAGGGG + Intergenic
1180059156 21:45375719-45375741 CCCCAGTGATTGGCAGAGATGGG - Intergenic
1180251801 21:46595086-46595108 TGACTGTGCAAGGCAGAGAGTGG - Intergenic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180650956 22:17376500-17376522 GCAGTGCGCTTGGCAGAGTGCGG + Intronic
1180712595 22:17849620-17849642 CCACTGTGCCTGGCCCAGAATGG + Intronic
1180935091 22:19620210-19620232 CCACTGCACCTGGCTGAGAGAGG + Intergenic
1181179445 22:21056555-21056577 GCACTGAACTTGGAAGAGAGGGG - Intronic
1181531263 22:23518850-23518872 CCACCGTGCTGGGCAGTGACAGG + Intergenic
1181620020 22:24084709-24084731 CCATTGTGCCTCGCACAGAGAGG + Exonic
1182007962 22:26977232-26977254 TCACAGTGCCTGGCACAGAGTGG + Intergenic
1182017283 22:27051370-27051392 CCTCAGTGCTTTGCAGGGAGAGG + Intergenic
1182377993 22:29862415-29862437 GCACTGTGCCTGGCAGACATAGG + Intergenic
1182776443 22:32834710-32834732 GCCCTGTGCTTTGCAGGGAGAGG + Intronic
1183319726 22:37157542-37157564 CCACTGTGCCTGGGACTGAGGGG + Intronic
1183734680 22:39637210-39637232 GCTCTGGGCTTGGCAGAGTGGGG + Intronic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1184336892 22:43859106-43859128 TCACTGTGCCTGGGAGAGACAGG - Intronic
1184343928 22:43901477-43901499 CCACTGCGCCTGGCTGAGAGAGG + Intergenic
1184728267 22:46358449-46358471 CCATTGTGCCTGCTAGAGAGGGG - Intergenic
1184819047 22:46894897-46894919 CCACTGTGCTAACCAGACAGTGG + Intronic
1184840584 22:47050290-47050312 CCACCGCGCCTGGCCGAGAGGGG + Intronic
1184850348 22:47116123-47116145 ACCCTGGGCTTGGCTGAGAGGGG + Intronic
1184956489 22:47890362-47890384 CCAGTGGGCTTGGCAGCGATTGG - Intergenic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
949779329 3:7668355-7668377 CCACTGTGGGTGGCAAATAGAGG - Intronic
949973733 3:9434955-9434977 CCACTGCGCCTGGCCAAGAGGGG - Intronic
951593540 3:24292640-24292662 GCACTGTGCCTGGCAAATAGTGG + Intronic
951902433 3:27670080-27670102 CCACTGTGCCCGGCCGAAAGTGG - Intergenic
952549297 3:34457436-34457458 CCACAGTGGTTGGCAGGTAGTGG + Intergenic
953481496 3:43256120-43256142 TCACAGTGCCTGGCACAGAGGGG - Intergenic
953859013 3:46526471-46526493 CCACTGTGCTTGGCTGTGTGTGG - Intronic
954237090 3:49265204-49265226 CCACTGTGCCCGGCCCAGAGTGG - Intergenic
954541196 3:51393801-51393823 CCAGTGGGCTTGGCACTGAGGGG + Exonic
954702961 3:52461353-52461375 CCACTGAGCTTGGCAGGGACAGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955672058 3:61412370-61412392 CCACTGTGACTGGCACAGAATGG - Intergenic
955826694 3:62954793-62954815 CCACTGTGATTGGCTGAGACTGG + Intergenic
956487260 3:69736068-69736090 ACAATGTGCCTGGCACAGAGTGG + Intergenic
956742477 3:72286198-72286220 CCACTGTGCTTGCCAGATGATGG + Intergenic
957483012 3:80822798-80822820 GCACTGTGCTTTGCACAGAGTGG + Intergenic
958258094 3:91348145-91348167 ACTCTGTGGTTGGTAGAGAGGGG + Intergenic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
959904393 3:111694373-111694395 TCACTGTGCTTAGAGGAGAGTGG + Intronic
960087296 3:113605036-113605058 CCACTGTGACTGACAGAGAGAGG + Intronic
960764689 3:121112367-121112389 CCACCTTGCTTGGCTGGGAGTGG + Intronic
962383502 3:134914947-134914969 TCCCTGTCCTGGGCAGAGAGAGG - Intronic
962403086 3:135078215-135078237 CCACTGTGCCTGGCAGGGGGAGG + Intronic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
963145066 3:141985239-141985261 CCACTGTGCTTGGCCAAAATAGG - Intronic
965115425 3:164482001-164482023 CCACTGTGCCTGGCTGACTGAGG + Intergenic
965545575 3:169912858-169912880 CCTCCGTCCTTGGCAGAGATGGG + Intronic
966026807 3:175293989-175294011 GCACTGTGCTTGGCACTGTGTGG - Intronic
966177697 3:177157057-177157079 ACACTGTGCCTGGCCCAGAGAGG - Intronic
966183034 3:177204114-177204136 CCACTGGCCTGGGCAGTGAGAGG - Intergenic
966542912 3:181111689-181111711 CCACTGTGCCTGGCTGATGGTGG - Intergenic
967391484 3:188960383-188960405 CCACTGTGTTTGGCATTGTGAGG + Intronic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
967877151 3:194275341-194275363 CCACTGTGCGGGGCAGAGGTGGG + Intergenic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968628451 4:1638302-1638324 ACCCTGTGCTAGGCAGACAGGGG + Intronic
968955828 4:3718667-3718689 CCTCTGTGGCTGGGAGAGAGTGG - Intergenic
970422149 4:15915298-15915320 AAACAGTGCTTGGCAGAAAGTGG + Intergenic
971029279 4:22619601-22619623 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
971143252 4:23947814-23947836 CCAATGTGGGAGGCAGAGAGTGG + Intergenic
971397637 4:26243805-26243827 CCACTGTGCCTGGCCAAGGGAGG - Intronic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
971704708 4:30025512-30025534 CCACTGCACCTGGCTGAGAGTGG - Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973314936 4:48749843-48749865 CCACTGTGCCTGGCCCAGGGAGG - Intronic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974453810 4:62100399-62100421 CCACTGTGCCTGGCCTAGAGTGG + Intergenic
975127321 4:70797555-70797577 CCACCGTGCCTGGCCTAGAGTGG - Intronic
976583018 4:86762266-86762288 CCACTGCGCTTGGCCTAAAGTGG + Intronic
977751518 4:100614860-100614882 CCACTGTGCCTGGCCGAGGGTGG + Intronic
977970480 4:103207692-103207714 CTACTGTGCTAGGAAGAAAGAGG - Intergenic
978032495 4:103952465-103952487 CTACTGTGCCTGTCAGAAAGTGG - Intergenic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
980634467 4:135481864-135481886 CGACTGAGCTGGGCAGAAAGTGG + Intergenic
981538796 4:145827035-145827057 CCACAGTGGTTGGCAGGGCGTGG - Intronic
981753086 4:148112092-148112114 GCACAGTGCTTGGCATAGATAGG - Intronic
981826912 4:148953641-148953663 TGACTGTGCTTGGCAGAGAAGGG - Intergenic
982122073 4:152152278-152152300 CCACTGTGTTTGGAAGAGGCAGG + Intergenic
982545059 4:156724044-156724066 CAGCTGTGCCTGGGAGAGAGGGG - Intergenic
982858926 4:160423531-160423553 CCATTGTGGTTGGAAGACAGTGG - Intergenic
985377482 4:189356149-189356171 CCACTGTGCTTGGGAGTGAGGGG + Intergenic
986212462 5:5686927-5686949 TCACTGTTCTTGGCAATGAGAGG + Intergenic
987005082 5:13702595-13702617 CCTCTGTCCTTGGCAATGAGAGG + Intronic
987324435 5:16799779-16799801 CCACTGTGCCCGGCTGAGAAAGG + Intronic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989654486 5:43731536-43731558 CCACTGTACCTGGCACTGAGTGG + Intergenic
990319131 5:54612548-54612570 CCACCGTGCCTGGCTGAGGGTGG + Intergenic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
992471204 5:77056513-77056535 CCACTGTGCCCGGCCAAGAGTGG + Intronic
993360431 5:86968260-86968282 TCCATGTGTTTGGCAGAGAGTGG - Intergenic
996284825 5:121777115-121777137 GAACTGTGCTTGGCAAATAGGGG + Intergenic
997594441 5:135096684-135096706 GTACTGTGCTTGACACAGAGCGG + Intronic
998443670 5:142182180-142182202 CCACTGTGCCTGGCCGGGACTGG - Intergenic
999152114 5:149433116-149433138 CCATTGTGACTGACAGAGAGGGG - Intergenic
1000283344 5:159801946-159801968 GCACTGTGTTTGGCATACAGTGG - Intergenic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1001722692 5:173869562-173869584 CCAGTGTGCATGGCTGAGAATGG - Intergenic
1001905186 5:175466329-175466351 CCCAAGTGCATGGCAGAGAGAGG - Intergenic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002885505 6:1290199-1290221 TTACAGTGCTTGGCAAAGAGTGG - Intergenic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003445984 6:6184806-6184828 GCACTGTCCTTTGCGGAGAGAGG + Intronic
1005669259 6:28088358-28088380 CTGCAGTGGTTGGCAGAGAGAGG - Intronic
1005685940 6:28252940-28252962 CCACTGTGCTTGACTGTGATTGG - Intergenic
1005955092 6:30658116-30658138 CCACTGTGCTTGGCGAAGTTTGG - Intronic
1006722037 6:36161721-36161743 CCACTGTGCCTGGCCTGGAGAGG - Intergenic
1007259864 6:40555852-40555874 ACATTGTGCATGTCAGAGAGCGG - Intronic
1007379841 6:41481569-41481591 CCACTGTGCTGGGCCTAGAATGG - Intergenic
1007539644 6:42629302-42629324 CCACTGTGCCCGGCTGATAGTGG + Intronic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1008535665 6:52504561-52504583 CCAGGGCCCTTGGCAGAGAGTGG - Intronic
1009185678 6:60571900-60571922 ACTCTGTGGTTGGTAGAGAGGGG - Intergenic
1010240674 6:73612762-73612784 CCACTGTGCCTGGCCTAGAAAGG - Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010489333 6:76454571-76454593 CCACTTTGCTTGGCATTCAGTGG + Intergenic
1010887709 6:81263939-81263961 CAGCTGTGCTTGGGAGAGTGGGG + Intergenic
1010918913 6:81656344-81656366 CAACTATGCTGGGCAGAAAGTGG - Intronic
1010968092 6:82235306-82235328 CCACTGCGCCCGGCAGAGTGTGG - Intronic
1011867294 6:91845925-91845947 TCAAAGTGCTTGGCAGATAGTGG + Intergenic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1012985682 6:105874062-105874084 TCACTGTGCCAGGCAGTGAGTGG - Intergenic
1013239633 6:108231856-108231878 ACACTGTATTTGGCAGGGAGTGG - Intronic
1013318057 6:108960251-108960273 AGACTGTGCTTGGCAGAGACTGG - Intronic
1013702832 6:112794929-112794951 ACACTGTGGTTGGCATTGAGTGG + Intergenic
1013710884 6:112896943-112896965 CTACTGTACGTGGGAGAGAGAGG - Intergenic
1013885317 6:114958174-114958196 CCACTGTGCTTGGCCTAAATTGG - Intergenic
1015225929 6:130857411-130857433 TTAATGTGCTTGGCAGAGAAAGG - Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015633563 6:135254495-135254517 TCAGTATGCTTGGCACAGAGGGG + Intergenic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1017113671 6:150955785-150955807 CCACTGTGCTTGGCCTCTAGTGG + Intronic
1017419480 6:154258988-154259010 CCTATGTGCCTGGCAGATAGTGG + Intronic
1017669634 6:156757664-156757686 CCACTGTGCCTGGCCAAGGGAGG - Intergenic
1017823500 6:158065058-158065080 CCTCTGTGCTATCCAGAGAGCGG + Intronic
1017884552 6:158588229-158588251 CCACAGTGCTCCGCAGGGAGGGG - Intronic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1019745880 7:2700188-2700210 CCTGTGTGCTCGGCAGTGAGGGG + Intronic
1020225043 7:6272896-6272918 CCACTGGGTTTTGCAGAGTGTGG - Intergenic
1021488119 7:21189177-21189199 CCACTGATTTTGGCAGAGTGCGG - Intergenic
1023312232 7:38899651-38899673 CCACTGGGGTTGGAAGAGTGAGG + Intronic
1025641275 7:63372976-63372998 CCACTATGCATGGAAGACAGGGG - Intergenic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027261212 7:76465866-76465888 CCACTGCGCCCGGCAGGGAGGGG + Intronic
1027312596 7:76963974-76963996 CCACTGCGCCCGGCAGGGAGGGG + Intergenic
1028102674 7:86840099-86840121 GCACTGTGCTAGGCACAGAGGGG + Intronic
1028317287 7:89419354-89419376 CCTCTGTTCTTGCCAGAGACAGG + Intergenic
1028449412 7:90963999-90964021 CCACTGTGCCTGGCCGACAAAGG + Intronic
1029522702 7:101074100-101074122 CCACTGTGCCTGGCCTAGAATGG - Intergenic
1029525326 7:101090335-101090357 CCACTGCGCCTGGCAGAGCCTGG - Exonic
1029536815 7:101162251-101162273 CCCCAGGGCTTGACAGAGAGAGG - Intergenic
1030267095 7:107631793-107631815 CCACTGGACTCGGCAGAGGGAGG - Intergenic
1030830318 7:114211425-114211447 CCACTTTCCTTGGCTGAGGGTGG + Intronic
1030947090 7:115737064-115737086 CCACTGTGCTTGGCCTATAGTGG + Intergenic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1034270762 7:149802570-149802592 CTTCTGTGCATGGCAGAGAGGGG + Intergenic
1034603040 7:152281442-152281464 CCACTGTGCCTGGCGTAGATGGG - Intronic
1035862677 8:3046929-3046951 CCACTGCGCCTGGCCCAGAGCGG - Intronic
1036620674 8:10422989-10423011 ACACTGTGCTGGACAGAGGGAGG - Intronic
1036807504 8:11845626-11845648 TCACTGTTCTTGGCAGGAAGGGG + Intronic
1037087932 8:14876065-14876087 CCACTGAGCTGGGGAGACAGGGG - Intronic
1037286003 8:17301151-17301173 GCACTGTGCTGGGCAGTGTGAGG + Intronic
1037750882 8:21681586-21681608 GAACAGTGCCTGGCAGAGAGTGG - Intergenic
1037780326 8:21864054-21864076 CCACTGCGCCCGGCCGAGAGTGG - Intergenic
1038112610 8:24516017-24516039 CCACTGTGCCTGGCATGGTGTGG + Intronic
1038218401 8:25584448-25584470 GCACTGTGCTTGGAAGGGAAGGG + Intergenic
1038243905 8:25836191-25836213 TCAGTGTGCTTGGAAGTGAGTGG - Intergenic
1038294332 8:26277149-26277171 CCACAGTGCTAGGCTGACAGAGG + Intergenic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1038650682 8:29400427-29400449 CCACTGTGCCTGGCCGAGGTAGG - Intergenic
1038944018 8:32336895-32336917 CCACTGTGCCCGGCCTAGAGTGG + Intronic
1039358265 8:36845437-36845459 CCACTGTGTTTGGCAGTAAGAGG + Intronic
1040996380 8:53407137-53407159 GCACTGTGCATGGCATAGAAAGG + Intergenic
1041560772 8:59215528-59215550 CCTCTGAGCTTGGCAGAGTCAGG + Intergenic
1042044109 8:64628938-64628960 CCACTGTGCCCGGCAGCGATGGG - Intronic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042892734 8:73631066-73631088 CCACTGTGCCTGGCCTAGATTGG - Intronic
1043294125 8:78643182-78643204 CCACTGTGTCTGGCTGAGAATGG + Intergenic
1047173419 8:122517125-122517147 GCACTGTGCTTGGCATGCAGTGG - Intergenic
1047326217 8:123838378-123838400 ACATTGTGTTTGGGAGAGAGGGG + Intergenic
1047852535 8:128874109-128874131 GCACTGTGCTTGGCACATAACGG - Intergenic
1048561983 8:135549244-135549266 GCACTGTGCATGGCACACAGAGG - Intronic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049290123 8:141797409-141797431 GCTCTGTGGTTGGCAGAGAGAGG + Intergenic
1049436592 8:142588986-142589008 CCATTGTGCTGTGCACAGAGAGG - Intergenic
1051176203 9:14362864-14362886 CCAGTCTGCTTGACAGAGTGAGG + Intronic
1051785117 9:20733712-20733734 CCACTGTGCCTGGCCCAGTGAGG - Intronic
1051903980 9:22074148-22074170 CCACTGTGCTTGGCACCTAGAGG + Intergenic
1057063569 9:92026962-92026984 CCACCGTGCCTGGCCTAGAGAGG - Intergenic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057424629 9:94938265-94938287 CCACAGTGCTTGGCACTGAGAGG + Intronic
1057909111 9:99004466-99004488 GCACTGGGCTAGGAAGAGAGTGG + Intronic
1060480785 9:124015805-124015827 CCACTTTGCTAGGCAGGAAGTGG + Intronic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1061135111 9:128729358-128729380 CCACAGTGCTTTGGGGAGAGGGG - Intergenic
1061308102 9:129744134-129744156 CCACTGTGCTTGACTGAGTAGGG + Intronic
1061772658 9:132938004-132938026 ACACTCTGCTTGGCAGGGGGTGG - Intronic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062141330 9:134960749-134960771 CCACAGTGCTGGGCGGAGAAAGG - Intergenic
1062266585 9:135689354-135689376 CAAATGGGCTTGGTAGAGAGGGG - Intergenic
1062289717 9:135789089-135789111 CCACAGTGCCCGGCAGAGCGAGG - Intronic
1062459404 9:136656621-136656643 CCACTGTGCCTTGCGGAGACTGG + Intergenic
1185916105 X:4037151-4037173 CGACTGTGGTTGGCAGCTAGCGG + Intergenic
1186095601 X:6098267-6098289 CCAGTGTGGGTGGCAGAGCGAGG + Intronic
1186393715 X:9186491-9186513 CCACACTGCGTGGAAGAGAGGGG + Intergenic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1186882073 X:13876575-13876597 CCACTGTGCAGGGCAGATGGTGG + Intronic
1187494714 X:19785059-19785081 GCACTGTGCTTGGCACTGGGTGG - Intronic
1187830658 X:23378042-23378064 CGACTGTGCTTAGCACTGAGTGG - Intronic
1187952212 X:24482044-24482066 CTATTGTGTTTAGCAGAGAGTGG - Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1189852716 X:45193064-45193086 CCACTGTGCCTGGCAGGCATTGG + Intronic
1189990833 X:46592648-46592670 CCACTGTACCTGGCTGATAGAGG + Intronic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1190736655 X:53259912-53259934 GCACTGTGCCTGGCATACAGAGG - Intronic
1191776933 X:64824585-64824607 CCACTGTGCATGGCTGAAATTGG - Intergenic
1191970143 X:66804870-66804892 CAACTGTGCTTGTCAGGGGGTGG + Intergenic
1192219866 X:69190391-69190413 ACTCTGTGCTTGGTACAGAGGGG + Intergenic
1194668440 X:96701402-96701424 ATACTGTGCTTGGTAGGGAGAGG + Intronic
1194937792 X:99971659-99971681 CCACTCTGCTAGGCACTGAGAGG - Intergenic
1195220886 X:102745124-102745146 CCACTGTTCTGGGAGGAGAGGGG - Intronic
1196193047 X:112813983-112814005 CCACTGCGCCTGGCAAACAGAGG - Intronic
1197696463 X:129555187-129555209 CCACTGTGCTTGGCCACCAGAGG - Intronic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1197916707 X:131543519-131543541 CCACGGTGCCTGACATAGAGTGG - Intergenic
1198463550 X:136884900-136884922 CCACTGAGCCTGGCCGAGAGGGG + Intergenic
1198480360 X:137034595-137034617 ACACAGTACCTGGCAGAGAGAGG - Intergenic
1198619559 X:138491040-138491062 TAACTGTGTTTGCCAGAGAGAGG - Intergenic
1200224976 X:154412224-154412246 CCAGTGTGCTGGGCAGGGGGAGG + Intronic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic