ID: 1189075024

View in Genome Browser
Species Human (GRCh38)
Location X:37905862-37905884
Sequence CGCCGCCGCCTGGGGGCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189075019_1189075024 -7 Left 1189075019 X:37905846-37905868 CCTGGCGCGACTCTGGCGCCGCC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG 0: 1
1: 0
2: 0
3: 11
4: 154
1189075016_1189075024 12 Left 1189075016 X:37905827-37905849 CCTTGAGGGGCGGGCTGTGCCTG 0: 1
1: 0
2: 2
3: 24
4: 352
Right 1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189075024 Original CRISPR CGCCGCCGCCTGGGGGCATC CGG Intronic
902476835 1:16692890-16692912 CGCCGCCGTCTAGGGGCGACAGG + Intergenic
904035566 1:27556962-27556984 CCCCGCCCCCTGGGGCCATCAGG + Intronic
905905780 1:41617563-41617585 CGGCACCGCCTGGGGTGATCTGG + Intronic
908401187 1:63774237-63774259 CGCCTCCGCCTGGCCGCCTCTGG - Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
915333491 1:155127777-155127799 CGCGGCTGCCTGGGGGCTTGGGG - Exonic
1062898100 10:1120364-1120386 CGCCGCCTCCGAGGGGCACCCGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1070167886 10:73911822-73911844 TGCCCCAGCCTGCGGGCATCTGG + Exonic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1073207163 10:101775463-101775485 CCTCGCCGGCTGGGGGCATAGGG - Intronic
1073577804 10:104640464-104640486 CGCTGCCGCGTGGGGGCACCTGG - Intergenic
1074165725 10:110872214-110872236 CGCCCCGGACTGCGGGCATCCGG + Intronic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1078139854 11:8684013-8684035 CGCGGCCGCCGGGGTGCTTCCGG - Exonic
1079126237 11:17720328-17720350 CGCCGCGGCCCGGGGGCAGCGGG - Exonic
1083272872 11:61580882-61580904 CGCCGCCGCCGCTGGGCATGGGG + Intronic
1083572771 11:63768992-63769014 CACCGCCGCCTGCGGGGCTCCGG + Intergenic
1083741526 11:64713870-64713892 CGCCGCCGCCTGAGGGAAGCCGG - Exonic
1089499904 11:118925773-118925795 CGCCGCCGCCCGGAGCCAGCCGG - Intronic
1091498242 12:991071-991093 CGCGGCGGCCCGGGGGCCTCCGG - Intronic
1096842061 12:54385688-54385710 GGCCACTGCCTGGGGGCAGCAGG - Intronic
1103739841 12:123083764-123083786 GGCAGCAGCCTGGGGGCATTCGG + Intronic
1104761560 12:131300034-131300056 CGCCCCGTCCTGGGGGAATCAGG - Intergenic
1104818216 12:131660758-131660780 CGCCCCGTCCTGGGGGAATCAGG + Intergenic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1118293799 14:64550117-64550139 CGGCGCCGGTTGGGGGCAGCAGG - Intronic
1118647210 14:67851578-67851600 CTCCCCAGCCTGGGGGCAGCAGG + Intronic
1120169674 14:81236191-81236213 AGCAGCCGGCTGGGGGCACCGGG + Intergenic
1121342860 14:93115605-93115627 TGCCGCCGCCTGAGGGCGTGTGG - Intronic
1122183651 14:99972473-99972495 CGGCAACGCCTGGGGGCTTCAGG - Intronic
1122645110 14:103189090-103189112 CGGCGCCCCCTGGGGGCACCCGG - Intergenic
1122977354 14:105176309-105176331 GGCCGCAGGCTGGGGGCATGGGG + Intronic
1127953468 15:63833346-63833368 GGCCGGCGCCTGGGGACACCGGG + Intronic
1129626356 15:77204524-77204546 CGCCGCAGCCTGCAGGCACCAGG + Intronic
1129850238 15:78789622-78789644 CCTCGCAGCCTGGGGGCACCGGG - Intronic
1132552723 16:560079-560101 CGCGGCAGCCTGCGGGCAACGGG + Intergenic
1134044367 16:11090443-11090465 CTCCGCTGCCTGAGGACATCTGG - Intronic
1137261121 16:46830956-46830978 CGCCGCCGCCGGCGGGCCCCAGG + Intronic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1138525954 16:57607358-57607380 TGCAGTCGCCTGGGGCCATCGGG + Intergenic
1139570254 16:67807045-67807067 CCCCGCCGCGGGGGGGCCTCTGG + Intronic
1141555328 16:84833507-84833529 CGGCCCTGCCTGGGAGCATCAGG + Intronic
1141802193 16:86317639-86317661 CGCCTCTGCCTGGGAGGATCGGG + Intergenic
1142146920 16:88496581-88496603 AGCCCCCACCTGGGGGCTTCAGG + Intronic
1142157956 16:88541197-88541219 AGCGGCCTCCTGGGGGGATCTGG - Intergenic
1142286211 16:89172510-89172532 CGCAGCTGCCTGGGGTGATCAGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146369830 17:32258708-32258730 AGCCGCTGCCTGCGAGCATCAGG - Intergenic
1147377609 17:40032262-40032284 TGCCTAGGCCTGGGGGCATCAGG - Intronic
1147591801 17:41688773-41688795 CGGCGCCGCCTGGGCGCTTGGGG + Intergenic
1148333301 17:46824953-46824975 CACTGCCACATGGGGGCATCTGG + Intronic
1150019260 17:61594117-61594139 CAGCTCTGCCTGGGGGCATCAGG + Intergenic
1151555048 17:74842581-74842603 CTCCGGGGCCTGGGGGCCTCTGG - Exonic
1152255948 17:79239562-79239584 CGCCGTCTCCTGGGGGCAGTGGG - Intronic
1152267738 17:79306126-79306148 AGCCGCCGCCTGCAGGCCTCGGG - Intronic
1152648496 17:81481354-81481376 CGCCGCTCGCTGGGGGCCTCGGG + Intergenic
1152748395 17:82051597-82051619 GGCCGCAGGCTGGGGGCAGCGGG + Exonic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1160523056 18:79520004-79520026 CCCCGCTTCCTGGGGGCAGCCGG - Intronic
1160717863 19:584547-584569 CAGCGCCGCCTGGTGGCAGCCGG - Intergenic
1160877723 19:1304957-1304979 CGCCGCGGGCAGGGGGCAGCGGG + Intergenic
1161112119 19:2476418-2476440 TGCCGCCGCCTGAGGTCAGCCGG + Intronic
1161439874 19:4284847-4284869 CTCCGCAGGCTGGGGGCTTCTGG - Exonic
1162416992 19:10544157-10544179 CCCCGCGGCCTGCGGGCCTCGGG - Exonic
1162822466 19:13231371-13231393 CCCCACCCCCTGGGGGCACCTGG + Intronic
1163009962 19:14418943-14418965 CGCGGCGGCCTGGGGCCATTTGG - Intronic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1164992110 19:32692067-32692089 CGCCGCCGGCCGAGGGCTTCCGG + Exonic
1165300325 19:34964256-34964278 CGCCGCCGCCTGCAGCCCTCGGG + Intergenic
1165345960 19:35249000-35249022 CGCGGCCGTCTGGGCGCGTCTGG - Exonic
1202710850 1_KI270714v1_random:18714-18736 CGCCGCCGTCTAGGGGCGACAGG + Intergenic
926090237 2:10044346-10044368 CGTCGCGACCTGGGGGCTTCGGG + Intronic
926097986 2:10094942-10094964 TACCTCTGCCTGGGGGCATCAGG + Intergenic
932735303 2:74250281-74250303 TGCCGCCACCTGGTGGCAGCAGG - Intronic
933886079 2:86720287-86720309 CGCCGCCGACTGGGGGGAGGGGG - Exonic
938012700 2:127841562-127841584 GGCTGCTGCCTGGGGACATCGGG + Intergenic
938273311 2:129993773-129993795 CGGTGCCGCCTGGAGGCAGCCGG + Intergenic
938442909 2:131352328-131352350 CGGTGCCGCCTGGAGGCAGCCGG - Intronic
942046557 2:172102439-172102461 CGCCGCCGCTCGGGGGCTGCTGG + Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946376014 2:219309300-219309322 CGCGGCGGCCTGGGGGTCTCGGG - Exonic
948046632 2:234951056-234951078 CGCCACTGCCTGGGGCCCTCGGG - Intergenic
948116146 2:235495154-235495176 AGCAGACGCCTGGGGGCAGCCGG + Intronic
948824185 2:240566516-240566538 TCCCGCCGCCAGGGGGCGTCAGG + Intronic
1171427479 20:25057874-25057896 GGCCGCCTTCTGGGGGCCTCTGG - Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173790408 20:45824398-45824420 TGCCGCTGCCTGCGGGCAGCAGG + Exonic
1175429098 20:58890239-58890261 GGCGGCGGCCTCGGGGCATCGGG - Intronic
1175947699 20:62566425-62566447 CGCCGCCTCCTGGGAGCCTCCGG + Intronic
1176135406 20:63520221-63520243 CACCGCCCCCTGCGGGCAGCAGG + Intergenic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1176414676 21:6467690-6467712 CGCCGCAGCCTGGGACCCTCCGG + Intergenic
1177779525 21:25607592-25607614 CGCCTCCACCGGGGGGCGTCAGG + Intergenic
1179690176 21:43076012-43076034 CGCCGCAGCCTGGGACCCTCCGG + Intronic
1179807271 21:43847647-43847669 CGTCCCTGCCTGGGGCCATCTGG - Intergenic
1179820365 21:43933747-43933769 CGCCGGGGCCTCTGGGCATCTGG - Intronic
1180067340 21:45418971-45418993 CGCCTCAGTCTGGGGGCATCAGG + Intronic
1180155149 21:45974010-45974032 CGCCGCTGTCTGGGGGCCGCAGG + Intergenic
1183684163 22:39351804-39351826 GGCCTCTGCCTGGGGGCACCTGG - Intronic
1184878388 22:47289707-47289729 CCCGACAGCCTGGGGGCATCGGG - Intergenic
1185383111 22:50519206-50519228 CGCCCCCACCCAGGGGCATCGGG - Exonic
954632793 3:52056289-52056311 CGGCGGCGGCTGGGGGCACCCGG - Exonic
955001123 3:54928839-54928861 AGCCGCCCCCTGTGAGCATCAGG + Intronic
956678308 3:71754804-71754826 CGCCCGCGCTTGTGGGCATCCGG + Exonic
961511970 3:127408809-127408831 CTCCGCCCCCTATGGGCATCAGG + Intergenic
962515043 3:136142354-136142376 CCCCGCCGCCAGGGGACATTTGG - Intronic
964304996 3:155330080-155330102 CACTGCAGCCTGGTGGCATCTGG + Intergenic
968230373 3:197002168-197002190 CGCCCCCACCTGCGGGCGTCGGG - Exonic
968286703 3:197513163-197513185 AGGCCCAGCCTGGGGGCATCAGG + Intronic
968650542 4:1758624-1758646 CGCCACTACCTGGTGGCATCTGG + Intergenic
969651942 4:8473265-8473287 CGCCGCCCCTTGGCGGCCTCAGG - Intronic
974716016 4:65669688-65669710 CGCCGCCGCTTGGGGGCCGCCGG + Exonic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
984973506 4:185210201-185210223 CGCCGCCGCCTGGAGCCGGCTGG + Intronic
989983406 5:50667881-50667903 CGCCCCCGACTGGGTGCAGCGGG - Intronic
991054372 5:62306074-62306096 CGGGGCCGCCTGGAGGCAGCGGG + Intergenic
991371575 5:65925600-65925622 CGTCGGCGGCTGGGGGCAGCGGG - Intergenic
992889667 5:81192519-81192541 CGGCGCCACCTTGGGGCAACAGG - Intronic
995106310 5:108381226-108381248 GGCCGCCGCCTGGGAGCAGCAGG - Exonic
995650112 5:114361180-114361202 CGCCCCCGCCAGGGGGGACCCGG + Intronic
996379117 5:122845769-122845791 CGCCGCCGCCTTGGCGCAGGGGG + Intronic
997349873 5:133222976-133222998 CACAGCCGCCTTGGGGCATAGGG - Intronic
999322650 5:150624850-150624872 CGCCGCCGCCTCGGCACACCTGG - Intronic
1001374569 5:171244001-171244023 CTCTGCCTCCTGGGTGCATCTGG - Intronic
1001496026 5:172188227-172188249 CGCCGCCGCCTGCGCGGTTCCGG - Exonic
1002046456 5:176543998-176544020 CCCCGCCTCCTGGGCGCATTAGG + Intronic
1006083527 6:31580993-31581015 CCCCGCCGCCAGGGGGCGCCCGG + Exonic
1006519748 6:34564459-34564481 TGCCCCAGCCTGGGGGCAGCAGG - Intergenic
1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG + Intergenic
1008030490 6:46688527-46688549 CGCCGCAGCCTGCCGGCACCAGG - Exonic
1015773466 6:136791993-136792015 CGCCGCCGCCGGGCAGCTTCTGG - Exonic
1017337809 6:153282637-153282659 CGCGGCCGCCGGGGTGCTTCCGG + Intergenic
1017719710 6:157236088-157236110 CGGCTCCGCCTGGGGGCTACCGG + Intergenic
1018191737 6:161315020-161315042 CGCCGCCTTGTGGGGGCCTCAGG - Intergenic
1018238411 6:161748975-161748997 ACCCGCCGCCAGGGGGCAGCTGG + Intronic
1019354496 7:571670-571692 CCCCACAGCCTGGGGGCAGCTGG - Intronic
1019633240 7:2061410-2061432 CACCGACTCCTGGGGGCACCTGG - Intronic
1021998521 7:26202230-26202252 CGCCGCAGCCTCGGGACAGCCGG - Intronic
1023418336 7:39951560-39951582 CGCCGCCGCCTGTAGGCCTTAGG - Exonic
1029374826 7:100171338-100171360 CGCCGCCGTGTCGGGACATCGGG + Exonic
1032174485 7:129612106-129612128 CTCCGCCGCCTGGGGCTCTCGGG + Intronic
1032791610 7:135246751-135246773 CGCCCTCGCCTGGGGACACCAGG + Intronic
1033199973 7:139360131-139360153 CGCCGCCGCCTCGAGGCGTGCGG - Exonic
1034227798 7:149497117-149497139 CGCAGCGGCCTGGTGGCACCTGG - Intronic
1034491611 7:151396003-151396025 GGCCGCGGCCGGGGGGCTTCTGG - Exonic
1034781758 7:153887844-153887866 CGCCGCCGCGCGCGGGCATGGGG - Intronic
1035160774 7:156948947-156948969 CTCGGCCGCCTGGGGGCCACAGG + Intergenic
1035171105 7:157017968-157017990 TCCCGGCGCCTGGGTGCATCTGG + Intergenic
1035676976 8:1462807-1462829 CGCCGCCGTGTGGGGGCCTGAGG - Intergenic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1044719757 8:95134008-95134030 CGCCGCCGCCCGCGGCCGTCGGG + Exonic
1048072875 8:131040255-131040277 CGTCGCCGGCCGGGGGCGTCGGG + Exonic
1048941651 8:139405372-139405394 AGCAGCCGCCTGGAGGCAACTGG - Intergenic
1049705520 8:144040367-144040389 AGCCGCAGCCTTGGGGCCTCTGG - Exonic
1050345285 9:4679872-4679894 CGCCGCCGCCTGGCAGCTGCGGG - Exonic
1057322976 9:94031078-94031100 CGGCGCCGGCTGGGGTCAGCAGG - Intronic
1059412220 9:114139560-114139582 CACCACCGCCTGGGGGCAGGCGG + Intergenic
1062488840 9:136794550-136794572 TGCAGCCGCCTGGGGCCATGAGG - Intronic
1062537793 9:137028426-137028448 CGCCGCCGCCGGGAAGCCTCCGG + Intronic
1062627002 9:137447938-137447960 CCCTGCCGCCTGAGGGCACCAGG - Exonic
1187403598 X:18983936-18983958 CGCTGCGGCCTGGGAGCCTCGGG - Exonic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic
1199445097 X:147912023-147912045 CGCCGCTGCCAGGGGGCGTGCGG + Intronic