ID: 1189077936

View in Genome Browser
Species Human (GRCh38)
Location X:37937618-37937640
Sequence GTTGTGTAGGCCATAATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189077936_1189077940 22 Left 1189077936 X:37937618-37937640 CCCAGAATTATGGCCTACACAAC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1189077940 X:37937663-37937685 CTTACAAACTGCTTAGTTTATGG 0: 1
1: 0
2: 2
3: 20
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189077936 Original CRISPR GTTGTGTAGGCCATAATTCT GGG (reversed) Intronic
900753869 1:4419696-4419718 GATGTCTATGCCCTAATTCTTGG + Intergenic
908200507 1:61790436-61790458 GTTCTGTAGGTCAGAATTCAGGG + Intronic
909700912 1:78521948-78521970 GTTCTGTAGGTCAGAAATCTGGG + Intronic
910661505 1:89678793-89678815 GTTGCTTAGGCCACAAATCTTGG - Intronic
911249540 1:95559325-95559347 TTTTTGTAGGTCATAAATCTGGG + Intergenic
912987356 1:114447369-114447391 GTTGCATAGGCCAAAAATCTTGG - Intronic
915641875 1:157233969-157233991 GTTGTGGAAGCCAAGATTCTTGG - Intergenic
916011325 1:160708631-160708653 GTTGCTCAGGCCAGAATTCTAGG - Intronic
916300354 1:163266998-163267020 ATTGTGCACTCCATAATTCTAGG + Intronic
916766747 1:167868269-167868291 GGTCTGTAGGCACTAATTCTCGG - Intronic
917116091 1:171605190-171605212 GGTCTGTAGGCACTAATTCTCGG - Intergenic
917527809 1:175804634-175804656 GTTGTGTAGGTCAGAAGTCTGGG - Intergenic
918141452 1:181723657-181723679 GTTTTGAAGGCTATAATTCGGGG + Intronic
918163016 1:181919027-181919049 CTTGTGTAGGCTATAAAACTGGG - Intergenic
920837535 1:209525640-209525662 GTTGTCTAAGGCAAAATTCTTGG + Intergenic
1064634742 10:17353113-17353135 GTTCTGTAGGACAAAGTTCTTGG - Intronic
1064773495 10:18749747-18749769 GTTGTTCAGGCCAAAAATCTTGG + Intergenic
1065037328 10:21653140-21653162 GTTCTGTAGGCCAGAAGTCTGGG + Intronic
1065454679 10:25894675-25894697 GTTGTTTAGTGGATAATTCTTGG - Intergenic
1066394386 10:35004983-35005005 GTTGTGAAAGCCAAAAATCTAGG + Intergenic
1067897368 10:50198602-50198624 GTTGAGTAGGTCAGCATTCTAGG - Intronic
1068612387 10:59074580-59074602 GTTGCATAGGCCAAAATCCTTGG + Intergenic
1069319972 10:67157761-67157783 GCTCTGTAGGCACTAATTCTTGG - Intronic
1069576563 10:69534616-69534638 TCTGTGTATGCCAGAATTCTTGG + Intergenic
1072293580 10:93989133-93989155 GTCTTTTAGGCCATAAGTCTTGG - Intergenic
1079157922 11:17965689-17965711 TTTGTGTTGGGCATTATTCTAGG - Intronic
1081795839 11:45818817-45818839 GTTGTGTAAGGCAGAAGTCTGGG - Intergenic
1089038006 11:115416561-115416583 TTTGTGTAGGACAGAATACTAGG - Intronic
1089938976 11:122395559-122395581 ATTTTGGAAGCCATAATTCTGGG + Intergenic
1093273082 12:17090356-17090378 GTTCTGTAGGTCAGAATCCTAGG + Intergenic
1093985800 12:25531239-25531261 GTTCTCTAGGCCATAAATCTGGG - Intronic
1094356499 12:29583628-29583650 GTTTTGTAGGAGATAATTCTGGG - Intronic
1095236930 12:39807926-39807948 ATTTTGTATGCTATAATTCTTGG + Intronic
1096670642 12:53196493-53196515 GTTGTGTAGTGCACAGTTCTAGG - Intronic
1102340648 12:112119013-112119035 GTTGTGTAGAACAGCATTCTTGG + Intergenic
1107841435 13:44461383-44461405 GATGTGTAAGCAATAATTATAGG + Intronic
1107906569 13:45066759-45066781 GTTCTATAGGCCAGAAGTCTGGG + Intergenic
1109222987 13:59659362-59659384 GGTGTGTGGGATATAATTCTAGG + Intergenic
1111947740 13:94683169-94683191 GTTGCTCAGGCCAAAATTCTAGG - Intergenic
1113799959 13:113081108-113081130 GCTGGGCAGGCCATCATTCTAGG + Intronic
1114699701 14:24664517-24664539 GTTCTGTAGGCCAAAAGTCTGGG - Intergenic
1115054399 14:29105021-29105043 GTTGTGAAAGGCATAATTTTGGG + Intergenic
1117263774 14:54064458-54064480 GTTGCTTAGGCCAAAACTCTTGG - Intergenic
1120826414 14:88960147-88960169 GTTGTGGAGGCCAGAAGCCTGGG - Intergenic
1121946170 14:98124691-98124713 ATTCTGTAGGTCAGAATTCTAGG + Intergenic
1125577893 15:40767593-40767615 CTTGTGTAGGCCATGTTCCTCGG + Exonic
1126451456 15:48813207-48813229 GTAGAATAGGCAATAATTCTAGG + Intergenic
1126969676 15:54096361-54096383 GTTCTTGAGGCCATAGTTCTTGG - Intronic
1129281524 15:74488814-74488836 GTTCTGTAGGTCAGAAGTCTGGG - Intergenic
1135473529 16:22753337-22753359 GTTGTGTACTGCATAATTCCAGG - Intergenic
1135596384 16:23747100-23747122 GTTGTTTAGGACAAAAATCTTGG + Intergenic
1139838427 16:69859134-69859156 GTTCTGTAGGTCATAAGTCCAGG + Intronic
1140300683 16:73754465-73754487 CTGGTGTATGCCATGATTCTCGG - Intergenic
1140686627 16:77439933-77439955 GTACTGTGGGTCATAATTCTTGG - Intergenic
1145159015 17:20562048-20562070 GTGGTGTAGGCCTGTATTCTTGG + Intergenic
1152003370 17:77661572-77661594 GTTGTTTAGGATTTAATTCTTGG + Intergenic
1153357725 18:4156075-4156097 GTTGCTTAGGCCAGAAATCTTGG - Intronic
1155468710 18:26168454-26168476 GTTGGTTAGGCAATCATTCTAGG - Intronic
1155629093 18:27870833-27870855 GTATAGTAGGCCGTAATTCTAGG + Intergenic
1155685619 18:28545608-28545630 TTTCTGTGGGCCAAAATTCTGGG + Intergenic
1156202952 18:34855031-34855053 GTTGTGTAGGGCAAACTTCATGG + Intronic
1156579154 18:38355313-38355335 GTTATGTGGTCCATAACTCTTGG - Intergenic
1157056681 18:44237448-44237470 GTTCTGTAGGTCAGAAATCTGGG - Intergenic
1159105127 18:63995991-63996013 GTTGCGTAGGCCATCATGATGGG + Intronic
1159972047 18:74666729-74666751 GTTCTGTAGGTCAGAAGTCTCGG + Intronic
1162933769 19:13970321-13970343 GTTCTGTGGGACATAGTTCTTGG - Intronic
925264672 2:2558761-2558783 GTTCTGGAGGCCAGAAGTCTAGG + Intergenic
927099099 2:19774193-19774215 GTTGTGTACTGCACAATTCTAGG + Intergenic
930305774 2:49672921-49672943 GTTCTGCAGGTCAGAATTCTAGG + Intergenic
930431947 2:51289248-51289270 GTTCTGTAGGTCAGAAGTCTGGG + Intergenic
932481490 2:72042136-72042158 GTTGTGTGGGCCAGGATTCCTGG + Intergenic
932595828 2:73092950-73092972 CTCATGTAGGCCATACTTCTGGG - Intronic
932873668 2:75428921-75428943 GCTGTGTAGGCCATACTTAAGGG + Intergenic
932905043 2:75739961-75739983 GGTGTGTTGGCCTTAGTTCTAGG - Intergenic
933134696 2:78718568-78718590 GTTTTGGAGGCCAGAAGTCTAGG + Intergenic
933310996 2:80661130-80661152 CTTCTGTAGGCCATATTTGTTGG - Intergenic
936884330 2:117291969-117291991 GTTGTGTAGATCAAAATTATTGG + Intergenic
940077323 2:149757140-149757162 ATTGTGTAGGTCAGAAGTCTGGG - Intergenic
942060718 2:172226346-172226368 GTTCTGTAGGCCAGAAGTCCAGG - Intergenic
944944406 2:204666671-204666693 CTTGTGTGAGCCAAAATTCTAGG - Intronic
945410085 2:209497452-209497474 GTTGTGTAAGCCACATGTCTAGG + Intronic
946134791 2:217636805-217636827 GTTGTGTACCCCAAAACTCTAGG + Intronic
947078161 2:226366608-226366630 CTTGTGTAGGTCAGAATTCCAGG + Intergenic
948832318 2:240604081-240604103 GCTGTGTAGACCATAACCCTGGG + Intronic
949069717 2:242017033-242017055 GTTGTGTAGGCCTCAGTTCCCGG - Intergenic
1170212680 20:13860947-13860969 ATTGTTCAGGCCATAAGTCTAGG + Intronic
1170400842 20:15981493-15981515 GGTCTGTAGGCACTAATTCTCGG + Intronic
1170511847 20:17085697-17085719 GATGTGTATGGCATTATTCTTGG - Intergenic
1171416583 20:24985507-24985529 GTTTTGTAGGCCAGAAGTCCTGG - Intronic
1176906105 21:14503484-14503506 TTTCTGTAGGTCATAATTATGGG - Intronic
1177355010 21:19996768-19996790 GGTCTGTAGGCACTAATTCTCGG + Intergenic
1178940419 21:36900840-36900862 GATGTTTAGGCCAGAAATCTTGG - Intronic
1179312815 21:40211873-40211895 ATTGTGTAGACCCTAATTGTTGG + Intronic
1183387530 22:37523718-37523740 GTTATCTAGTCCATAAGTCTGGG + Intergenic
950991713 3:17446410-17446432 GTTGTGTAAGCCAGAAATTTAGG - Intronic
951253899 3:20427002-20427024 GGTGTGGTGGCCATATTTCTGGG + Intergenic
952023168 3:29047685-29047707 GTTCTGTTGGCTATACTTCTAGG + Intergenic
952641463 3:35601720-35601742 CTTGTGTAACCCATAAATCTGGG - Intergenic
952957016 3:38563679-38563701 GCTGTGCAGGCCACAATTCTTGG + Intronic
953201999 3:40786256-40786278 GTTCTGTAGGTCAAAATTCCTGG + Intergenic
953483896 3:43276233-43276255 TTTCTGTAGGCCAAAATTCCAGG + Intergenic
955813866 3:62821251-62821273 GTTCTGTAGGTCAAAAGTCTGGG + Intronic
957360267 3:79147315-79147337 GTTTTGTAGGCCATGCTTCTTGG - Intronic
957944540 3:87046129-87046151 GTTCTGTAGCCCAGAATCCTGGG - Intergenic
959571147 3:107885387-107885409 GTTCTGTAGGTCAGAAGTCTGGG - Intergenic
960525080 3:118700705-118700727 GTTCTGTAGGTCAGAAATCTAGG + Intergenic
964778826 3:160312168-160312190 GTTGTGTAGTGCACAACTCTGGG + Intronic
965191810 3:165540261-165540283 GTTGTGCAGGTCAGAATTTTGGG - Intergenic
965382134 3:168002996-168003018 TTTGTGTGGGCCAGAAGTCTAGG + Intergenic
965385477 3:168040360-168040382 GGTGTGTAGGCTGGAATTCTGGG + Intronic
967274841 3:187764278-187764300 ATTGTGTAGGGCATAGTTCTAGG + Intergenic
971696869 4:29916281-29916303 GTGGTACAGGCCATAATTCCTGG + Intergenic
977343403 4:95788889-95788911 GCTGTGAAGGCCATTATTATTGG - Intergenic
977995477 4:103494427-103494449 GTGGTTTAGGCCAAAATGCTAGG + Intergenic
979367310 4:119840810-119840832 GTTCTGTAGGTCAGAAATCTGGG - Intergenic
979843268 4:125473213-125473235 GTTGTGTTGGTGATAATTCAGGG - Intronic
981401343 4:144317133-144317155 GTTCTGTAGGACAAAATTATAGG + Intergenic
982356214 4:154472530-154472552 GTTGTGTATGCCAAAAGTTTAGG - Intronic
983334947 4:166379293-166379315 GTTGGACAGGCCAGAATTCTGGG + Intergenic
986013530 5:3738327-3738349 GTTGTGTAGGCCAAATCTCAGGG - Intergenic
986907605 5:12514239-12514261 ATGGTGTAGGCCAAAATTTTGGG + Intergenic
987274464 5:16347188-16347210 GTTCTGTAGGTCAGAAGTCTTGG - Intergenic
987641531 5:20617915-20617937 ATTCTGTAGGCCAAAAGTCTTGG + Intergenic
990506776 5:56453241-56453263 GTTCTGTAGGTCAGAAGTCTGGG + Intergenic
990907586 5:60820330-60820352 GTTCTGTAGGTCAGAATTCCAGG - Intronic
992834492 5:80626820-80626842 GTTGGTTAGGCAATCATTCTAGG - Exonic
992921284 5:81524401-81524423 GTTTTGTAGGTCAGAAGTCTGGG - Intronic
992989412 5:82268878-82268900 GGTCTGTAGGCACTAATTCTTGG + Intronic
993737455 5:91495160-91495182 GTTCTGTAGGTCAGAAATCTGGG + Intergenic
993759079 5:91769237-91769259 ATTGTTTATGACATAATTCTAGG + Intergenic
993823990 5:92658416-92658438 GTTATTTAGGCAATAAATCTTGG - Intergenic
995451796 5:112310081-112310103 GTTCTGTAGGCCACAAGTCCAGG - Intronic
996136255 5:119846046-119846068 GTAGTCTAGGCCAAAATTTTAGG + Intergenic
997011281 5:129881716-129881738 ATTGTGGATGCCATAAGTCTTGG + Intergenic
1003509000 6:6763670-6763692 GTTGTTGAGGCCAAAAATCTAGG - Intergenic
1005602139 6:27437573-27437595 GTTCTGTAGGTCAGAAGTCTGGG - Intergenic
1010303306 6:74286703-74286725 GTTGTGTAGGCCAGAAGTCTAGG + Intergenic
1010486302 6:76418482-76418504 GTTCTGTAGGCCAGAAGTCTAGG - Intergenic
1011025632 6:82866451-82866473 ATTTTGTGGGCCATATTTCTAGG - Intergenic
1014465866 6:121756055-121756077 GTTGGGTAGGCCTTCATTTTAGG + Intergenic
1014783210 6:125588148-125588170 ATGCTGTAGGCCATAATTCACGG - Intergenic
1015302964 6:131675280-131675302 GTTGTTTAAGCCAAAAATCTTGG + Intronic
1018232974 6:161693538-161693560 GTTGTGGAGGCCATAGCTCTGGG + Intronic
1019847499 7:3520923-3520945 GTTTTGTAGGTCATAAGTCTAGG + Intronic
1021534009 7:21682102-21682124 GAGGTGTTGGTCATAATTCTAGG + Intronic
1023222497 7:37933878-37933900 GTTGTTTACTCCAGAATTCTTGG + Intronic
1028003310 7:85529422-85529444 GTTCTGTAGGTCAGAAATCTGGG - Intergenic
1037321756 8:17650443-17650465 GTTGACTGGGCCATACTTCTAGG + Intronic
1039135713 8:34320863-34320885 GTTCTGTAGGTCAGAAGTCTGGG + Intergenic
1042455505 8:68997564-68997586 ATTATGTAGTTCATAATTCTTGG + Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1046225737 8:111277686-111277708 GTTTTATAGACAATAATTCTGGG - Intergenic
1046756953 8:117982096-117982118 GTTCTGTAGGTCACAAGTCTGGG + Intronic
1047522879 8:125609020-125609042 GTTCTGTATGCCAAAATTCTTGG + Intergenic
1047648256 8:126891721-126891743 CTTGTCTAGGCCAGAAGTCTGGG - Intergenic
1047804274 8:128343070-128343092 CTTGTATAGGGCATTATTCTAGG + Intergenic
1047909950 8:129517199-129517221 GTTGTCTAGGGTATAAATCTGGG - Intergenic
1050823666 9:9915171-9915193 GGTGTGTGGGCCTTCATTCTAGG - Intronic
1053086261 9:35225676-35225698 GTGGTGTAGGCTATAATTGTTGG + Intronic
1053324328 9:37129704-37129726 TTTCAGTATGCCATAATTCTGGG - Intronic
1054969458 9:71068495-71068517 GTTGTGTAGGACATCATGTTTGG - Intronic
1056050008 9:82758402-82758424 GCTCTGTAGGCCAGAAATCTGGG + Intergenic
1058268662 9:102941027-102941049 GTTGTTTAGGCCAAAATCTTAGG - Intergenic
1060116805 9:120948156-120948178 GTTGTTCAGGCCAAAAGTCTTGG + Intergenic
1061510884 9:131060205-131060227 CATGTGAAGGCCAGAATTCTGGG + Intronic
1187240005 X:17503749-17503771 GTTTTGTAGGCCATAACACCTGG + Intronic
1189077936 X:37937618-37937640 GTTGTGTAGGCCATAATTCTGGG - Intronic
1189395323 X:40617419-40617441 GTTTTGTAGGTCAGAATTCTGGG + Intergenic
1189760975 X:44321192-44321214 GTTGTTCAGGCCAAAATACTTGG - Intronic
1191025270 X:55907681-55907703 GTTGCTTAGGCCAAAAATCTTGG - Intergenic
1191718531 X:64209823-64209845 TGTGTGTAGTCCATCATTCTGGG - Intergenic
1192537366 X:71939538-71939560 GTTGTCTAGGCCAGAAACCTAGG - Intergenic
1193374137 X:80737876-80737898 GGTGTGTTGGCCATAATTTGTGG - Intronic
1196940891 X:120774769-120774791 GTTCTTTAGGCCAGAAGTCTGGG + Intergenic
1201373231 Y:13288103-13288125 GGTCTGTAGGCACTAATTCTTGG - Intronic