ID: 1189081471

View in Genome Browser
Species Human (GRCh38)
Location X:37977467-37977489
Sequence TCTGGAAATGAATGGTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189081471 Original CRISPR TCTGGAAATGAATGGTCAGG GGG Intronic
901385801 1:8908289-8908311 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
902391195 1:16107933-16107955 TCTGGAAAAGAAAGATCAGGAGG + Intergenic
903782394 1:25829410-25829432 CCAGGAAATGAATGTTCAGTAGG + Intronic
904268121 1:29329569-29329591 TCAGGCAATGAATGGCCAGCAGG + Intergenic
904415761 1:30360212-30360234 TGGGGAAGTGAGTGGTCAGGGGG - Intergenic
905251636 1:36652746-36652768 GGAGGAAATGAATGGTCAGCAGG + Intergenic
905845558 1:41228324-41228346 TCTGGAGATGGATGGTGATGAGG + Intronic
906705582 1:47892737-47892759 TATGTGAATGAATGGTGAGGAGG + Intronic
906717185 1:47979002-47979024 TTTGGAAATGGAGGATCAGGGGG + Intronic
906869062 1:49456377-49456399 TCTAGAAATGGATGGCCAGAGGG - Intronic
907860299 1:58346177-58346199 GCTGCAGATGAATGGGCAGGCGG + Intronic
910526518 1:88185100-88185122 TCTGCAACTGAATGGTAATGTGG - Intergenic
910528637 1:88210445-88210467 TCTGAATATGAATGGTTGGGTGG - Intergenic
911038298 1:93572391-93572413 CCAGGAAATGAATGGGGAGGAGG + Intronic
911136430 1:94445634-94445656 TCTGGAAAAGAAAGATCTGGAGG - Intronic
911269438 1:95782364-95782386 TCTGGAATTGATGGTTCAGGTGG + Intergenic
911593018 1:99769167-99769189 TCTGGAAGGGAATGATAAGGTGG - Intergenic
914862976 1:151401478-151401500 TCCTTAAATGAAAGGTCAGGTGG - Intronic
915008387 1:152662074-152662096 TCTGGAAATGAAAGGGGATGAGG - Intergenic
915179776 1:154048206-154048228 TCTGGAAAAGAAAGATCTGGAGG - Intronic
916412777 1:164562664-164562686 TATGGAAATGCATTGCCAGGGGG - Intronic
919969565 1:202565527-202565549 TCTGGAATTGCATGAGCAGGAGG + Intronic
920427731 1:205891555-205891577 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
920748780 1:208654368-208654390 TCTGGAAAGGAAGGTTCAGGAGG + Intergenic
921065786 1:211621144-211621166 TGAGGAAATAAATGGTCTGGAGG - Intergenic
923204155 1:231741859-231741881 CCTGGAAATGAAAGCGCAGGTGG - Intronic
924508801 1:244711476-244711498 TCTGGGGATGAATGGCCTGGGGG - Intergenic
924819470 1:247474593-247474615 TCTGGAATTTAATGGCCAGATGG + Intergenic
1063699933 10:8374540-8374562 TCTGGAAATGACTGGTCTTCAGG - Intergenic
1065445038 10:25789313-25789335 TGAGGCAATGAATGGTAAGGGGG + Intergenic
1066774547 10:38874672-38874694 ACTAGAATGGAATGGTCAGGAGG + Intergenic
1068166660 10:53340145-53340167 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1069056324 10:63848291-63848313 TCTGGAAAAGAAAGATCCGGAGG - Intergenic
1072913863 10:99525203-99525225 TTTGCACATGAATGCTCAGGAGG + Intergenic
1073226159 10:101921355-101921377 ACTGGAAAAGAAGGGTCATGAGG + Intronic
1075688380 10:124379374-124379396 TGTGGAACTGAATGGACTGGGGG - Intergenic
1077444617 11:2585190-2585212 CCTGGGAAGGAATGGACAGGAGG - Exonic
1077550308 11:3197282-3197304 GCTGGAAATGAAGGCCCAGGAGG + Intergenic
1077995137 11:7446497-7446519 TCTGGAGATCACTGGACAGGAGG - Intronic
1078707376 11:13758343-13758365 TTTGGACATGAATGATGAGGGGG - Intergenic
1079304338 11:19309038-19309060 TCTTGGAATGAAAGGGCAGGTGG - Intergenic
1079326074 11:19493750-19493772 GCTAGAAGGGAATGGTCAGGAGG - Intronic
1079365200 11:19802970-19802992 CCTGGAAAGGAATGGAAAGGAGG - Intronic
1079683726 11:23330370-23330392 CCTGGAAGTGAAAGGTCATGTGG + Intergenic
1081613612 11:44578003-44578025 TCTGGAAATTGAGGCTCAGGGGG - Intronic
1083639027 11:64135484-64135506 TCTGGCCCTGAAAGGTCAGGTGG - Intronic
1084088037 11:66863703-66863725 TGGGGAAGTGAACGGTCAGGGGG + Intronic
1084142249 11:67240356-67240378 ACGGGAAACGAAAGGTCAGGGGG + Intronic
1084346946 11:68559174-68559196 TCTTAAAATGCATGGGCAGGTGG + Intronic
1085023214 11:73221885-73221907 TTGGGAAATGAGTGGCCAGGCGG + Intronic
1085345797 11:75767586-75767608 TAGGGAAATGGCTGGTCAGGTGG - Intronic
1087808355 11:102581113-102581135 TCTGGAAAACATTGGTCATGAGG + Intronic
1088491956 11:110397074-110397096 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1092261944 12:6957632-6957654 TCTGGAAAGGGAGGGTCGGGTGG - Exonic
1093886934 12:24472439-24472461 TCTGGCAATGCATGCTAAGGTGG - Intergenic
1095577101 12:43752790-43752812 TCTGGAGATGAATGGTGGTGAGG + Intronic
1095912996 12:47447875-47447897 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1097766368 12:63531582-63531604 TCTGGAAATAAATGGGTAGTGGG + Intergenic
1097782803 12:63727420-63727442 TCTGGAAATAAATGGGTAGTGGG + Intergenic
1100414366 12:94356421-94356443 TCTGGAAAAGAAAGATCTGGGGG - Intronic
1101598347 12:106187628-106187650 TCTGGGAAAGAAAGGTCCGGAGG - Intergenic
1104762878 12:131307935-131307957 TCTGGAAATGAATAGGAATGTGG - Intergenic
1104817047 12:131653448-131653470 TCTGGAAATGAATAGGAATGTGG + Intergenic
1105352353 13:19627186-19627208 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1105668527 13:22587279-22587301 ACAGGAAATGAAGGGTCAGACGG + Intergenic
1107653157 13:42565137-42565159 TCTAGAAAAGAATGTTCATGTGG + Intronic
1111495794 13:89048087-89048109 TTTGAAAATGAATGATTAGGAGG + Intergenic
1111958671 13:94785180-94785202 TCTGGAAATTCAGGGTCAAGAGG + Intergenic
1113032228 13:106006874-106006896 TCTGTAAATGAATGGGAAGTTGG - Intergenic
1113415928 13:110128509-110128531 TCTTTAAATGAAAGGTCAAGAGG - Intergenic
1114522028 14:23345780-23345802 TCTGGAAATTAATCTTCAGTGGG + Intergenic
1116238688 14:42313311-42313333 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1116463603 14:45207181-45207203 TATGGAAATGGATGTTCAGCTGG - Intronic
1117073156 14:52074356-52074378 TCTAGAAATGAGTGGTCAGTAGG - Intergenic
1122423280 14:101590654-101590676 TCTGGAAGTGGATGCTGAGGTGG - Intergenic
1122652795 14:103234860-103234882 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1124954827 15:34353485-34353507 TAAGAAAATGAATGGCCAGGTGG - Intronic
1125059318 15:35400063-35400085 TCTGGAAAAGATTCTTCAGGAGG + Intronic
1126057930 15:44749348-44749370 ACTGGAAGTGACTGGTCATGGGG - Intronic
1126969952 15:54099528-54099550 TGTGAACATGAATGGTGAGGAGG - Intronic
1128673879 15:69594907-69594929 CTTGGAAATGAATGGGAAGGAGG + Intergenic
1130639532 15:85658515-85658537 ACTGAAAATGAATGGTGAAGAGG - Intronic
1132145160 15:99425217-99425239 TTTGGGAAGGAAAGGTCAGGCGG - Intergenic
1132783937 16:1644007-1644029 TCTGGAAAAGACTGGGCAGGTGG + Intronic
1133210857 16:4262739-4262761 TCTGGAGATGAATGATGAAGAGG - Intronic
1134827594 16:17296980-17297002 AGTGGAAATGAATGGAGAGGAGG + Intronic
1138077391 16:54056326-54056348 GCTGGGAATAAATGGTCAGTGGG - Intronic
1144043849 17:11437255-11437277 TCTGAAAGTGAATGGTCCTGGGG - Intronic
1144351232 17:14398898-14398920 TCTGGAGATGCATGGTGGGGTGG - Intergenic
1144379164 17:14675926-14675948 TCTGGATAAGAAGGGTAAGGGGG + Intergenic
1145068490 17:19781859-19781881 TCTGGAAATGAATGACAAGGGGG + Intronic
1146657546 17:34643916-34643938 TCTGGCATTGACTGGTCATGTGG + Intergenic
1146786505 17:35726261-35726283 TCTGGAAAGAAATGGGGAGGGGG + Intronic
1152119169 17:78407465-78407487 TCAGGAAATGAATGGTCCACTGG - Intronic
1152167201 17:78717368-78717390 CCTGGAAAGGAATGGTGATGGGG - Intronic
1152250590 17:79210629-79210651 TATGGAATTGAAGGGTCGGGTGG + Intronic
1153266991 18:3280838-3280860 TCTACAAATGAAATGTCAGGGGG + Intergenic
1153434006 18:5049156-5049178 TGTGGAAATGAAGGGCTAGGGGG - Intergenic
1154361135 18:13662057-13662079 TCTGGACTTGAATGGTCTGGGGG - Intergenic
1155873102 18:31051594-31051616 TCTGGACATGAATGGGTATGTGG - Intergenic
1164025070 19:21344418-21344440 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1164032238 19:21418152-21418174 TCTGGAAAAGAAAGATCTGGAGG + Intronic
1165568797 19:36757287-36757309 TCTAGAAATGAATGTGCAGATGG + Intronic
1165593368 19:36989954-36989976 AGTGGAAATGAATGGTTAAGTGG + Intronic
1165593548 19:36991542-36991564 AGTGGAAATGAATGGTTAAGTGG + Intronic
1165866212 19:38940952-38940974 TCTGGAAAAGAAAGATCTGGAGG + Intronic
926703865 2:15822742-15822764 TGAGGAAATGAATGGTCACATGG + Intergenic
926714551 2:15913938-15913960 TATGGAAAGGAATGGACAGGAGG - Intergenic
927117943 2:19923606-19923628 TCTGGAAAAGAAAGATCTGGAGG - Intronic
928386098 2:30869434-30869456 TCTGGAAATGAATAGTGGTGAGG - Intergenic
930048054 2:47191475-47191497 GCTGGAAATGAATGGAGAGGTGG + Intergenic
930183206 2:48385383-48385405 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
930279953 2:49358246-49358268 CAAGGAAATGAATGGTCAGCGGG + Intergenic
931072780 2:58672966-58672988 TCTGGAAATGTATGATCAGAGGG - Intergenic
932706203 2:74026845-74026867 TCTGGAAATGCATGGGCAGGGGG - Intronic
935026010 2:99277715-99277737 TCTGGAAAAGAAAGATCTGGAGG + Intronic
936799678 2:116252213-116252235 TCTGGAAAAGAAAGATCTGGCGG - Intergenic
936876760 2:117199608-117199630 TCAGGCAATGAATGGTGAGCTGG + Intergenic
937577281 2:123438877-123438899 TCTGGAAATGAATGGGCCTCTGG + Intergenic
938799020 2:134743040-134743062 TCTGGAGATGGATGGTAATGAGG + Intergenic
940310980 2:152278882-152278904 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
942710595 2:178830743-178830765 TCTGGACTTGATGGGTCAGGAGG + Exonic
943961033 2:194264288-194264310 TCTTGAAATGAATGAGGAGGAGG + Intergenic
945391398 2:209269607-209269629 ACTTGGGATGAATGGTCAGGTGG + Intergenic
947426253 2:229985573-229985595 TCTGCAAGTGGATGGTGAGGTGG + Intronic
948974590 2:241456725-241456747 CCTGGAAATGAACGGGGAGGGGG - Exonic
1168863863 20:1067293-1067315 TCTGGAAAGGAATGAACAGCAGG - Intergenic
1169559060 20:6779783-6779805 TCTGTAAATTAAGGGGCAGGAGG - Exonic
1169723837 20:8707639-8707661 TCTGGGAATGAATTCTCAGAAGG - Intronic
1171059169 20:21939607-21939629 TCTGGGATTGAATGGCCAAGGGG - Intergenic
1172040183 20:32038998-32039020 TCTAGGAATGAATGTGCAGGTGG - Intergenic
1173066910 20:39721879-39721901 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1174028676 20:47602635-47602657 TCTGGAAATGAAAAGACAGTAGG - Intronic
1174511075 20:51053040-51053062 TCTGGATATGGATGGTGAGATGG - Intergenic
1175160101 20:57002078-57002100 TCAAGAAATGAATGCTCATGGGG + Intergenic
1176225616 20:63997055-63997077 TCTGGAGATGAATGGTGATGAGG - Intronic
1176984378 21:15419524-15419546 GCTGGAAATAACAGGTCAGGTGG + Intergenic
1177776746 21:25576386-25576408 TTTTGTAATGACTGGTCAGGAGG - Intergenic
1180142303 21:45899994-45900016 TTTGGAAAGGAATTGTCTGGGGG - Intronic
1180882210 22:19213397-19213419 TCTGGAAAACAATAGTGAGGCGG + Intronic
1181583520 22:23840844-23840866 TCTGGAGATGGATGGTGGGGAGG + Intergenic
1183741546 22:39671148-39671170 TCTGGAAGGGAACGGTCAGAGGG + Intronic
1183842803 22:40514410-40514432 TCTTAAAATGAATGGTGGGGAGG + Intronic
950501356 3:13365895-13365917 TCTGGGAAGGAGTGGGCAGGGGG + Intronic
951830586 3:26922030-26922052 TGTGGAAATGAATGATGTGGAGG + Intergenic
952086675 3:29830790-29830812 ACTGGAAATGAATGCACAAGGGG - Intronic
953805915 3:46067162-46067184 TATGGAAATGGATGATTAGGAGG + Intergenic
954645913 3:52131483-52131505 TCTGGAAAGTCTTGGTCAGGGGG - Intronic
956289771 3:67649143-67649165 TCAGGCAATGAATGATCAGAGGG + Intronic
959182904 3:103004829-103004851 TTTGGAAATGTATGGTTATGAGG + Intergenic
959644721 3:108685084-108685106 TTTTGAAATACATGGTCAGGTGG + Intronic
960045723 3:113195827-113195849 TCTGGAAGTGAATGGGAATGAGG + Intergenic
961859331 3:129902103-129902125 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
962912403 3:139864968-139864990 TCTGGAGATGAGTAGGCAGGAGG - Intergenic
963257884 3:143163950-143163972 TCTGGAAGTGAATGGTGCTGGGG + Intergenic
964044491 3:152306700-152306722 AATGGAAATGGATGTTCAGGAGG + Intronic
964268893 3:154933460-154933482 TTTGAAAATGAATGGCCATGGGG + Intergenic
965315292 3:167183046-167183068 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
965526324 3:169722988-169723010 GCTGCAAGTGAATGATCAGGTGG - Intergenic
966968404 3:185018914-185018936 TCTGGAAAAGAAAGATCTGGAGG + Intronic
967991084 3:195131247-195131269 TTTGGAAATGAATGGGGAGACGG - Intronic
969157682 4:5225858-5225880 TCTGAAAATGAGTGCTTAGGAGG + Intronic
969895677 4:10302376-10302398 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
970359317 4:15292509-15292531 TCTGGAAACAAATGCACAGGGGG - Intergenic
972834651 4:42855184-42855206 TCTGGAAAGGAAGGGTGAGATGG + Intergenic
973008449 4:45042921-45042943 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
974862400 4:67538504-67538526 TCTGGAAATGGGTGATCAGAGGG - Intronic
975124002 4:70761354-70761376 CATGTAAAAGAATGGTCAGGAGG + Intronic
976228944 4:82820489-82820511 TTTAGAAAAGAATGGTGAGGTGG + Intronic
978152465 4:105453305-105453327 TCTGGAGATGGATGGTGATGAGG + Intronic
978332244 4:107626272-107626294 TGGGTAAATGAATGGGCAGGTGG - Intronic
979893599 4:126131607-126131629 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
980396391 4:132221648-132221670 TCTGGAAATGCATGGTTATGGGG - Intergenic
980968702 4:139548842-139548864 CCAGGAAATTAATGGTCAGAAGG + Intronic
982282046 4:153693543-153693565 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
984061051 4:174989499-174989521 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
984779627 4:183513544-183513566 GCTGGAAATGAATGGAAGGGGGG + Intergenic
984956487 4:185050828-185050850 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
985117177 4:186603841-186603863 TCTGGAGAAGAATACTCAGGTGG - Exonic
985500727 5:243004-243026 TCTGGAAAAGAAAGATCTGGAGG - Intronic
985736132 5:1584514-1584536 TCTGGAAATGAAAGATCTGGAGG + Intergenic
986192999 5:5514277-5514299 TCTGGAAATGGATGGAGAGTGGG + Intergenic
986309168 5:6538985-6539007 GCTGGAAATGAAAGGACATGAGG - Intergenic
988056949 5:26109537-26109559 TTTGGAAATAAAAGGTCACGAGG + Intergenic
988811140 5:34786369-34786391 TCTGGAAAAGAAAGATCTGGAGG + Intronic
989004179 5:36791413-36791435 TTTGGAAATGAAATGTGAGGTGG - Intergenic
989758716 5:44987100-44987122 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
992100950 5:73407107-73407129 TCTGGATATGATTGGATAGGAGG - Intergenic
992585271 5:78232442-78232464 TCTGTAGATGCATGGTCATGTGG - Intronic
992654570 5:78895782-78895804 TCCGGAAATGGATAGTCAGCAGG + Intronic
992737320 5:79735462-79735484 TCTGATAATGAATGATCAGCTGG - Exonic
993303427 5:86243183-86243205 TCTGTAAATGAATGCTGATGAGG + Intergenic
993405851 5:87511189-87511211 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
995356160 5:111239833-111239855 TCTGGAAATGCGTTGGCAGGAGG + Intronic
998205246 5:140152905-140152927 TCCGGAAGTGAGTGGTCAGGTGG + Intergenic
1000065181 5:157688077-157688099 TATGGAAAAAAATGCTCAGGAGG + Intergenic
1000380289 5:160622766-160622788 TCTGGTAATGGATGGACATGTGG - Intronic
1002067592 5:176659889-176659911 CATGTAAATGAATGGGCAGGTGG - Intergenic
1003128040 6:3371757-3371779 GCAGGAAATAAATGTTCAGGAGG - Intronic
1003346581 6:5274284-5274306 CCTGGAAATGAATTGTAATGCGG + Intronic
1004482760 6:16036912-16036934 TCTGGGCATGAATGTTCAGGTGG - Intergenic
1008093534 6:47315894-47315916 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1008901277 6:56619743-56619765 GCTGGAAAGGAAGGATCAGGCGG - Intronic
1009955521 6:70448176-70448198 TCTGGAAAGGAAAGATCTGGAGG + Intronic
1013475145 6:110500037-110500059 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1015184663 6:130401041-130401063 TCTGGAAATAAATGGGGAGTGGG + Intronic
1015215040 6:130740384-130740406 TCTGGAGATGAATGGTGGTGAGG - Intergenic
1015387592 6:132642336-132642358 TTTGGAAATGAACAGACAGGTGG + Intergenic
1015540504 6:134308970-134308992 TCGGGAAATGACTGGTCATGTGG - Intronic
1020460869 7:8428331-8428353 TCTGAAAAGGAATGGTTAGTGGG + Intergenic
1022451052 7:30515474-30515496 TCTAGAAATCAAATGTCAGGAGG + Intronic
1023676552 7:42636076-42636098 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1023804672 7:43864115-43864137 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1023967466 7:44970409-44970431 TCAGGACATCAATGGTCAGAGGG + Intronic
1024405102 7:48969975-48969997 TCTGCACAGGAATGGTGAGGTGG - Intergenic
1027528321 7:79299307-79299329 ACTGGAAATGGATAGGCAGGGGG + Intronic
1027832908 7:83203248-83203270 TCTGGACATGAAAGGTAAGTGGG - Intergenic
1028780327 7:94728425-94728447 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1031672612 7:124568552-124568574 TCTGAAAATGCATGGTAAAGGGG - Intergenic
1033065524 7:138150192-138150214 TCTAGAAATGAATGGTGATATGG + Intergenic
1034246808 7:149651116-149651138 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1034581152 7:152043687-152043709 TCTGGAAAAGAAAGATCCGGAGG + Intronic
1037652832 8:20854981-20855003 TCTGGACAGGGATGGTAAGGAGG + Intergenic
1038703799 8:29875503-29875525 TCTGGGAATAAATGCCCAGGGGG - Intergenic
1040608921 8:48963147-48963169 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1043792391 8:84488579-84488601 TATGGAAATGATTGTACAGGAGG - Intronic
1044237814 8:89852110-89852132 TCTGGAAATGACTCCTCAAGTGG + Intergenic
1044256713 8:90071884-90071906 TCTTGAAATTAATGGTCTAGAGG - Intronic
1047562895 8:126008580-126008602 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1047765461 8:127986526-127986548 CCTGGGACTGAAGGGTCAGGTGG - Intergenic
1048686662 8:136911975-136911997 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1049857481 8:144871914-144871936 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1051673283 9:19534078-19534100 TCTGTGAATAAATGGTCAGAAGG - Intronic
1061876775 9:133547918-133547940 TCTGGAAATGGAGGCTCTGGTGG + Intronic
1203678247 Un_KI270756v1:41597-41619 ACTAGAATGGAATGGTCAGGAGG - Intergenic
1186150540 X:6670085-6670107 CCTGGAAATAAATGATCATGTGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187630090 X:21159745-21159767 TCTGGAAATGAATAGTTGTGAGG + Intergenic
1188538208 X:31220533-31220555 ACTGCAAAGGAATGGCCAGGAGG - Intronic
1189081471 X:37977467-37977489 TCTGGAAATGAATGGTCAGGGGG + Intronic
1189969977 X:46408248-46408270 TGTTGAAATGAATAGGCAGGGGG + Intergenic
1192275908 X:69630847-69630869 TGTGGAAATAAATTGTCAGAGGG - Intronic
1192884666 X:75324058-75324080 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1193048672 X:77078772-77078794 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1194536239 X:95108389-95108411 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1195504196 X:105638034-105638056 TCTGCAAATGAATGGAAATGAGG - Intronic
1197587680 X:128369556-128369578 TATTGAACTGAATGATCAGGAGG + Intergenic
1197869699 X:131053328-131053350 ACCGGAAAAGAATGGGCAGGGGG + Intergenic
1201214165 Y:11707532-11707554 TCTGGAATGGAATGGACTGGAGG + Intergenic
1201370039 Y:13253377-13253399 TCTGGAAAAGAAAGATCTGGAGG - Intronic
1201782719 Y:17741202-17741224 TCAGAATATGAATGGGCAGGAGG + Intergenic
1201818834 Y:18164786-18164808 TCAGAATATGAATGGGCAGGAGG - Intergenic
1201926546 Y:19293925-19293947 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1201959107 Y:19659459-19659481 TCTGGAAAAGAATGATATGGAGG + Intergenic
1202164088 Y:21968589-21968611 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1202227268 Y:22617775-22617797 TCTGGAAAAGAAAGATCTGGAGG - Intergenic
1202315854 Y:23577879-23577901 TCTGGAAAAGAAAGATCTGGAGG + Intergenic
1202554911 Y:26092195-26092217 TCTGGAAAAGAAAGATCTGGAGG - Intergenic