ID: 1189082993

View in Genome Browser
Species Human (GRCh38)
Location X:37994226-37994248
Sequence CAATGAGGGGCTGGAGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189082982_1189082993 24 Left 1189082982 X:37994179-37994201 CCAATGACATCAAAAAGTGGAGG 0: 1
1: 1
2: 0
3: 14
4: 237
Right 1189082993 X:37994226-37994248 CAATGAGGGGCTGGAGCATAGGG 0: 1
1: 0
2: 2
3: 23
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189082993 Original CRISPR CAATGAGGGGCTGGAGCATA GGG Intronic
900277169 1:1838222-1838244 CAATTAGGGGCTGGAACAATTGG - Intronic
903372824 1:22847802-22847824 CATGGAGGGACTGGAGCACAGGG - Intronic
906290100 1:44614238-44614260 CAGTGAGCTGCAGGAGCATATGG + Exonic
906577324 1:46902565-46902587 GGGTGAGGGGCTGAAGCATATGG - Intergenic
906669981 1:47647410-47647432 CACTGAGGGGCTGTAGGGTAAGG - Intergenic
908574194 1:65441752-65441774 CACTGAAGGGCTGGAGCCTGAGG + Intronic
908608307 1:65825318-65825340 CAATGAGGTGGTGGAACACAAGG + Intronic
910395723 1:86791743-86791765 GAATGAGTGGCTGGATCATGTGG - Intergenic
911530551 1:99038385-99038407 CAAAGAGGGATTGGAGCATCAGG - Intergenic
912086687 1:106014741-106014763 AAATGAGGAACTGGAGCAAAAGG - Intergenic
912687832 1:111780689-111780711 CAACGAGGCGCTGGAGCTGACGG - Exonic
916583193 1:166126671-166126693 CAATGAGGGGCCACATCATATGG + Intronic
917213026 1:172649304-172649326 CCATCAGGGCCTGGAGCACATGG + Intergenic
917647609 1:177044521-177044543 CAAAGATGGGCTGTAGCAAAGGG + Intronic
918589902 1:186229212-186229234 CAATGAGGGGATGGAAAACAAGG + Intergenic
920865300 1:209747571-209747593 CAATGAGGGGCTGAGGCCCAAGG + Intergenic
921169406 1:212533192-212533214 TAATGAGGGGCTGGAATAAAAGG - Intergenic
1069571990 10:69499883-69499905 CACAGAGTGGCTGGAGCAGAGGG + Intronic
1069628287 10:69881411-69881433 CAGTGAGGGGTGGGAGCAGAGGG + Intronic
1071461350 10:85899823-85899845 CAATGAGGGGCTGAACCTTCTGG - Intronic
1072720719 10:97779424-97779446 CACTGAGGGGCTTGAGCTGAAGG - Intergenic
1073546746 10:104355299-104355321 AAATGAGGGGCTGGTGCCTCTGG - Intronic
1075223378 10:120603369-120603391 GGATGAGGGGCTGGAAAATACGG + Intergenic
1075569387 10:123528970-123528992 TAATGAGGGGCTGGGGCTTTGGG - Intergenic
1075628700 10:123985933-123985955 GGATGAGGGGCTGGAGAATTAGG + Intergenic
1076162436 10:128255873-128255895 GAATGAGGGGCTGGTGGATTTGG - Intergenic
1078762262 11:14260706-14260728 CAATGAGGATCTGGAGCAGGTGG + Exonic
1080674945 11:34417110-34417132 TTATGAGGGGAGGGAGCATATGG + Intergenic
1081776792 11:45681251-45681273 CAATGAGGGGTTACAGCAGAGGG + Intergenic
1081963616 11:47156161-47156183 CAGTTAGGGGCTGGAGCCTGGGG + Intronic
1082806038 11:57451180-57451202 GAATGGGAGGCTGGAGCATAAGG + Intergenic
1084918157 11:72446909-72446931 CAAAGTGGGGCTGGAGGAAAAGG + Intergenic
1085462539 11:76702771-76702793 CATAGAGGGGGTGGAGGATATGG - Intergenic
1086607126 11:88709305-88709327 GAATGAGGGGATGGACCATGAGG + Intronic
1089494771 11:118902521-118902543 CAAAGAGCAGCTGGAGCATCGGG - Exonic
1090957549 11:131526791-131526813 GAATCAGGGGCTGGAGCAGAGGG + Intronic
1092112646 12:5974736-5974758 CAGTGAGGAGCTGGAGCAGACGG + Intronic
1092225365 12:6744952-6744974 CACTGAGGAGCTGGGGCATGGGG - Intergenic
1094120690 12:26970652-26970674 CAATGAGGGGCTGTGCCCTAGGG + Intergenic
1094496245 12:30991117-30991139 GAACAAGGGGCTGGAGCATCTGG - Intronic
1096489180 12:52004461-52004483 AAATGAGGGCTTGGACCATACGG + Intergenic
1096552763 12:52384290-52384312 AAATGAGGGGCTGGGGTAAAGGG - Intronic
1097965152 12:65571210-65571232 CAATGTGGTGCTGGAGCCTGAGG - Intergenic
1098580597 12:72094589-72094611 CTGAGAGGGGCTGGAGCTTAAGG + Intronic
1101832747 12:108272064-108272086 CACAGAGGGGCTGGAGAAAAAGG - Intergenic
1101877111 12:108603322-108603344 CCATGAGGGGCTGGAGCTGGGGG - Intergenic
1103609564 12:122114563-122114585 CAATGGGGGCCTGGAGCACAGGG - Intronic
1104802924 12:131566900-131566922 CAATCAGCGGCTGCAGCACACGG + Intergenic
1105810697 13:23992667-23992689 CAGGGAGGGGCTGTAGCACATGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108766357 13:53635013-53635035 TAATGAGGGTCTGGAGAAAATGG - Intergenic
1109349750 13:61163133-61163155 AAAAGAGGGGCTGGAGGATTAGG - Intergenic
1110364272 13:74663668-74663690 CAATGTGGGGCTGATGAATATGG - Intergenic
1112599486 13:100840987-100841009 AAATGAGAGGCTGGACCATATGG - Intergenic
1114149498 14:20021367-20021389 CAATGAGGGACTGTTGCATTGGG - Intergenic
1114530682 14:23393800-23393822 GAATGAGAGGCTGGAGGATGAGG - Exonic
1114570707 14:23665624-23665646 CCATGAGGTGCTGCAGCAAAAGG - Intergenic
1116719488 14:48476502-48476524 CAATGAGGGTTTGGAGAACATGG + Intergenic
1118761643 14:68883926-68883948 GAACTAGGGGCTGGAGGATAAGG + Intronic
1119616925 14:76104970-76104992 GCATGAGGGGCTGGAGCATCAGG - Intergenic
1121379946 14:93456178-93456200 GAATGAGGGAAGGGAGCATATGG + Intronic
1122269222 14:100560898-100560920 CCATCAGGGGATGGAGCATGAGG + Intronic
1124095952 15:26648899-26648921 CAGGGAGGGGCTGGAGCTTGTGG + Intronic
1132864658 16:2087429-2087451 CCAGGAGGGGCAGGAGCATAGGG + Intronic
1134222779 16:12368182-12368204 CCATGAGGGGCTGGACTCTAGGG + Intronic
1136132862 16:28234942-28234964 CATTGAGAGGCTGGAGCCTTTGG - Intergenic
1138411584 16:56844570-56844592 CAATGCGAGGCTGGTGCAGATGG + Exonic
1140504558 16:75463573-75463595 CAATGAGGGACCAGAGCAGAGGG - Intronic
1140512103 16:75516356-75516378 CAATGAGGGACCAGAGCAGAGGG - Intergenic
1140898030 16:79342369-79342391 CCAAGAGGGGCTGCAGCATGAGG + Intergenic
1141757229 16:85999314-85999336 CAGTGAGGGGCTTGAGCAGAGGG - Intergenic
1141790803 16:86232785-86232807 CGGTGAGGGGCTGGAGCTCACGG - Intergenic
1146472855 17:33138591-33138613 CAGGAAGGGGCTGGAGCAAAGGG - Intronic
1149081277 17:52660528-52660550 CAATGAGGAGAAGGAGCAGAAGG + Intergenic
1152246471 17:79187286-79187308 GAAAGAGGGGCAGGAGCATGAGG - Intronic
1152577549 17:81149475-81149497 CTGTGAGGGGCTGGAGGATGTGG - Intronic
1153664055 18:7352262-7352284 CAAGGATGGCCTGGAGCACAGGG - Intergenic
1157296925 18:46452005-46452027 GAATGAATGGGTGGAGCATAGGG + Intronic
1158341761 18:56473639-56473661 CAATGATGGCCTGGAGAAGAAGG - Intergenic
1159915604 18:74184967-74184989 CAAAGTGGGGCTGTAGCTTACGG + Intergenic
1160552897 18:79706339-79706361 CAATCTGGGGCTGGAACACATGG - Intronic
1160822674 19:1065837-1065859 CTATGTGGGGCTGGCGCCTAAGG + Intergenic
1162531959 19:11241365-11241387 CAATGAGGGGCTGGGGCAGAGGG + Intronic
1163746479 19:19051801-19051823 CATTGAGGGACTGGAGCAGAAGG - Exonic
1167299628 19:48671286-48671308 CGGTGAGCGGCTGGAGCAGAGGG + Intronic
925114356 2:1365952-1365974 GAATGAGGGGGTGGAGAATGGGG - Intronic
926665857 2:15522239-15522261 TAATGAGGGTCTGAAGTATAAGG + Intronic
926686188 2:15699563-15699585 CAATGAGGGGGTGGAGAATGAGG - Intronic
927459162 2:23282937-23282959 AAGTGAGGGGCTGGAGAATAGGG + Intergenic
927496443 2:23554732-23554754 CCATGTGGGGCTGGAGCAGAGGG - Intronic
927498547 2:23566317-23566339 GAATGAGGGGCTGGAGGACGTGG - Intronic
928436871 2:31260472-31260494 CAATCAGGGGCTGGGGCCTTTGG - Intronic
930274616 2:49297007-49297029 CAAACAGGGACTTGAGCATAAGG - Intergenic
931057005 2:58483500-58483522 CAGTGAGGGCCTGGAGGATAGGG - Intergenic
932039462 2:68283829-68283851 CTCTGTGTGGCTGGAGCATAGGG - Intergenic
935606189 2:104974319-104974341 CAGTGAGGAGCTGGAGCAGGTGG - Intergenic
937048066 2:118863342-118863364 CAAGGAGAGGCTGGAGCAGGAGG + Intergenic
938238439 2:129724441-129724463 CAATGAGGGTCTGGCGCATTCGG - Intergenic
941993200 2:171576888-171576910 CTGTGAGGGGCTAGAGCAAAAGG + Intergenic
942344865 2:174992224-174992246 GAATGTGGGGCTGGAACATGTGG + Intronic
943119845 2:183722227-183722249 CCATGAGTGGTGGGAGCATAGGG - Intergenic
945746570 2:213725691-213725713 CAATGAGGGGATGGAGTTAATGG + Intronic
947859672 2:233349559-233349581 CAATGAAGGGCTGGAGAAGGGGG + Intergenic
948881674 2:240861023-240861045 AAATGAGGGACTGGAACATTGGG - Intergenic
1169005182 20:2200874-2200896 TGATGAGGGGCTGGAGCACAGGG - Intergenic
1177448615 21:21234717-21234739 TAATGAGTGTCTGGAGCAGAGGG + Intronic
1178834797 21:36087834-36087856 GAATGAGGGACTGGAGGAGAGGG - Intergenic
1179562742 21:42226679-42226701 CAATGAGTGCTTGGAGCATAAGG - Intronic
1181627159 22:24129844-24129866 CAAAGAGGGGTTGGAGGGTATGG + Intronic
1182080691 22:27526786-27526808 CCATGTGGGGCTCGGGCATAGGG + Intergenic
1182509805 22:30810739-30810761 CAGAGAGGGGCTGGATCATTTGG - Intronic
1183210444 22:36448030-36448052 CACAGAGGAGCTGGAGCAGAGGG - Intergenic
1184235379 22:43180401-43180423 TGGTGAGGGGCTGGAGCATGGGG + Intronic
1184511885 22:44938728-44938750 CAATGAGGGCCTGAAAAATAAGG + Intronic
1184538790 22:45106233-45106255 CAATGAGGGTCTGAAGCAAGGGG + Intergenic
1184942694 22:47780788-47780810 CACTGAGGGGCTGGTGCCTGGGG - Intergenic
1185263738 22:49886350-49886372 CAATGAGCCGCTCGAGCATGTGG - Exonic
951444956 3:22767873-22767895 CAATGAGGGGCTGGAGTAGCTGG - Intergenic
952955882 3:38556855-38556877 CAATGGGAGGCTGGAGTACATGG + Intronic
954605281 3:51904588-51904610 GGATGAGGGGGTGGAGAATATGG + Intergenic
955641255 3:61087636-61087658 CAATAAGGCTCTGGAGCATCTGG + Intronic
957050348 3:75406862-75406884 GAATGAGAGGATGGAGGATAAGG + Intergenic
958110944 3:89144213-89144235 GAATGAGTAGGTGGAGCATAAGG - Intronic
959202166 3:103261267-103261289 CAATGAAGGCCAGGAGCCTAGGG + Intergenic
959319816 3:104857809-104857831 CAATGTGGGGCAGAAGCAGAAGG + Intergenic
961384890 3:126517807-126517829 CAATGAGAGGCTGGAGGAGGTGG - Intergenic
961851034 3:129818837-129818859 AAATGAGGTGCTGAAGCACATGG + Intronic
961882653 3:130073306-130073328 GAATGAGAGGATGGAGGATAAGG + Intergenic
962227133 3:133622588-133622610 CACTGGGGGGCTGGAGAATAAGG + Intronic
965837366 3:172866903-172866925 CAATGAGGGGCTTTAGCACCCGG + Intergenic
965926187 3:173983596-173983618 CTACAAGAGGCTGGAGCATAAGG - Intronic
966547881 3:181171287-181171309 CAAGGAGGGGTGGGAGGATAGGG + Intergenic
967037055 3:185655868-185655890 CCATGAGGAGCTGGGGCCTAGGG - Intronic
967833067 3:193938738-193938760 CAAGGAAGAGCTGGAGCAGAGGG - Intergenic
967894258 3:194383959-194383981 AAATGAGGGACTGGACCAGAGGG - Intergenic
967936583 3:194732941-194732963 CCATGTGTGGCTGGAGCACAGGG + Intergenic
967990270 3:195125362-195125384 CATTGCGGGGCTGGAGAATTGGG + Intronic
968812491 4:2806248-2806270 CCCTGCGGGGCTGGGGCATAGGG + Intronic
974159529 4:58119808-58119830 ACATGAGGGGCTGAAGCAGAAGG - Intergenic
978169163 4:105648392-105648414 GACAGTGGGGCTGGAGCATATGG + Intronic
982090935 4:151879389-151879411 CAAGGAGGGGCAGGAGCAGCCGG + Intergenic
983336059 4:166394160-166394182 CAACCAGGGGCTGCAGCAGAGGG + Intergenic
984348804 4:178565635-178565657 CAATGAGAGGCTGGGGCAGCCGG + Intergenic
984828152 4:183946857-183946879 CAAGGAGGGGGTGGATCACAAGG - Intronic
985136241 4:186788680-186788702 CAAGGAGGGGATAGAGCAAAGGG - Intergenic
985388326 4:189468161-189468183 CAGTGAGGGGCTGGAGGATGGGG - Intergenic
986529989 5:8726440-8726462 CACTGATGGGCTGGGACATAAGG + Intergenic
986846360 5:11760274-11760296 CAATGAGGGGCTGGGTAACAAGG - Intronic
988921685 5:35948162-35948184 CACTGAGGAGCTGGTGCAGAGGG + Intergenic
989195889 5:38715842-38715864 CAATGGGGGGCAGGAGCAGATGG + Intergenic
991957445 5:72009650-72009672 AATTGAGGGGCTTTAGCATAAGG + Intergenic
995415730 5:111910900-111910922 CAAGAAGGGGCTGGAGCAGTAGG - Intronic
996024563 5:118630453-118630475 CAATGAGGTCCTGGAGCTCAAGG - Intergenic
999817584 5:155192884-155192906 CAATGAGGAGCAGGAGATTAGGG + Intergenic
1002434370 5:179221868-179221890 CCATGGGGGGCTGGAGCAGAGGG - Intronic
1006297135 6:33174698-33174720 CAATGAGGGGCTAGAGGCTGGGG - Intronic
1007186791 6:39978503-39978525 CAATGAGTGGGTGTAGCAGAAGG + Intergenic
1007510574 6:42371518-42371540 CAAGGAGGGGGTTGAGCATCAGG - Intronic
1009434453 6:63601974-63601996 CAATGAAGGGCTGAAGCAACTGG + Intergenic
1010870110 6:81026463-81026485 CAATGTGGGGCTTGAGAAGATGG - Intergenic
1012324751 6:97903074-97903096 GAATGATGGCCTTGAGCATAAGG + Intergenic
1016745126 6:147571151-147571173 CAAGGAGGACCTGAAGCATAAGG - Intronic
1017156577 6:151327790-151327812 CAATGTGGGTGTGGAGGATATGG + Intronic
1017868593 6:158466955-158466977 CAATGAAGGTCTGAAGCCTAAGG + Intronic
1017960371 6:159216327-159216349 CAATAAGGGGCTGGACAAAAGGG - Intronic
1018209145 6:161463431-161463453 CAAGGAGGGGCAGGATGATATGG - Intronic
1019147882 6:169986550-169986572 CAAGGGGTGGCTGGAGCAGAGGG - Intergenic
1019581948 7:1768956-1768978 CAATCAGGGGCTGAAGTAGAGGG - Intergenic
1022371849 7:29778911-29778933 CACTGAGGGGTAGGAGGATATGG - Intergenic
1023586751 7:41738718-41738740 CAATGAGGGGGTAGAACTTATGG + Intergenic
1024349895 7:48353007-48353029 CAGTGAAGGGCTGGAGCAGCTGG + Intronic
1027229649 7:76264827-76264849 GAATGGGGGGCTGGAGAGTAGGG - Intronic
1028464008 7:91128786-91128808 AAAGGAGGGGCTGGAGAAAAGGG - Intronic
1030476363 7:110038014-110038036 CAGTGGGATGCTGGAGCATATGG + Intergenic
1033273271 7:139951440-139951462 CAATGGGGGACTGAACCATATGG - Intronic
1036128303 8:6084078-6084100 CAGTGAGGGGCAGGAGCCTAAGG + Intergenic
1041045063 8:53880703-53880725 TAATGCGGGGCTGGAGCAGTGGG + Intronic
1042294201 8:67202195-67202217 GGATGAGGGGCTGCAGAATAAGG - Intronic
1045676954 8:104617577-104617599 CTATGTGGGGCAGGAGCAGAGGG + Intronic
1050335433 9:4585381-4585403 CAAGAAGGAGCTGGAGCAGATGG + Exonic
1050371456 9:4925255-4925277 GAATGAGGTTCTGGAGGATATGG + Intergenic
1053443697 9:38135902-38135924 CAATGAGGGGCAGGGCCACAGGG - Intergenic
1053491423 9:38507455-38507477 AAATAAAGGGCTGGAGCAAAAGG - Intergenic
1057075411 9:92135860-92135882 TCATGAGGGGCTGGTGCATCCGG - Intergenic
1057139378 9:92717480-92717502 CAAGCAGTTGCTGGAGCATAGGG - Intronic
1057913888 9:99040983-99041005 CAAGCCGGGGCTGGAGCTTAGGG - Intronic
1059622956 9:116028906-116028928 AAATGAGAGACAGGAGCATAAGG - Intergenic
1060473342 9:123966903-123966925 CAGTGAGGGACTGCAGTATAGGG - Intergenic
1062035138 9:134379624-134379646 CAGAGAGGGGCTGGAGCAGGAGG - Intronic
1062070715 9:134553718-134553740 CACTGAGGGGCTGGAGAACCTGG - Intergenic
1187173331 X:16871377-16871399 AAATGAGGGCCAGGAGCAGAGGG + Intergenic
1188542427 X:31265717-31265739 CAAAGAGGGGCTTGAGTAAAAGG + Intronic
1188980082 X:36719801-36719823 CAGTGAGGGGCTGGAGCACAGGG + Intergenic
1189082589 X:37990723-37990745 CAATAAGGGCCTGGAGCAGAGGG + Intronic
1189082993 X:37994226-37994248 CAATGAGGGGCTGGAGCATAGGG + Intronic
1189649861 X:43177469-43177491 CCAGGTGGGGCTGGAGCACATGG + Intergenic
1190388613 X:49910022-49910044 CAATGAGGGGCCTCAGGATATGG - Intergenic
1191881747 X:65849433-65849455 CAGAGAGGGGCTGGATCAAAGGG + Intergenic
1195174983 X:102306120-102306142 GAATGTGGGGCTGGGGGATAGGG + Intergenic
1195183882 X:102380973-102380995 GAATGTGGGGCTGGGGGATAGGG - Intronic
1196574050 X:117297886-117297908 CAGTGAGTTGCTGGATCATATGG + Intergenic
1198043780 X:132879784-132879806 CAATGAGCTGCTACAGCATAGGG - Intronic