ID: 1189083453

View in Genome Browser
Species Human (GRCh38)
Location X:37997218-37997240
Sequence GGCTGCACACTTTGTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 3, 2: 19, 3: 70, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189083445_1189083453 12 Left 1189083445 X:37997183-37997205 CCATCATGCCAGCTGCAGCAGGG 0: 15
1: 36
2: 71
3: 155
4: 410
Right 1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG 0: 1
1: 3
2: 19
3: 70
4: 251
1189083447_1189083453 4 Left 1189083447 X:37997191-37997213 CCAGCTGCAGCAGGGAGCCATGA 0: 1
1: 1
2: 10
3: 71
4: 337
Right 1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG 0: 1
1: 3
2: 19
3: 70
4: 251
1189083443_1189083453 18 Left 1189083443 X:37997177-37997199 CCGTTGCCATCATGCCAGCTGCA 0: 1
1: 10
2: 19
3: 67
4: 293
Right 1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG 0: 1
1: 3
2: 19
3: 70
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189083453 Original CRISPR GGCTGCACACTTTGTGGAGC TGG Intronic
900183067 1:1320859-1320881 GGCTGCACCCTGTGGGGAGCAGG - Intronic
900228562 1:1544301-1544323 GGATGGACCCTGTGTGGAGCTGG - Intronic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
902747207 1:18481988-18482010 GGCTGCACCCTTTGTGTCACCGG - Exonic
903069938 1:20722074-20722096 GCCTGCACATTTTGGAGAGCAGG + Intronic
903168424 1:21537398-21537420 AGCCCCTCACTTTGTGGAGCGGG + Intronic
905001147 1:34671165-34671187 GGCTGCACACTCCGTGAGGCAGG + Intergenic
905684469 1:39898902-39898924 GGCTGCAAAATGTGTGGAGCAGG - Intronic
906009397 1:42509620-42509642 TACTGAACACTTTGTTGAGCTGG + Intronic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG + Intergenic
907761655 1:57367680-57367702 GGTTCCACACTCCGTGGAGCTGG + Intronic
908682800 1:66681673-66681695 TGATGCTCACTTTGTGGAGGGGG + Intronic
908902321 1:68969825-68969847 GGCTGCTCCATTTGTGGAGCAGG + Intergenic
911095671 1:94053077-94053099 TGCTGAACACTTTGAGGTGCTGG + Intronic
912881954 1:113424162-113424184 AGCTGCACACTCCTTGGAGCTGG - Intronic
913695410 1:121320048-121320070 GGCTGCAAAGCTTCTGGAGCAGG + Intronic
913958861 1:143324144-143324166 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
914053178 1:144149524-144149546 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
914126019 1:144817017-144817039 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
914142153 1:144960012-144960034 GGCTGCAAAGCTTCTGGAGCAGG - Intronic
914420362 1:147523133-147523155 GGCTGCACCCTTAGAGAAGCAGG + Intergenic
917783477 1:178425996-178426018 GGCTGCTGACTTTCTAGAGCTGG - Intronic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
920482741 1:206338427-206338449 GGCTGCAAAGCTTCTGGAGCAGG + Intronic
920703501 1:208235237-208235259 GGCTGAAGACTTGGTGGAGATGG - Intronic
921181725 1:212636781-212636803 GGCAGCACACTGTGTGGATGAGG - Intergenic
921767051 1:218983994-218984016 GGCTGCATACTCAATGGAGCTGG - Intergenic
922503565 1:226113769-226113791 AGCTGCACACTGTGAGGAGAAGG - Intergenic
923918090 1:238530756-238530778 GGCTACTCACTCTGTGGAGATGG - Intergenic
924672885 1:246147499-246147521 GGCTGCACACTCCATGGAGGCGG + Intronic
1064684284 10:17843808-17843830 TGCTCCAGACTTTGTGGAGCAGG + Intronic
1065808925 10:29422924-29422946 GGCTACACACTTTGAGTAGAAGG + Intergenic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1066962812 10:42236293-42236315 GGCTGCACTCCTTGGGGAACAGG + Intergenic
1068300503 10:55132100-55132122 GGCTACACACTCCATGGAGCTGG - Intronic
1068474304 10:57506581-57506603 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1072871459 10:99124866-99124888 GGCTGCACACTCCATGGAGCTGG - Intronic
1072922304 10:99586366-99586388 GTATGCACTCTTGGTGGAGCTGG - Intergenic
1073502066 10:103948990-103949012 AGCTACACAGTTTGTAGAGCAGG + Intergenic
1076361118 10:129889516-129889538 GGCTGCAGAGTTTGGGGAGCAGG - Intronic
1076549266 10:131267497-131267519 GTCTGCTCACTTTGCAGAGCTGG - Intronic
1079733141 11:23961765-23961787 GGCTGCACACTCCATGGAGCTGG + Intergenic
1082010989 11:47449377-47449399 GCCTGCCCACTTGCTGGAGCTGG - Intergenic
1083272168 11:61578077-61578099 GGCTGGACAGAGTGTGGAGCTGG + Intronic
1083570447 11:63758686-63758708 AGCTGCTCACATTGTGGGGCAGG - Exonic
1084325334 11:68396880-68396902 GGCTTCACACGTGGTGGGGCAGG - Intronic
1087036095 11:93758185-93758207 GGCTACACACTCTATGGAGCGGG + Intronic
1088704413 11:112448406-112448428 GGCTGCACACTCCATGGAGCTGG - Intergenic
1088989312 11:114938038-114938060 GGCTTCTCACATGGTGGAGCAGG - Intergenic
1089822633 11:121241830-121241852 GCCTGCTCGCTTTGCGGAGCAGG + Intergenic
1090795336 11:130130952-130130974 AGCTGCTCCATTTGTGGAGCTGG + Intronic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1094427145 12:30327802-30327824 GGCTGCACACTCCATGGAGCTGG + Intergenic
1096796542 12:54081638-54081660 CCCTTCAAACTTTGTGGAGCAGG + Intergenic
1098619590 12:72578298-72578320 GGCGGCACAGCTTTTGGAGCAGG + Intronic
1099049884 12:77768806-77768828 GGTTGCACACTCCATGGAGCTGG - Intergenic
1099963657 12:89421590-89421612 AGCTACACACTTAGTGGAGAAGG + Intronic
1100847730 12:98678360-98678382 GGCTGCATGCTCTGTGGAGCTGG + Intronic
1103177413 12:118876772-118876794 GGCTGCACACTGACTGGGGCTGG + Intergenic
1105274417 13:18906298-18906320 GGCTGCACTCCTTGGTGAGCAGG - Intergenic
1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG + Intergenic
1107115329 13:36740468-36740490 GGCTGCACAGTTGGTGGTTCAGG - Intergenic
1111202959 13:84962578-84962600 GGCTGCATGCTCTGAGGAGCCGG - Intergenic
1111800627 13:92975404-92975426 GGTTGCACACTCCATGGAGCTGG - Intergenic
1112741030 13:102472675-102472697 GGCTGCATGCTCTGTGGAGCTGG - Intergenic
1113343068 13:109446182-109446204 GAGTGCACACTTTCTGGAGAAGG - Intergenic
1114280897 14:21192002-21192024 GGCTGCATGCTTAGTGGAGCCGG + Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG + Intronic
1116130725 14:40854028-40854050 GGCTGCACACTACTTGGAGCTGG + Intergenic
1119250433 14:73148336-73148358 CGCTGCACACCTTGGGAAGCTGG - Intronic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1124650408 15:31469679-31469701 GGCTGCACACTCCATGGAGCTGG - Intergenic
1127058888 15:55161838-55161860 AGCTGCAGACTTTGTGAAGGAGG + Intergenic
1128504581 15:68257584-68257606 GGCTACATAATTTGTGGACCCGG - Intergenic
1128790797 15:70432114-70432136 GGCTGCACACTCCATGGAGCTGG - Intergenic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1130029183 15:80296245-80296267 GGCTGCACACTCCATGGAGCTGG - Intergenic
1130183011 15:81651101-81651123 GACTACACACTCCGTGGAGCTGG + Intergenic
1131467518 15:92667645-92667667 GGCTCCACACTGTGGGGAACAGG - Intronic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132823920 16:1893291-1893313 GGGAGCAGACTTTGAGGAGCAGG + Intergenic
1132902951 16:2268292-2268314 GGTTGCACGCTTACTGGAGCGGG + Intronic
1134078575 16:11309157-11309179 GGCTGCACATTCTCTGGAGGTGG - Intronic
1135114359 16:19712741-19712763 GGCCGGACACTGTCTGGAGCAGG + Intronic
1135345760 16:21687215-21687237 GGCTCCACAGTGAGTGGAGCAGG + Intronic
1136718958 16:32304378-32304400 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1136723982 16:32342734-32342756 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1136837331 16:33510642-33510664 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1136842312 16:33548778-33548800 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1137063002 16:35809342-35809364 AGCAGCACACATTGTGGAGACGG - Intergenic
1137238422 16:46633976-46633998 GGCTGCACACTCCATGGAGCTGG - Intergenic
1137291691 16:47055819-47055841 GGCTGCACACTCCATGGAGCCGG - Intergenic
1137588496 16:49679262-49679284 GGCTGCGCCCTCCGTGGAGCTGG + Intronic
1138454410 16:57113070-57113092 GGCTGGACAGCTTGTGGAGCAGG - Intronic
1139343993 16:66290250-66290272 AGCTGCCCACCTCGTGGAGCGGG + Intergenic
1139354581 16:66359995-66360017 GGCTGCACCATCTGTGGGGCAGG - Intergenic
1139390114 16:66601963-66601985 GGCTGCACACTCCATGGAGCAGG - Intergenic
1139571612 16:67816475-67816497 GGCCACACACTTTGTGGGGCTGG + Intronic
1203002449 16_KI270728v1_random:175031-175053 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203007473 16_KI270728v1_random:213393-213415 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203075381 16_KI270728v1_random:1119690-1119712 GTCTGCACTCCTTGGGGAGCAGG - Intergenic
1203123489 16_KI270728v1_random:1558347-1558369 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203134054 16_KI270728v1_random:1711437-1711459 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1203147510 16_KI270728v1_random:1810921-1810943 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1203152477 16_KI270728v1_random:1849075-1849097 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1142905836 17:3041239-3041261 ATCTGGACACTTTGTGGAGGTGG + Intergenic
1143357704 17:6342806-6342828 GGCTGCACACTTGGTTCATCTGG + Intergenic
1144632168 17:16879807-16879829 GGCTGCCCACACTGTGGAGAAGG - Intergenic
1144714353 17:17423975-17423997 GACTGCACACTCCATGGAGCTGG + Intergenic
1145208839 17:20998376-20998398 GGCTGCCCACACTGTGGAGAGGG + Intergenic
1145976767 17:28988449-28988471 GGCTAGGCACTTTGGGGAGCAGG - Intronic
1146086789 17:29837827-29837849 GGCTGCGCACTCCATGGAGCTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149085299 17:52709658-52709680 GGCTGCACACTACATGGAGCGGG + Intergenic
1149160588 17:53687540-53687562 GGCTGCACACTCCATGGAGCTGG - Intergenic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150377647 17:64695147-64695169 TGCACCACACTTTGAGGAGCAGG - Intergenic
1150777021 17:68089348-68089370 TGCACCACACTTTGAGGAGCAGG + Intergenic
1151497171 17:74465983-74466005 GTCTGCACTCTGTGTGGATCAGG + Intergenic
1154076145 18:11203674-11203696 GGCTGCAGAATTGGAGGAGCAGG + Intergenic
1154175590 18:12085988-12086010 GGCTGCACTCCTTGTTGAGCAGG - Intergenic
1154415858 18:14174872-14174894 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1154466104 18:14643553-14643575 GGCTGCACTCCTTGGTGAGCAGG - Intergenic
1155120861 18:22817001-22817023 GGCTGCACACTCCATGGAGCGGG - Intronic
1155830975 18:30514264-30514286 GGCTGCACACTCCATGGAGCAGG - Intergenic
1156298984 18:35818473-35818495 GGCTGCACGCTCCGTGGAGCTGG - Intergenic
1156337985 18:36186976-36186998 GGCTGCACACTTTCGGAACCGGG - Intergenic
1156826251 18:41433342-41433364 GGCAAAAAACTTTGTGGAGCTGG + Intergenic
1157273533 18:46294387-46294409 GCCTGCACACCTTGGGGATCAGG - Intergenic
1157743586 18:50115176-50115198 GGCTGCCCACCTTGGGGATCAGG - Intronic
1158045133 18:53146381-53146403 GGCTGCATCCTCTATGGAGCAGG + Intronic
1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG + Intergenic
1158890086 18:61864486-61864508 CGGTGAACACTTTGAGGAGCTGG - Intronic
1164796662 19:31039235-31039257 AGCTGAACACTTATTGGAGCAGG - Intergenic
1165027105 19:32969949-32969971 GGCTGCACACTTCATGGAGCCGG - Intronic
1166519752 19:43472557-43472579 GGCTGCCCACGTTGTGGGGCAGG - Intergenic
1167013016 19:46821513-46821535 GGCTACACACTCCATGGAGCCGG + Intergenic
1167234918 19:48308628-48308650 GGCTGCACACTCCATGGAGCCGG + Intronic
1168303266 19:55419264-55419286 GGCTGCACGTTTCATGGAGCCGG + Intergenic
1202692576 1_KI270712v1_random:101947-101969 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
926859428 2:17292417-17292439 GGCTGCACACTCCATGGAGCTGG - Intergenic
926988519 2:18651073-18651095 GCTTGCACAATTTGTGGAGATGG + Intergenic
929872983 2:45773904-45773926 GGCTGCCCTCCTCGTGGAGCAGG + Intronic
931297677 2:60945017-60945039 GACTGCAGACATTCTGGAGCTGG - Exonic
932414079 2:71563439-71563461 AGCTGCACACTCTGGAGAGCAGG - Intronic
932501742 2:72188174-72188196 GGCTGCAGACTCCATGGAGCTGG - Intronic
932617466 2:73243036-73243058 GGCTGCAGAGTTTCTGAAGCAGG + Exonic
933953828 2:87352024-87352046 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
934275171 2:91568466-91568488 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
935131436 2:100264206-100264228 TGCTGCACACTTGGTGGGGGAGG - Intergenic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
936290283 2:111217497-111217519 GGCCTCCCACTTTATGGAGCAGG - Intergenic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
939059691 2:137405757-137405779 GGCTTCACAGTTCGTGGAGCAGG - Exonic
941151288 2:161918827-161918849 AGCTGCATGCTCTGTGGAGCAGG + Intronic
941746528 2:169092664-169092686 GGGTGGAAACTTTCTGGAGCAGG + Intronic
943473381 2:188323569-188323591 AACTGCACACTTTTTGGAGAAGG - Intronic
943526158 2:189020385-189020407 GGCTGCACACTCCATGGAGCTGG + Intergenic
943961062 2:194264646-194264668 GGCTACACACTCCATGGAGCAGG + Intergenic
943984876 2:194605890-194605912 CACTGAACACTTTGTTGAGCTGG - Intergenic
944483693 2:200181957-200181979 GACTGCACGCTCAGTGGAGCTGG + Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
947819248 2:233059230-233059252 GGGGGCACTCTTTGTGCAGCGGG + Intergenic
948213849 2:236214556-236214578 GGCCGCAGGCTTTGTGCAGCGGG + Exonic
1168983537 20:2027435-2027457 GGCTGCACACTCCATGGAGCTGG - Intergenic
1169077326 20:2769243-2769265 GGCTGAACAAATTGTGGATCTGG - Intergenic
1169910158 20:10641648-10641670 CGCTGTGCCCTTTGTGGAGCAGG + Exonic
1171848000 20:30289653-30289675 CCCTTCAAACTTTGTGGAGCAGG + Intergenic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1172676537 20:36676841-36676863 GGCTGCACACGCCATGGAGCTGG + Intronic
1174668648 20:52284731-52284753 GGCTGCACAGTCTCTGGACCTGG + Intergenic
1175194110 20:57230453-57230475 GGCTGCTCACCTTTTGGGGCTGG - Intronic
1175642444 20:60642434-60642456 GGCAGCACAATTTCTGGGGCAGG - Intergenic
1175954967 20:62604561-62604583 GGCTGCAGACCTTGGGGAGGAGG - Intergenic
1176085232 20:63292834-63292856 GGCTGCCCACTGTGGGGAGCAGG - Intergenic
1176104459 20:63379389-63379411 GGCTGTGCGCTCTGTGGAGCTGG + Intergenic
1176808481 21:13515043-13515065 GGCTGCACTCCTTGGTGAGCAGG + Intergenic
1177736101 21:25092477-25092499 GGCTGCACACTCCATGGAGATGG - Intergenic
1178486014 21:33020590-33020612 GGCTGCACACGTTGAAGAGCTGG - Intergenic
1180548905 22:16526734-16526756 GGCTGCACTCCTCGGGGAGCAGG - Intergenic
1181355803 22:22295149-22295171 GGCTGCACTCCTCGGGGAGCAGG + Intergenic
1181463926 22:23100708-23100730 CTCTGCAGACTTTGTGGAGCGGG + Intronic
1184738243 22:46411592-46411614 GGATGCTCACTTCTTGGAGCCGG + Exonic
1184930169 22:47675045-47675067 GGATGCACACTTTGAGGACAGGG + Intergenic
1185072045 22:48661881-48661903 GGGTGCCCACTTTGGGGAGATGG + Intronic
1185072059 22:48661922-48661944 GGGTGCCCACTTTGGGGAGATGG + Intronic
1185072072 22:48661962-48661984 GGGTGCCCACTTTGGGGAGATGG + Intronic
1185072096 22:48662042-48662064 GGGTGCCCACTTTGGGAAGCTGG + Intronic
949623815 3:5846119-5846141 GGCTGCATACTTTGAGGTTCAGG - Intergenic
951509777 3:23487447-23487469 GGCTGCATGCTCTGTGAAGCTGG - Intronic
952015973 3:28958516-28958538 GGCTGTACAAGTTATGGAGCCGG + Intergenic
952054191 3:29424514-29424536 GGCTGGACACATTATGGAGTTGG + Intronic
952269552 3:31817783-31817805 GGCTGCACACTCCATGGAGCTGG - Intronic
952886935 3:38017819-38017841 GGCTGCAGGCTTTGAGGAGTGGG + Intronic
954405263 3:50341844-50341866 GGCTGAACACATGCTGGAGCTGG + Exonic
954595199 3:51818648-51818670 GACTCCAAACTGTGTGGAGCAGG + Intronic
955241625 3:57183117-57183139 TGCTGCACACTCCATGGAGCCGG - Intergenic
955446624 3:59017917-59017939 GGCTGCACTCTGTTTGTAGCTGG - Intronic
956990136 3:74752471-74752493 GGCTACACATTCTGTGGAGTCGG - Intergenic
960634413 3:119768818-119768840 GGCTGCACCCTCCATGGAGCTGG - Intergenic
960690441 3:120341714-120341736 GGCTGCACATTCCATGGAGCTGG + Intronic
961493460 3:127273919-127273941 GGATGCACACTCCATGGAGCCGG + Intergenic
962105350 3:132383397-132383419 AGCTGCACAATTAGTGGAGGGGG + Intergenic
962786093 3:138769138-138769160 GGCTGCATGCTCTGTGGAGCTGG - Intronic
962824689 3:139089260-139089282 GGCTGCACACTCCATGGAGCTGG - Intronic
963069007 3:141287029-141287051 GGCAGCACAGGTTGGGGAGCCGG + Intronic
965118898 3:164524478-164524500 GGCTGCACATTTACTGGAGCTGG - Intergenic
965205314 3:165713729-165713751 GGTTGCACACTCCATGGAGCCGG - Intergenic
965272401 3:166635635-166635657 GGCTGCAAAATATTTGGAGCAGG + Intergenic
965750522 3:171970558-171970580 GACTGCACAGTTTGAGGGGCAGG - Intergenic
965750529 3:171970593-171970615 GACTGCACAGTTTGAGGGGCAGG - Intergenic
965750536 3:171970628-171970650 GACTGCACAGTTTGAGGGGCAGG - Intergenic
965813538 3:172614873-172614895 GGCTGCACACTCCATGGAGCTGG - Intergenic
966491314 3:180531447-180531469 GGCTGCCCACTCCATGGAGCTGG + Intergenic
968659589 4:1793587-1793609 GGCGGCAAACTTTCCGGAGCGGG - Intronic
968980914 4:3848910-3848932 GGCTGCAGGCTGCGTGGAGCTGG - Intergenic
969442454 4:7225572-7225594 TGCTGCTCACTTTGTGGTTCAGG + Intronic
970465198 4:16315504-16315526 AGCTTCACGCTTTGTTGAGCTGG - Intergenic
972931194 4:44072742-44072764 GGCTACACATTCTGTGGAGCTGG - Intergenic
974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG + Intergenic
975689358 4:76949419-76949441 AGCTGCCCGCTTCGTGGAGCCGG + Intergenic
977331480 4:95642471-95642493 GGCTGGATACATTTTGGAGCAGG - Intergenic
978663546 4:111155145-111155167 GGCTGCGCACTCCATGGAGCTGG - Intergenic
978964697 4:114726073-114726095 GGCTGCACACTCCATGGAGCTGG - Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
980844267 4:138305188-138305210 AGCTGCTGACTTTGTGGAGAAGG + Intergenic
980877942 4:138680762-138680784 GGCTGATCATTTTGTGGAGCTGG - Intergenic
981349667 4:143714497-143714519 GCCAGCAGACTTTCTGGAGCTGG - Intergenic
981494545 4:145376748-145376770 AGCTGCTCACATTGTGGGGCAGG - Intergenic
981723163 4:147821607-147821629 GGCTGTGCACGTGGTGGAGCAGG + Intronic
983914937 4:173281836-173281858 GGCTCCACATTCTGTGGAGGAGG - Intronic
984363647 4:178770660-178770682 GGCCGGGCACTTTTTGGAGCTGG + Intergenic
985256720 4:188077223-188077245 GGATGCACTCTTTGTTGATCAGG + Intergenic
985780344 5:1867591-1867613 GGCTGCAGACTTTGTTGACCAGG - Intergenic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
991416430 5:66397512-66397534 GGCTGAAGAGATTGTGGAGCAGG + Intergenic
992029794 5:72709515-72709537 GGCTGTACACTCCATGGAGCTGG - Intergenic
993841914 5:92890538-92890560 GGCTGCAGAGTTTCTGAAGCAGG - Intergenic
998792168 5:145777617-145777639 GGCTGCACACTCCATGAAGCTGG + Intronic
998950968 5:147392833-147392855 GGGAGCACATTTTGTGGACCTGG - Exonic
999217598 5:149948280-149948302 AGCTGCACACTCTTTGGACCTGG - Intergenic
999859818 5:155633459-155633481 GGCCTCCCACTTTGTGGAGTGGG + Intergenic
1000934939 5:167296191-167296213 GGCTTCACATTTTGTGGGTCTGG - Intronic
1002761019 6:202357-202379 GGCTGCACACTTTGTTTACCTGG + Intergenic
1003972247 6:11310818-11310840 GCCTGCTTTCTTTGTGGAGCAGG - Intronic
1004696891 6:18042557-18042579 GGCAGCACACTCCATGGAGCTGG + Intergenic
1005021622 6:21423887-21423909 GGCTGCACACTCCATGGAGCCGG - Intergenic
1006500747 6:34457572-34457594 GGCTGCACACTCCATGGAGCTGG + Intergenic
1007903093 6:45430129-45430151 TGCTGGACACTTTTGGGAGCAGG + Intronic
1010657315 6:78526516-78526538 AGAATCACACTTTGTGGAGCGGG + Intergenic
1012889806 6:104885469-104885491 AGCTGCATGCTTTATGGAGCCGG + Intergenic
1015455806 6:133424870-133424892 GGCTGCACACTCCATGGAGCGGG - Intronic
1015826976 6:137324241-137324263 GTCTGCAGCCTGTGTGGAGCAGG + Intergenic
1016915174 6:149237950-149237972 GGGTGCACACACTGTGGGGCTGG - Intronic
1016957774 6:149643081-149643103 GGCAGCTCACTCTGTGGAGCTGG - Intronic
1016983952 6:149880261-149880283 GGCTGCAGAGTTTCTGAAGCAGG + Intergenic
1017942192 6:159062740-159062762 GGCTACGAACTTTGCGGAGCTGG + Intergenic
1018407985 6:163507673-163507695 GGCTGCACACTTTGTTTCTCAGG - Intronic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1018950863 6:168378031-168378053 GACGGCACACTCTGTGGAGAAGG - Intergenic
1018963649 6:168466700-168466722 AGGTGCACCCTTCGTGGAGCTGG - Intronic
1021561568 7:21972718-21972740 GGCTGCATACTCCATGGAGCCGG - Intergenic
1023618960 7:42050023-42050045 CGCTGTGCACTTAGTGGAGCTGG - Intronic
1023790629 7:43750343-43750365 GGCTGCACACTCCATAGAGCTGG - Intergenic
1024254642 7:47531739-47531761 GGCTGCACTCTCCATGGAGCCGG + Intronic
1025904177 7:65770901-65770923 GGCTGTACAGTTCCTGGAGCTGG + Intergenic
1027128239 7:75572622-75572644 GGCTGCACACTCCATGGAACAGG + Intronic
1029901305 7:104043151-104043173 GGCTGCACATTATGTGCATCAGG + Intergenic
1032607718 7:133374879-133374901 CGCTGCACACTCTGTGGTCCTGG + Exonic
1035308033 7:157945791-157945813 GGAAGCAGACTTTGTGGAGGTGG - Intronic
1035434698 7:158850467-158850489 GGCTGCACACTGCGTGGAGCTGG - Intergenic
1035529215 8:337821-337843 AGCTACACACGTTGGGGAGCAGG + Intergenic
1039298648 8:36185420-36185442 GGATGATCACTTTGTAGAGCAGG - Intergenic
1039727017 8:40229359-40229381 GGCTGCACACTTTGAGCCGAAGG + Intergenic
1040721652 8:50331255-50331277 AGCAGCACACCTTGTGGGGCTGG + Intronic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1042395919 8:68292362-68292384 GGCTGGACACTCCATGGAGCCGG + Intergenic
1043087294 8:75850056-75850078 GGCTGCACACTCTGTGGCACAGG - Intergenic
1044726653 8:95199962-95199984 AGCTGCACACTTGGAGCAGCTGG + Intergenic
1044962200 8:97542478-97542500 GGCTGCACACTCCATGGAGCCGG + Intergenic
1047944771 8:129864594-129864616 GTCTGCACACTTTATTGGGCTGG - Intronic
1047979568 8:130166491-130166513 GGCTGCAGACATTTTGGGGCAGG - Intronic
1048548079 8:135405301-135405323 GGCTGCACACTCCATGGAGCTGG - Intergenic
1049212349 8:141392477-141392499 AGCTGCACAGTTTGGGGGGCTGG + Intronic
1049823849 8:144654605-144654627 GGCTGCACACTCCATGGAGCTGG + Intergenic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050947846 9:11549291-11549313 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1052325520 9:27213412-27213434 GGCTGAAAACTTTGGGGAACAGG - Intronic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1053077909 9:35150730-35150752 GGCTACACACTCCATGGAGCCGG + Intergenic
1053143741 9:35698094-35698116 GGCTGCAGCCTTTGAAGAGCAGG - Exonic
1053614043 9:39745102-39745124 GGCGGCGCACTTTGTGGAGCCGG - Intergenic
1053786140 9:41654302-41654324 CCCTTCAAACTTTGTGGAGCAGG + Intergenic
1054158911 9:61659896-61659918 CCCTTCAAACTTTGTGGAGCAGG - Exonic
1054174856 9:61868247-61868269 CCCTTCAAACTTTGTGGAGCAGG + Intergenic
1054239473 9:62597291-62597313 GGCGGCGCACTTTGTGGAGCCGG + Intergenic
1054260968 9:62864622-62864644 GGCCGCGCGCTTTGTGGAGCCGG - Intergenic
1054449711 9:65397295-65397317 CCCTTCAAACTTTGTGGAGCAGG + Intergenic
1054478685 9:65590901-65590923 CCCTTCAAACTTTGTGGAGCAGG - Intergenic
1054553605 9:66631818-66631840 GGCGGCGCACTTTGTGGAGCCGG + Intergenic
1054662683 9:67712546-67712568 CCCTTCAAACTTTGTGGAGCAGG - Intergenic
1056732514 9:89178241-89178263 GGTGGGACACCTTGTGGAGCAGG + Exonic
1057468378 9:95337029-95337051 GGCTGCATGCTCCGTGGAGCTGG + Intergenic
1057548356 9:96034652-96034674 GGCTGCACACTCCATGAAGCTGG + Intergenic
1057604488 9:96489364-96489386 GGATGCACAGGTTGTGGAGGTGG - Intronic
1059104657 9:111501241-111501263 GGCTGCATCCTCTGTGGAGCTGG + Intergenic
1060524268 9:124311690-124311712 GGCTGCACATTTTTTTGAGAGGG + Intronic
1062329004 9:136028591-136028613 GGCTGCACGCTCCATGGAGCTGG + Intronic
1187319686 X:18228213-18228235 GGCTGCAGACTCTGTTGAACTGG - Intergenic
1187807773 X:23139954-23139976 TGCTCCACACTTTGTGAGGCAGG + Intergenic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1189416136 X:40815428-40815450 GGCTCCACACTTAGTGGAGCTGG + Intergenic
1190445033 X:50515303-50515325 GGCTGCACACTCCCTGGAGCTGG - Intergenic
1195690743 X:107622542-107622564 GGCTCCACAAATTGTGTAGCTGG - Intergenic
1195692480 X:107638680-107638702 GGCTCAGCACTTTGGGGAGCAGG - Intronic
1196883846 X:120224176-120224198 GGCTGCACATTCCATGGAGCTGG - Intergenic
1197342084 X:125287035-125287057 GACTGCACACTCCATGGAGCTGG + Intergenic
1197796152 X:130300107-130300129 GGCTGCCCACTCCATGGAGCAGG - Intergenic
1197951950 X:131907825-131907847 TGCTGCACACTCCGTGGAGCCGG + Intergenic
1199321850 X:146448897-146448919 TGCTGCACATTTTGTGGGACAGG - Intergenic
1199599313 X:149532527-149532549 GGCTGCACGCTGGGTGCAGCAGG - Intronic
1199651318 X:149947678-149947700 GGCTGCACGCTGGGTGCAGCAGG + Intergenic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
1201983210 Y:19930438-19930460 GGCTGCATGCTCTGTGGAGCTGG + Intergenic
1202584002 Y:26405975-26405997 GGCTGCACTCCTCGGGGAGCAGG + Intergenic