ID: 1189084003

View in Genome Browser
Species Human (GRCh38)
Location X:38001092-38001114
Sequence GTCCCTGGTCACAGGCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 23, 3: 101, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189084003 Original CRISPR GTCCCTGGTCACAGGCCCAG GGG Intronic
900469871 1:2848442-2848464 ATCCCTGGTCACTGGCCCCAGGG - Intergenic
900555367 1:3277583-3277605 GTCCCTGGACAACGTCCCAGGGG - Intronic
900695636 1:4008131-4008153 GTCCCTGTTTCCAGCCCCAGTGG + Intergenic
901432335 1:9224614-9224636 CTCCTGGGTCACAGGCCTAGAGG - Intergenic
903285034 1:22271449-22271471 GTCCCTGCTAAGCGGCCCAGTGG + Intergenic
903408948 1:23123699-23123721 CTCCCTGCTCTCAGGCCCTGAGG + Intronic
903542921 1:24107029-24107051 GTCGCAGGTCCCAGGCCCTGGGG + Intronic
903780043 1:25815231-25815253 GTCCGGGGTCACAGGAACAGAGG + Intronic
903831554 1:26178227-26178249 TTCCCTGGCCCCAGGGCCAGTGG + Intronic
904415831 1:30360545-30360567 GGCCCTGGACCCAGGCCCTGGGG + Intergenic
904593403 1:31627847-31627869 CTGTCTGCTCACAGGCCCAGTGG + Intronic
904610961 1:31726079-31726101 GTCCCTGGGAAGGGGCCCAGAGG + Intergenic
905010899 1:34746500-34746522 GGCCCTGGTGACATGGCCAGTGG + Intronic
906215371 1:44035206-44035228 CAGCCTGGTCACAGGCCCTGTGG + Intergenic
906699614 1:47848438-47848460 GACCCTGCTCACAGGCCCACAGG + Intronic
907114324 1:51955685-51955707 GTCCCTGGGGCCAGGCGCAGTGG - Intronic
908070610 1:60455519-60455541 GTCCCTGAGGATAGGCCCAGTGG + Intergenic
910724306 1:90322543-90322565 GTCGCTGACCACAGGCCCACAGG + Intergenic
911512709 1:98827439-98827461 GCCTCTCATCACAGGCCCAGAGG + Intergenic
915016972 1:152743539-152743561 CTCCCTGGACAGAGGCCAAGAGG - Intronic
915219184 1:154360323-154360345 GTCATTGGCCACTGGCCCAGTGG - Intergenic
916284653 1:163093400-163093422 GTCCATGGGCACAGGCCCTGGGG - Intergenic
917406570 1:174713031-174713053 GTCCAATGGCACAGGCCCAGAGG + Intronic
919183812 1:194118456-194118478 GTCCGAGGGCACAGGCCAAGGGG + Intergenic
919539177 1:198827814-198827836 GTCCCTGGGCACAGGACTAGGGG + Intergenic
920699768 1:208209073-208209095 GTCCCTAGTCCCAGGCAGAGTGG + Intronic
921159937 1:212465508-212465530 TTCCCTGGCCTCAGACCCAGGGG + Intergenic
921585086 1:216936922-216936944 TTCCCTGGGCACATACCCAGGGG + Intronic
921890941 1:220353168-220353190 GTCCGTGCCCACAGGCCCGGAGG - Intergenic
922215480 1:223516416-223516438 GAGCCTGGGAACAGGCCCAGGGG - Intergenic
922375870 1:224965103-224965125 GTCCAAGGTCACATGACCAGAGG + Intronic
922730397 1:227946381-227946403 TTCCCTGCTCTCCGGCCCAGCGG - Intronic
923252610 1:232191535-232191557 GTCTGTGGTCACAGGCCTGGGGG - Intergenic
923666375 1:236002093-236002115 GGCCCTGGTCAGTGGCACAGTGG + Intronic
1063445631 10:6113154-6113176 GTTCAAGGTCACGGGCCCAGGGG - Intronic
1063648396 10:7908877-7908899 GTGCCTGGGCCCAGCCCCAGAGG + Intronic
1064361727 10:14671648-14671670 GTCTCTGGTTTCAGGGCCAGTGG - Intronic
1065852976 10:29806013-29806035 GTCCCTGGAAACAGGGGCAGGGG + Intergenic
1066219590 10:33322153-33322175 GTGCTTGTTCTCAGGCCCAGAGG - Intronic
1067508664 10:46877342-46877364 GCCCATGGACACAGGGCCAGCGG - Intergenic
1067653585 10:48174508-48174530 GCCCATGGACACAGGGCCAGCGG + Intronic
1068229881 10:54157542-54157564 CTCTCTCATCACAGGCCCAGAGG - Intronic
1068310341 10:55266479-55266501 GTCCATGGGCACAGGCCCATGGG - Intronic
1070288268 10:75099208-75099230 TTCCCTAGTCACTGGTCCAGGGG - Intronic
1070599197 10:77853933-77853955 GCCCCTGGACAGAGACCCAGAGG + Intronic
1070784625 10:79155822-79155844 CTCCCTGGGCAAAGGCCCAGAGG - Intronic
1071220364 10:83458707-83458729 GTCCGTGGGCACCGGCCCTGGGG - Intergenic
1071598878 10:86946610-86946632 GCCCCAGTTCACAGACCCAGTGG + Intronic
1071600292 10:86955663-86955685 CTCCCTGGTCACAGGAGCAAGGG + Intronic
1072551141 10:96478474-96478496 ACTCCTGGGCACAGGCCCAGTGG + Intronic
1073045277 10:100634142-100634164 GCCCCTGGGCACGGGCACAGTGG + Intergenic
1073112679 10:101071981-101072003 GCCCCTCCTCACAAGCCCAGAGG - Intergenic
1073762775 10:106648760-106648782 GTCCCAGGGCAGGGGCCCAGGGG - Intronic
1073836007 10:107443749-107443771 GTCCGTGGGCACAGGCCCCGGGG - Intergenic
1075572012 10:123552956-123552978 GTCACTGGCCAAAGGCTCAGGGG + Intergenic
1076432931 10:130419739-130419761 GCTCCTGGTCACAGGGCAAGTGG - Intergenic
1076457357 10:130609614-130609636 AGTCCTGGTCACAGGCACAGGGG + Intergenic
1076484265 10:130805772-130805794 GACCCGGGACACAGACCCAGAGG + Intergenic
1076495198 10:130892650-130892672 GTCTCAGGTCACAGGCTCACTGG + Intergenic
1076701519 10:132275613-132275635 GCCCCTGGCCACTGGCCCCGTGG - Intronic
1076724559 10:132407419-132407441 TTCCCTGGCCACCTGCCCAGAGG + Intronic
1077034965 11:490117-490139 GTCCCTTGGCACAGGCACTGTGG + Intronic
1077100178 11:819172-819194 GTCCCTGGACAGAGGCGCACCGG - Intronic
1077118371 11:895671-895693 GGCCCTGGACAGAGGCTCAGGGG - Intronic
1077586762 11:3459707-3459729 GTCCGTGGGCACAGGCCCTGGGG + Intergenic
1078335713 11:10461633-10461655 GTCCCTGTTCACTGTCCCAGAGG + Exonic
1078337729 11:10477112-10477134 ATACCTGGCCACAGGCCAAGAGG + Intronic
1078736413 11:14024730-14024752 GTCCATGGGCACAGGCCCAAGGG + Intronic
1078750210 11:14154418-14154440 GTCTCAGGTCACAGCTCCAGAGG - Intronic
1078823340 11:14905053-14905075 GTCCGGGTGCACAGGCCCAGGGG + Intronic
1079766911 11:24405910-24405932 GTCTCTGGGCACAGGCCCGAGGG - Intergenic
1082013767 11:47469213-47469235 CTCCCTGGTCACAACCCAAGGGG + Intronic
1083388919 11:62333850-62333872 GTCCATGGGCACAGGCCCAGGGG + Intergenic
1083723954 11:64618824-64618846 GTCCCTGGGCCCAGGCCCATGGG + Intronic
1084206130 11:67594172-67594194 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1084640322 11:70421984-70422006 GCCCCTGGTCAAATGGCCAGTGG - Intronic
1084951930 11:72671262-72671284 GTCCCCGGTGACAAGCCAAGTGG + Intronic
1085350257 11:75793629-75793651 GTTCCTGGTTATCGGCCCAGTGG + Intronic
1085887078 11:80533563-80533585 ATCCGTGGGCACAGGCCCAAGGG + Intergenic
1086311447 11:85540171-85540193 GTCCGTGGGCAAAGGCCCAAGGG - Intronic
1087397031 11:97611689-97611711 GTTCATGGGCACAGGCCCAAGGG + Intergenic
1087462009 11:98457096-98457118 GTTCGTGGGCACAGGCCCGGGGG + Intergenic
1087726762 11:101727149-101727171 CTCTCTGTTCACAGGCCCACTGG + Intronic
1088221074 11:107570434-107570456 TTCCCTGGGCACAGGCCTGGGGG + Intergenic
1088507370 11:110539639-110539661 GTCCATGGGCACAGGCCCGAGGG + Intergenic
1089122056 11:116144493-116144515 GTCCATGGGCACAGGCCAGGAGG - Intergenic
1089313814 11:117577153-117577175 CTCTCTGGTCTCTGGCCCAGGGG + Intronic
1090124351 11:124070187-124070209 TTCCATGGGCACAGGTCCAGGGG + Intergenic
1092412998 12:8268440-8268462 GTCCGTGGGAACAGGCCCTGGGG + Intergenic
1092652177 12:10646714-10646736 CCCTCTGATCACAGGCCCAGAGG + Intronic
1092771530 12:11901587-11901609 GGCCATGGTCTCAGGACCAGGGG + Intergenic
1093656035 12:21695030-21695052 GTCCCTGGTCACAAGGCAGGTGG + Intronic
1095873045 12:47051232-47051254 CTCTCTCATCACAGGCCCAGAGG - Intergenic
1096414496 12:51401744-51401766 GTCCCTGGGCACAGGCCTGGGGG + Intronic
1097352438 12:58562977-58562999 GTCCATGGGCACAGGCCGAAGGG + Intronic
1097681112 12:62649962-62649984 GTCCCTTGTAAAAGGCCCACAGG - Intronic
1098697753 12:73581094-73581116 GTCCATGGGCACAGGCCCGAGGG - Intergenic
1099055453 12:77834174-77834196 GTCCATGGGCACAGGCCCAGGGG + Intronic
1101455115 12:104824132-104824154 GTCCATGGGCACAGGCCCGGGGG - Intronic
1101455701 12:104827962-104827984 GTCCATGGGCACAGGCCTGGGGG - Intronic
1101757623 12:107633471-107633493 GTTCATGGTCCCAGTCCCAGGGG + Intronic
1102004134 12:109578042-109578064 GTCTCTGCTCCGAGGCCCAGAGG - Intronic
1102033734 12:109759338-109759360 GTCCCATATCACAGGCCCTGTGG + Intronic
1103224324 12:119274093-119274115 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1103343020 12:120231099-120231121 TGCCCTGATCCCAGGCCCAGCGG + Intronic
1103748325 12:123141438-123141460 GTTGCTGGTGCCAGGCCCAGTGG - Intronic
1103991176 12:124800400-124800422 GTCCCTCATCACAGGGCCTGGGG - Intronic
1104238368 12:126961559-126961581 GTCCATGGTCATAGGCCCCAGGG + Intergenic
1104440711 12:128791222-128791244 ATCACTGACCACAGGCCCAGTGG + Intergenic
1104732509 12:131115669-131115691 GTCTCTGATGACAGGGCCAGAGG + Intronic
1104858116 12:131911326-131911348 GTCCCTGGTCACAGAGCAGGGGG - Intronic
1106016101 13:25870378-25870400 GTCCCTGGACACAGGCCTGGGGG + Intronic
1107106410 13:36648023-36648045 GTTCCTGGTCCATGGCCCAGGGG + Intergenic
1108522207 13:51256624-51256646 GTCCCTCATCACATCCCCAGTGG - Intronic
1109140726 13:58711740-58711762 GTCCATGGGCACAGACCCAGGGG - Intergenic
1109151774 13:58856991-58857013 GTCCATGGGCACAGGCCCAGGGG + Intergenic
1109152502 13:58861270-58861292 GTCCATGGCCACAGGCCCAGGGG + Intergenic
1109172945 13:59118312-59118334 GTCCATGGGCACCGGCCCAGGGG + Intergenic
1110484333 13:76020121-76020143 GTCCCTGAGCACAGGCCTGGGGG + Intergenic
1110964579 13:81676465-81676487 GTCCTTGGGCACAGGCCCAAGGG + Intergenic
1111184799 13:84720118-84720140 GTCCGTGGGCACAGGCTCAAGGG - Intergenic
1111217163 13:85159444-85159466 GTCCGTGGACAGAGGCCCGGGGG - Intergenic
1111343996 13:86924860-86924882 GTCCCTGGGCACAGGCCTGGGGG + Intergenic
1111670147 13:91320098-91320120 ATCCATGGTCCCAGGCACAGAGG - Intergenic
1112058852 13:95716915-95716937 GTCCGTGGGCACAGGCCCAAGGG + Intronic
1112705219 13:102060759-102060781 GTCCATGGGCACAGGCCCGAGGG - Intronic
1112929186 13:104713731-104713753 GTCCATGGACGCAGGCCCAAGGG - Intergenic
1114670213 14:24407000-24407022 TCCCCTGGACACTGGCCCAGTGG + Intronic
1114989797 14:28272582-28272604 GCCTCTCATCACAGGCCCAGAGG - Intergenic
1114996881 14:28365172-28365194 GTCCCTGGGCACAGGCCCAAGGG - Intergenic
1115013002 14:28572968-28572990 GTCCATGGGCACAGACCCAGGGG + Intergenic
1116301163 14:43184974-43184996 GTCCTTGGTCTCATGCCCATAGG - Intergenic
1118487131 14:66224779-66224801 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1119711744 14:76827555-76827577 ATCCCAGGTCAATGGCCCAGAGG + Intronic
1120744631 14:88142536-88142558 GTCCATGGGCACAGGCCCAGAGG - Intergenic
1120855099 14:89205379-89205401 GTCCTTGGGCACAGGCCCAAGGG - Intronic
1121243060 14:92443549-92443571 CTCTCTGGTCACAGTGCCAGGGG - Intronic
1121437990 14:93931541-93931563 GTCCCTGCTCACAGCCCCAGGGG + Intergenic
1121475715 14:94200002-94200024 GTCCGTGGGCACAGGCCCAGGGG + Intronic
1122141211 14:99664134-99664156 GTTCCTGGACAAAAGCCCAGGGG + Intronic
1123106078 14:105841657-105841679 CACCCTGGTCAGAGGCACAGAGG + Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1123721001 15:23061849-23061871 CTCTCTCATCACAGGCCCAGAGG - Intergenic
1123824075 15:24063395-24063417 GTTCATGGGCACAGGCCCAGGGG + Intergenic
1124593804 15:31077438-31077460 GTCCCTGGTGACAGAACAAGAGG - Intronic
1124631496 15:31340081-31340103 GACCCTGGAAACAGGCCTAGAGG - Intronic
1125420362 15:39498686-39498708 GTCCCTCGCAACAGCCCCAGGGG + Intergenic
1125446849 15:39767489-39767511 GTCCATGGGCACAGGCCCAAGGG - Intronic
1125749980 15:42021468-42021490 GTCCCTGGCCACAGCTCCTGGGG - Intronic
1125789396 15:42352150-42352172 GTCCCTGCTCACATCACCAGGGG - Exonic
1126134360 15:45376700-45376722 GTCCTTGGGCAGAGGCTCAGTGG + Exonic
1128372272 15:67049108-67049130 GCCCCTGGTCACATGCTCTGTGG + Intergenic
1128984356 15:72208320-72208342 GTCACTGCTCACAGGACCAGGGG - Intronic
1130051832 15:80490297-80490319 GTCACTGGTCGCAGGCCTTGAGG + Intronic
1130682767 15:86010823-86010845 GTCCGTGGGGACAGGCCCAGGGG + Intergenic
1130866310 15:87935992-87936014 GTCCCTGGGGACAGGGCCACTGG - Intronic
1132849855 16:2020107-2020129 GTCCCTGGCCAGGGGCCCGGCGG - Exonic
1133025664 16:2988021-2988043 GGCCCTGGCGCCAGGCCCAGAGG - Intergenic
1133026998 16:2992875-2992897 GATTCTGGGCACAGGCCCAGAGG + Intergenic
1133166945 16:3954559-3954581 GACCCTACTCACTGGCCCAGAGG - Intronic
1133246254 16:4450798-4450820 GTCCGAGGTCACAGGGCAAGTGG - Intronic
1133354199 16:5123945-5123967 GTCCGTGGGCAAAGGCCCTGGGG + Intergenic
1134682871 16:16138653-16138675 ATCCCTAGTGACAGCCCCAGTGG + Intronic
1136084694 16:27876588-27876610 GGCACTGGTACCAGGCCCAGGGG + Intronic
1138219977 16:55242229-55242251 GTCTGTGGGCACAGGCCCAAGGG - Intergenic
1139017802 16:62711392-62711414 GTCCGTGGGCACAAGCCCTGAGG - Intergenic
1139064077 16:63291294-63291316 GTCCGTGGGCACAGGCCCAGGGG - Intergenic
1139154590 16:64425134-64425156 GTTCCTGGTCACACAGCCAGTGG + Intergenic
1141687181 16:85577159-85577181 GTCCCTGGGCACCCGGCCAGGGG + Intergenic
1141712548 16:85708337-85708359 TTCCCTGCTCCCAGGACCAGTGG - Intronic
1141767304 16:86067090-86067112 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
1142007897 16:87698788-87698810 GTCCCTCCGCCCAGGCCCAGGGG + Intronic
1142725470 17:1810618-1810640 GTCAGTGGACACAGGCCCAAGGG - Intronic
1143022214 17:3922775-3922797 GGCCCTGCCCACAGGGCCAGAGG - Intergenic
1143465608 17:7134269-7134291 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
1144331514 17:14228321-14228343 GTCCATGGTCACAGGGCATGTGG + Intergenic
1144657096 17:17043523-17043545 TTCCCTGGTCACTGGCCGAGGGG + Intronic
1144695954 17:17303878-17303900 GTCCAAGGTCACCGGCGCAGGGG - Intronic
1145205271 17:20981489-20981511 AGCCCTGCTCACAGGCCCTGTGG - Intergenic
1145977483 17:28992745-28992767 GCCCCTGGTCACAGCCTCATGGG - Intronic
1146696046 17:34909730-34909752 GCCCCTGGTCCCACACCCAGTGG + Intergenic
1147189710 17:38731306-38731328 TTCCCTGGCCACAGGCCCAGTGG + Exonic
1147921599 17:43920636-43920658 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1148055740 17:44794261-44794283 GTCTCTGGTCCCAGACCCTGCGG + Intergenic
1148129402 17:45254071-45254093 ATCCCTGGCCTCAGGCCAAGAGG + Intergenic
1148437616 17:47695463-47695485 GTCCCAGGTCAGGGGCCAAGGGG + Exonic
1148521746 17:48283432-48283454 GCCCCAGGTCACAGACCAAGAGG - Intronic
1148684617 17:49494783-49494805 ATCCCTGGGCAGAGGCCTAGGGG - Intergenic
1148767577 17:50048120-50048142 GTCCAAGGTCACAGTCCCACTGG + Intergenic
1149623024 17:58060351-58060373 GATCCTGGCCACAGACCCAGAGG + Intergenic
1150489326 17:65563544-65563566 GTCCCTTGTCACAGTCCCTTAGG - Intronic
1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG + Intronic
1151402402 17:73864397-73864419 GCCTCTGGAAACAGGCCCAGGGG + Intergenic
1151697105 17:75723329-75723351 GTCCCTGGCCACAGCCCCTCAGG - Intronic
1152457664 17:80425478-80425500 CTTCCTTGTCACAGGCCCTGAGG + Exonic
1152549526 17:81022613-81022635 GTCCTTGGGCACTGGCCCATTGG - Intergenic
1152685414 17:81691406-81691428 GGGCCTGGTCACAGGCACTGGGG - Intronic
1152748967 17:82053802-82053824 GACCCTGGCCCCAGGCCCTGAGG - Intronic
1152984888 18:312377-312399 GGCCCTGGCCACAGGAACAGAGG + Intergenic
1155791152 18:29972017-29972039 GTTCCTGGGCACAAGCCCAGCGG + Intergenic
1156439332 18:37167805-37167827 GTCTGTGGGCACAGGCCCAATGG + Intronic
1157200969 18:45659215-45659237 GTCCCTGGGCTCAGGCCCTCTGG + Intronic
1157484903 18:48079905-48079927 GTCCCTGGGCACTTGCCCACTGG - Intronic
1158591911 18:58785148-58785170 GCCACTGCTCACTGGCCCAGAGG + Intergenic
1159416191 18:68152400-68152422 GTCCGTGGGCACAAGCCCAGGGG - Intergenic
1159721733 18:71899343-71899365 GTACATGGGCACAGGCCCGGGGG + Intergenic
1160824190 19:1071712-1071734 GTCCGGGGTCTCAGGCCCGGCGG + Intronic
1160987455 19:1845765-1845787 GCCCTGGGTCACAGGCTCAGCGG - Intronic
1164830800 19:31319026-31319048 GTCCCTGGTCTCCGGCTCAGAGG - Intronic
1164934880 19:32202480-32202502 CTCCCAGGTCATAGCCCCAGCGG - Intergenic
1165139148 19:33688754-33688776 GTCCCTGGTACCCGGCCCGGTGG - Intronic
1165893066 19:39126238-39126260 GTCAGAGGTCACAGCCCCAGGGG + Intronic
1166621679 19:44306619-44306641 GTCCGTGGCCACAGGCCTGGGGG + Intergenic
1168081618 19:54014362-54014384 GTCCATGGGCACAGGCCCTAGGG + Intergenic
1168644599 19:58052021-58052043 GTCCTTGCCCACAAGCCCAGAGG - Intronic
925013639 2:504844-504866 ATCCCTGGTGACAATCCCAGAGG - Intergenic
925034091 2:672776-672798 GGACCTGGTCACAGGCCCGGGGG + Intronic
925049230 2:798221-798243 GTCCATGGACACAGGCCCGAGGG + Intergenic
925092452 2:1166654-1166676 GTCCATGGGCACAGGCCTGGGGG - Intronic
925839747 2:7980198-7980220 GTCAATGGGCACAGGCCCAGGGG - Intergenic
926108236 2:10165849-10165871 GTCCCTGTGCACATGCCCCGTGG + Intronic
926215053 2:10901209-10901231 TTCCCAGATCTCAGGCCCAGAGG + Intergenic
926309595 2:11665964-11665986 GTCCATGGTCACAGCCTCTGAGG + Intronic
926961759 2:18365018-18365040 GTCTATGGGCACAGGCCCGGGGG + Intergenic
927153153 2:20207069-20207091 GGCCCTGGCCACAGGCCCACGGG + Intronic
928537987 2:32258451-32258473 GTCCGTGGGCACAGGCCTGGGGG + Intronic
929816965 2:45240184-45240206 GTCCCTGGTCACATTCGCAGGGG - Intergenic
930537852 2:52666437-52666459 CTCCCTCATCACAGGCCCAGAGG - Intergenic
930962446 2:57277498-57277520 TTCCCTCATCACAGTCCCAGAGG + Intergenic
931034804 2:58227763-58227785 GTCAGTGGGCACAGGCCCGGGGG + Intronic
931812755 2:65870590-65870612 AGCCCTGGTAACAGGCCCAGAGG + Intergenic
932576465 2:72964967-72964989 GTCCGTGGGCACAGGCCTGGGGG - Intronic
933141480 2:78796013-78796035 GTCCTTGAGCACAGGCCCAAGGG + Intergenic
933187063 2:79290411-79290433 GTCCGTGGGCACAGGGCCGGAGG - Intronic
933802611 2:85975143-85975165 GTCCAAGGTCACAGGGCCAGAGG - Intergenic
935297869 2:101666123-101666145 GTTCGTGGGCACAGGCCCGGGGG + Intergenic
935507336 2:103921741-103921763 GTCGCTGCTCTCAGGCTCAGGGG + Intergenic
936150919 2:110022060-110022082 GTCCCTGGTCATAGGGTCAAGGG - Intergenic
936163531 2:110102092-110102114 ATCCCTGGACTCAGGCTCAGGGG + Intronic
936193757 2:110349309-110349331 GTCCCTGGTCATAGGGTCAAGGG + Intergenic
936346271 2:111677666-111677688 GTCCATGGGGACAGGCCCATAGG - Intergenic
936864009 2:117056273-117056295 GTCCGTGGGCACAGGCCCGAGGG + Intergenic
937225418 2:120366145-120366167 GTCACAGGTCACAGGGGCAGCGG + Intergenic
937289325 2:120772578-120772600 GGGCCTGGCCATAGGCCCAGAGG + Intronic
937743761 2:125386782-125386804 GTCCGTGGGCACAGACCCAAGGG + Intergenic
937901798 2:127025329-127025351 GGCCTGGGTCCCAGGCCCAGGGG - Intergenic
937921995 2:127137405-127137427 GTCCCAGGGGACAGGCCCGGGGG + Intergenic
939436143 2:142180697-142180719 GTCCCTGGGCACAGGTCCCCGGG - Intergenic
939778378 2:146413447-146413469 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
940404756 2:153287875-153287897 GTCCGTGGGCACAGGCCCGAGGG + Intergenic
942401676 2:175609629-175609651 GTCTCTGGACAGAGGCTCAGGGG + Intergenic
943838972 2:192552863-192552885 GTCCGTGGGCACAGACCCAAGGG + Intergenic
945858728 2:215096342-215096364 TACCCTGATCAAAGGCCCAGGGG + Intronic
946158239 2:217820804-217820826 GTCCCTGCTGACAGGCTTAGTGG - Intronic
947525489 2:230874561-230874583 GTCCCAGGGCACAGACCCAGGGG - Intronic
948051522 2:234982685-234982707 TTCCCTAGTCACAGGGGCAGTGG + Intronic
948159768 2:235814185-235814207 GTCTGTGGGCACAGGCCCAAGGG + Intronic
948184949 2:236013785-236013807 GCCCCAGGTCACAGGGCTAGAGG - Intronic
948300763 2:236905259-236905281 GCCCCTGGGGACAGGCACAGTGG + Intergenic
948496201 2:238351430-238351452 GCCTCTTGTCACGGGCCCAGAGG - Intronic
948525281 2:238567409-238567431 GTCCGTGGGCACAGGCCCGGGGG - Intergenic
948787392 2:240359580-240359602 GTCCCTTGTGCCAGGCCCGGAGG - Intergenic
948826182 2:240574382-240574404 GGCCCTGGGCACTGGTCCAGGGG + Intronic
1168823277 20:791683-791705 GTCTGTGGGCACAGGCCCAAGGG - Intergenic
1169120548 20:3093165-3093187 GCCCCAGGCCCCAGGCCCAGCGG + Intergenic
1169902018 20:10562623-10562645 GTCTGTGGGCACAGGCCCAAGGG + Intronic
1170301379 20:14887983-14888005 GTGACTGGTCCCAGGCTCAGAGG - Intronic
1170486037 20:16817033-16817055 GTCCATGGGCACAGGCCCGGGGG + Intergenic
1172457894 20:35092404-35092426 GTCCCTTGTCAGGGGCCGAGCGG - Intronic
1174085328 20:48004070-48004092 GACCTGGGTCACAGGCCCACCGG + Intergenic
1174092102 20:48057682-48057704 GTCCTTGGTCAAAGGTCCTGAGG + Intergenic
1174432346 20:50479414-50479436 GTCCGTGGGCACAGGCCCAGGGG + Intergenic
1176252213 20:64130880-64130902 TTCTCTGTTCTCAGGCCCAGGGG - Intergenic
1176719524 21:10381679-10381701 GTCTCTGTGCACAGGGCCAGAGG + Intergenic
1178195875 21:30344634-30344656 GTCCGTGGGCACAGGCCCAGGGG + Intergenic
1178422417 21:32453022-32453044 GTCCATGGGCACAAGCCCATGGG + Intronic
1178438609 21:32580974-32580996 GTCCATGGGCACAGGCCCAGGGG - Intronic
1179370399 21:40801523-40801545 CTCTCTCATCACAGGCCCAGAGG + Intronic
1179959853 21:44762091-44762113 GTCCCTGTTTGCAGGCCCATTGG + Intergenic
1180172488 21:46067054-46067076 GGCCCAGGACACAGGGCCAGAGG + Intergenic
1180300757 22:11034653-11034675 GTCTCTGTGCACAGGGCCAGAGG + Intergenic
1180919657 22:19514911-19514933 GCGCCTGGTCACAGCACCAGTGG + Intronic
1181325077 22:22038689-22038711 GTGACTAGACACAGGCCCAGGGG + Intergenic
1181455080 22:23054584-23054606 ATCCTTGGTCCCAGGCCCATGGG - Intergenic
1183383190 22:37500700-37500722 GTCCCAAGTCACAGGCCCCTCGG - Intronic
1183743997 22:39683176-39683198 GGCTCTGGGCACAGGGCCAGGGG + Intronic
1184075461 22:42174475-42174497 GTCCCTGAACACAGCCTCAGTGG + Intronic
1184089160 22:42283441-42283463 GCCCCGGGTCACAGTCCCAGGGG - Intronic
1184646477 22:45898002-45898024 CTGCCTGGTCCCTGGCCCAGGGG + Intergenic
1185014747 22:48336272-48336294 GTCCCCGGGCACAGCCACAGTGG + Intergenic
1185078093 22:48694033-48694055 GTCCCTGCCCACAGGCCACGCGG + Intronic
1185127129 22:49017542-49017564 GTCCCTGGGCACAGGCCCTGGGG + Intergenic
1185282551 22:49981088-49981110 GACCCTGGTCTTAGGACCAGGGG - Intergenic
1185344187 22:50304250-50304272 GTGACTGGCCCCAGGCCCAGTGG - Intronic
950013985 3:9743465-9743487 GTTCCTGGTGAGAAGCCCAGGGG + Intronic
950148728 3:10669676-10669698 GTCTCTGGGCACAGTCCCTGAGG - Intronic
950497307 3:13341462-13341484 GTGCCTGGTCACATGGCAAGGGG - Intronic
950902657 3:16512202-16512224 GGCCCTACCCACAGGCCCAGAGG + Intronic
951237314 3:20250910-20250932 CTCTCTCATCACAGGCCCAGAGG - Intergenic
951299265 3:20974479-20974501 GTCCCTGGTGAAATGACCAGAGG + Intergenic
951549327 3:23861467-23861489 GTCTGTGGGCACAGGCCCGGGGG - Intronic
951704877 3:25534468-25534490 GTCACTGCTCACAAGCCCTGTGG + Intronic
951993371 3:28700696-28700718 GTCCCTGCTGACAGGATCAGTGG - Intergenic
952003040 3:28808904-28808926 GTCCGTGGACACAGGCCCAAGGG + Intergenic
953786842 3:45917386-45917408 GAGCCTGGACAGAGGCCCAGAGG - Intergenic
954680925 3:52345553-52345575 GTCCCTGCTCACACGGCCAGAGG + Exonic
954712609 3:52512557-52512579 GTCTGAGGTCACAGGACCAGGGG - Intronic
955511521 3:59685572-59685594 TTCCCTAGTGACAGGCGCAGTGG - Intergenic
956121628 3:65971802-65971824 GTCCTTGGTCACTGGTACAGAGG - Intronic
956295117 3:67703999-67704021 GCCCCTCGTCAGAAGCCCAGAGG - Intergenic
956390778 3:68770816-68770838 GTCCATGGGCACAGGCCCGAGGG - Intronic
956982395 3:74654249-74654271 GTCCATGGACATAGGCCCAAAGG - Intergenic
957058106 3:75459633-75459655 GTCCTTGGGCACAGGCCCTGGGG + Intergenic
959583374 3:108004084-108004106 GTCCACGGGCACAGGCCCAAGGG - Intergenic
960986797 3:123286203-123286225 GGCCCTGGCCACAGACTCAGAGG - Intronic
962095182 3:132285535-132285557 GTCCGTGGGCACAGGCCTGGGGG + Intergenic
963239926 3:142992705-142992727 GTCCATGGGCACAGGCCCGGGGG + Intronic
963934455 3:151037928-151037950 GAGGCTGGCCACAGGCCCAGTGG + Intergenic
966914005 3:184575111-184575133 GCCCCTGGACACAGGCTCTGTGG - Intronic
967269384 3:187720250-187720272 GGTTCTGGTCACTGGCCCAGAGG - Intronic
968921411 4:3523993-3524015 GTGCCTGGGGTCAGGCCCAGGGG + Intronic
969001944 4:3989506-3989528 GTCCATGGGCACAGGCCCTGTGG + Intergenic
969448514 4:7259527-7259549 GTCCCTGACGTCAGGCCCAGGGG + Intronic
969633192 4:8350516-8350538 GTCCCTGGTCAGGGGAACAGAGG + Intergenic
969752060 4:9119027-9119049 GTCCGTGGGCACAGGCCCTGGGG - Intergenic
969811974 4:9655302-9655324 GTCCGTGGGCACAGGCCCTGGGG - Intergenic
970054709 4:11957585-11957607 GTTCCTGGGCACAGGCCCCGGGG + Intergenic
970190290 4:13509663-13509685 GCCCCTCATCACAGGCCCTGAGG + Intergenic
971197284 4:24481500-24481522 GTCTCTTGTCACAGTCCCAGAGG + Intergenic
971831447 4:31701325-31701347 GTCCATGCGCACAGGCCCGGGGG - Intergenic
972013169 4:34209605-34209627 GTCTGTGGTCAAAGGCCCAAGGG - Intergenic
972394708 4:38649054-38649076 GTCCGTGGGCACAGGCTCACGGG - Intergenic
973656661 4:53055298-53055320 GTCACTGATCACAGTCCCACTGG - Intronic
973936365 4:55850580-55850602 GTCCATGGGCACAGGCCCAGTGG + Intergenic
974250690 4:59379045-59379067 GTCCCTGGGCAGAGGCCTGGGGG + Intergenic
977045242 4:92061115-92061137 GTCCATGGGCACAAGCCCAAGGG + Intergenic
977766673 4:100806345-100806367 GTCCATGGGCACAGGCCCGGTGG + Intronic
978414714 4:108463409-108463431 GTCCATGGGCACAGGCCCAAGGG - Intergenic
979448353 4:120840264-120840286 GTCCCTGAGCACAGGGCCAATGG - Intronic
980286312 4:130782790-130782812 GTCCGTGGACACAGGCCCAGGGG - Intergenic
980734437 4:136867103-136867125 GTCCGTGGGCACAGGCCCGAGGG - Intergenic
980900190 4:138897504-138897526 GTCCCTTTTCACAGGACCTGTGG + Intergenic
982325617 4:154125946-154125968 GTCCCTGGACCCCAGCCCAGGGG + Intergenic
982504110 4:156196658-156196680 ATCCGTGGGCACAGGCCCAAGGG - Intergenic
982618943 4:157678729-157678751 CCCTCTGATCACAGGCCCAGAGG - Intergenic
983146015 4:164215520-164215542 GTCTGTGGGCACAGGCCCAGGGG + Intronic
984081190 4:175252193-175252215 GTCCATGGGCACAAGCCCCGGGG - Intergenic
984097179 4:175447877-175447899 GTCCATGGGCACAGGCCCGGGGG - Intergenic
984289931 4:177782063-177782085 GTCCATAGGCACAGGCCCAAGGG + Intronic
986364812 5:7019622-7019644 GTCCATGGGCACAGGCCTAGAGG + Intergenic
987023360 5:13898024-13898046 GTGCCTGTTCACAGTCCCACTGG + Intronic
987267455 5:16271881-16271903 GTCCCTGTTCTCAGTCCCAGTGG - Intergenic
987524515 5:19030397-19030419 GTCCCTGGGCACAGTCCCGAAGG + Intergenic
988038160 5:25853799-25853821 GTCCCTGGGCACAGGCCAGGAGG + Intergenic
988331767 5:29850424-29850446 GTCCGTGGGCACAGGCCCAAGGG + Intergenic
989132827 5:38124517-38124539 CTCTCTCATCACAGGCCCAGAGG - Intergenic
989491386 5:42059951-42059973 GTCTGTGGGCACAGGCCCAAGGG - Intergenic
989498535 5:42138333-42138355 GTCCTTGGGCACAGGCCCAAGGG + Intergenic
990129611 5:52564922-52564944 GTCCCTGCTCACAGCCACAGTGG - Intergenic
990638055 5:57751066-57751088 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
990792419 5:59496413-59496435 GTCCGTGGGCACAGGCCTGGGGG + Intronic
991937661 5:71817832-71817854 GTTCTGGGTCACAGCCCCAGGGG - Intergenic
992042333 5:72848319-72848341 CTCCCGGTGCACAGGCCCAGAGG - Intronic
992210876 5:74478456-74478478 GTCTGTGGGCACAGGCCCAAGGG + Intergenic
992337654 5:75789428-75789450 GCCTCCTGTCACAGGCCCAGAGG + Intergenic
993416456 5:87639251-87639273 GTCCAGGGGCATAGGCCCAGGGG + Intergenic
994661593 5:102660921-102660943 GTCCGTGGGTACAGGCCCGGGGG - Intergenic
995978953 5:118078505-118078527 TTCCGTGGGTACAGGCCCAGGGG - Intergenic
996027050 5:118657821-118657843 CTCTCTTATCACAGGCCCAGAGG - Intergenic
996566107 5:124881024-124881046 GTCCCTGGGCACAGGGCTGGGGG + Intergenic
996937490 5:128965491-128965513 GTCCGTGGCCTCAGGGCCAGCGG - Exonic
997293301 5:132753213-132753235 CTCCCTGGCTTCAGGCCCAGAGG - Exonic
997456128 5:134018828-134018850 CTCCCTGGTCAAATGCCCACAGG - Intergenic
997639128 5:135437190-135437212 GTCCCTGGGCCCCTGCCCAGTGG + Intergenic
1000332233 5:160214948-160214970 GTCCCTGGTCACCATCTCAGAGG + Intronic
1000516510 5:162241588-162241610 GTCCGTGGGCACAGGCGCAAAGG + Intergenic
1000532770 5:162444444-162444466 GTCCATAGGCACAGGCCCAGGGG - Intergenic
1001181096 5:169521596-169521618 GTCCCTGGGCACAGGCCTGGAGG - Intergenic
1001657638 5:173364430-173364452 GTCCCTGTTGACAAGCTCAGTGG - Intergenic
1002048125 5:176553399-176553421 GTCCCTCCTCCCAGTCCCAGAGG - Intronic
1002107923 5:176889287-176889309 GTCCCTGTTCTCAGGCCCTTAGG - Intronic
1002466254 5:179410344-179410366 TTCCCTGTTCCCACGCCCAGAGG + Intergenic
1003160542 6:3630461-3630483 GTCCCTGGTTAATGGCCCTGGGG - Intergenic
1003499839 6:6695145-6695167 GTCTGTGGGCACAGGCCCGGGGG + Intergenic
1003533446 6:6956276-6956298 GTCCATGGGCACAGGCCCAGGGG + Intergenic
1003809964 6:9768314-9768336 GTCCATGGGCACAGGCCTGGGGG + Intronic
1004078137 6:12364121-12364143 GTGCCTGGTGAAAGGCCAAGTGG + Intergenic
1005461139 6:26071302-26071324 GTCCCTGGGCACAGGCCTGGGGG - Intergenic
1005532576 6:26722543-26722565 ATCCATGGGCACAGGCCCGGCGG - Intergenic
1005535832 6:26755060-26755082 GTTCATGGGCACAGGCCCGGGGG + Intergenic
1005538219 6:26779122-26779144 ATCCATGGGCACAGGCCCGGCGG + Intergenic
1005561981 6:27050020-27050042 GTCTGTGGGCACAGGCCCGGGGG - Intergenic
1005638984 6:27776781-27776803 GTACCGGGTCAGTGGCCCAGGGG + Intergenic
1006208859 6:32375679-32375701 GTCTGTGGGCACAGGCCCAGGGG - Intergenic
1006314242 6:33280658-33280680 GTCCCTGGTGAGTGGGCCAGGGG - Exonic
1006438837 6:34040925-34040947 GTGCCTGGAGACAGGCCCATGGG + Intronic
1007119346 6:39367312-39367334 GTCCCTGGCCAGAGTCCCCGTGG - Intronic
1007307513 6:40918557-40918579 GTCCATGGGCACAGGACCAGGGG - Intergenic
1007379992 6:41483077-41483099 GCCCCTACTCAGAGGCCCAGAGG + Intergenic
1007605345 6:43113993-43114015 GTCCCCGGCCACAGGCCCCGGGG - Intronic
1007701252 6:43767855-43767877 ATCCCTGGGCAAAGCCCCAGAGG + Intergenic
1007737227 6:43989484-43989506 GCCCCTCTTCACAGGACCAGTGG + Intergenic
1008727727 6:54442056-54442078 GTCCATGGGCACAGGCCTAGGGG + Intergenic
1009006856 6:57798709-57798731 GTCCATGGGCACAGGCCCGGCGG + Intergenic
1009009069 6:57821472-57821494 GTCCATGGGCACAGGCCCGGCGG + Intergenic
1009582075 6:65549155-65549177 GGCACTGGTCCCTGGCCCAGGGG + Intronic
1009725200 6:67529592-67529614 GTCCATGGGCATAGGCCCAAGGG + Intergenic
1010014295 6:71086499-71086521 GTCCGTGGGCACAGGCCCGAGGG - Intergenic
1010028440 6:71246054-71246076 GTCCATGGGCACAGGCCCGAGGG + Intergenic
1010360405 6:74986957-74986979 GTCTCCCATCACAGGCCCAGAGG + Intergenic
1010504055 6:76634135-76634157 GTCTGTGGGCACAGGCCCCGGGG + Intergenic
1011801551 6:91021827-91021849 GTCCATGGGCACAGGCTCAGGGG - Intergenic
1011873582 6:91927229-91927251 GTCCGTGGGCACAGGCCCAGGGG + Intergenic
1012724901 6:102798739-102798761 GTCCCTGGGCACAGGCCCGAGGG - Intergenic
1013088415 6:106876143-106876165 CTCTCCCGTCACAGGCCCAGAGG - Intergenic
1014090823 6:117401957-117401979 GACCCAGGTGAGAGGCCCAGGGG - Intronic
1014100947 6:117511067-117511089 GGCCCTGCTCAAATGCCCAGAGG + Intronic
1015729548 6:136334391-136334413 GTCCATGGGCACAGGCCCAGGGG - Intergenic
1016020939 6:139235694-139235716 GTCCCTGGGCACAGGCTCGAGGG - Intergenic
1016728378 6:147401182-147401204 CTCTCTCATCACAGGCCCAGAGG - Intergenic
1017980081 6:159393860-159393882 GTTTGTGGGCACAGGCCCAGTGG - Intergenic
1018392253 6:163349591-163349613 CTCCCTGGACATAGGACCAGAGG - Intergenic
1018794472 6:167175136-167175158 GTCCCTGGGCACAGGCCCGGGGG + Intronic
1018821847 6:167379931-167379953 GTCCCTGGGCACAGGCCTGGGGG - Intronic
1019447283 7:1077942-1077964 GTCCCCGCACACACGCCCAGCGG - Intronic
1019485954 7:1289243-1289265 GGCCCTGGTCACCGGCGCATGGG + Intergenic
1019506336 7:1393360-1393382 GGCCCTGGTCCCTGGCTCAGAGG - Intergenic
1020537910 7:9424524-9424546 CTCTCTCATCACAGGCCCAGAGG - Intergenic
1021820759 7:24495244-24495266 GTCCGTGGGCACAGGCCCACGGG + Intergenic
1022114781 7:27252057-27252079 GACGCTGCTCACAGGCCCAAGGG - Intergenic
1022497445 7:30861932-30861954 GTCCCTCCTCACACCCCCAGTGG - Intronic
1022805957 7:33823000-33823022 CTCCCTGACCACAGGCCTAGTGG + Intergenic
1024643924 7:51355743-51355765 GTCCATGGGCACAGGCCCGGGGG + Intergenic
1025928130 7:65975170-65975192 ATCTCTGCTTACAGGCCCAGAGG - Intronic
1026270040 7:68828687-68828709 GTTCCTGGTCACAGTCACTGTGG - Intergenic
1026313868 7:69211368-69211390 GTCTGTGGGCACAGGCCCAAGGG - Intergenic
1026557840 7:71423199-71423221 GTCCGTGGGCACAGGCCCGAGGG + Intronic
1026845859 7:73698877-73698899 TTCCCTGAGAACAGGCCCAGAGG - Intronic
1026990319 7:74581431-74581453 GGCCAGGGTCACAAGCCCAGTGG - Intronic
1027669534 7:81078359-81078381 GTCCGAGGGCACAGGCCCAAGGG + Intergenic
1028134552 7:87211687-87211709 ATCCCTGGACACAGGGCCTGAGG - Intronic
1029033157 7:97490298-97490320 GTCTGTGGGCGCAGGCCCAGGGG - Intergenic
1029374229 7:100168316-100168338 CTCCCTGATCACAGCCCCTGGGG + Intronic
1029420434 7:100469250-100469272 GACCCAGGTCCCAGGCCCATAGG - Intronic
1029611675 7:101629906-101629928 GTCCGTGGGCACAGGCCCAAGGG + Intergenic
1031122158 7:117734114-117734136 GTCTCAGGTCCCAGGTCCAGGGG - Intronic
1031765587 7:125773062-125773084 GCCCCTGAGCACAGGCCCGGGGG - Intergenic
1031778970 7:125939156-125939178 ATCTCTCATCACAGGCCCAGAGG + Intergenic
1031926317 7:127642146-127642168 GTCTCTATTCACAGGCCCTGGGG + Intergenic
1032488479 7:132306118-132306140 GGCCTTGCTCACAGGGCCAGAGG + Intronic
1033128631 7:138726453-138726475 GGCCCTGGTGACATGCCCCGTGG - Intronic
1033896224 7:146073966-146073988 GTCCTTGGTCACAGGCCCTAGGG - Intergenic
1034265967 7:149780794-149780816 GTGCCTGGGCACAGTGCCAGCGG - Intergenic
1034429650 7:151034823-151034845 CTCCCAGGTCAGTGGCCCAGTGG + Exonic
1036375279 8:8194433-8194455 GTCCGTGGACACAGGCCCTGGGG - Intergenic
1036854260 8:12228715-12228737 GTCCGTGGACACAGGCCCTGGGG + Intergenic
1036875622 8:12471215-12471237 GTCTGTGGACACAGGCCCTGGGG + Intergenic
1037138933 8:15496617-15496639 GACCCTAGATACAGGCCCAGTGG + Intronic
1037226726 8:16601917-16601939 GTCCATGGGCACAGGCCCGAAGG - Intergenic
1038248528 8:25881640-25881662 GTCCATGGGCACAGGCCAAGGGG - Intronic
1038862318 8:31401268-31401290 GTTCATGGGCACAGGCCCAGGGG - Intergenic
1040602422 8:48897674-48897696 GTCCATGGGGACAGGCCCAAGGG + Intergenic
1040652459 8:49464774-49464796 GTCCATGGACACCGGCCCAGGGG - Intergenic
1041556398 8:59161265-59161287 GGCCCTGGTCACAGCCTCTGAGG + Intergenic
1041586204 8:59523174-59523196 GTCTGTGGGCACAGGTCCAGGGG - Intergenic
1041934647 8:63322106-63322128 GTCTGTGGGCACAGGCCCAGGGG - Intergenic
1044206151 8:89494033-89494055 GTCCATGGGCACAGGCCCAAGGG - Intergenic
1044613381 8:94116152-94116174 GTTCCAGGTCACAGTCCGAGTGG + Intergenic
1044765746 8:95572297-95572319 GTCCATGGGCACAGGCCCGAGGG - Intergenic
1045942443 8:107755064-107755086 GTCCATGGGCACAGGCCCGGGGG - Intergenic
1046138855 8:110063730-110063752 GTCCATAGGCACAGGCGCAGGGG - Intergenic
1046260835 8:111765706-111765728 GTCCCTGGGCACAGGCCCCAGGG - Intergenic
1047308886 8:123676051-123676073 GTCCCTGGTCCCAGTCACACTGG + Intergenic
1047586469 8:126279370-126279392 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1049332901 8:142064680-142064702 GTGCCTGGTCACAGTTTCAGCGG + Intergenic
1049562168 8:143317319-143317341 GGCCGTGGACAGAGGCCCAGAGG + Intronic
1049578123 8:143398816-143398838 GACCCTCCCCACAGGCCCAGAGG - Intergenic
1049615279 8:143573161-143573183 GCCCCTAGCCCCAGGCCCAGTGG - Intergenic
1050202221 9:3157384-3157406 GTGCATGGGCACAGGCCCAGTGG + Intergenic
1050255418 9:3787851-3787873 GTCTCCCATCACAGGCCCAGAGG - Intergenic
1051103634 9:13551263-13551285 GTCCATGAGCACAGGCCCAGGGG + Intergenic
1052370076 9:27654792-27654814 GTCCGTGGGCACAGGCCCAGGGG - Intergenic
1052566581 9:30160824-30160846 GTCCATGGGCACAGGCCAGGGGG + Intergenic
1053125819 9:35580233-35580255 CTCTCTCATCACAGGCCCAGAGG + Intergenic
1054927663 9:70604432-70604454 GTTCCTGCTCACAGCCCCTGAGG - Intronic
1055054439 9:72010862-72010884 GTCCATGGGCACAGGCCTGGGGG + Intergenic
1055474998 9:76653999-76654021 GGCCCTGGTTCCAGGCACAGAGG + Intronic
1055554653 9:77462330-77462352 TGCTGTGGTCACAGGCCCAGTGG + Intronic
1056327294 9:85490603-85490625 GTCCGTGGGCACAGGCCCAAGGG - Intergenic
1056573313 9:87834889-87834911 GTCCGTGGGCACAGGCCCGGGGG + Intergenic
1057031013 9:91775326-91775348 GGCTCTGACCACAGGCCCAGGGG + Intronic
1057135277 9:92683012-92683034 GTCCCTGCTGACAGCCACAGAGG - Intergenic
1057725917 9:97568076-97568098 TGCCCTGGTCACTTGCCCAGTGG + Intronic
1057803144 9:98202013-98202035 GACACTGGTCTCATGCCCAGGGG + Intronic
1058172962 9:101705073-101705095 GTCTATGGGCACAGGCCCAAGGG - Intronic
1061444043 9:130627526-130627548 GTCCCTGCTCACAGACACTGTGG + Intronic
1061616761 9:131785376-131785398 GATCCAGGTGACAGGCCCAGTGG - Intergenic
1061646243 9:132004500-132004522 GCCCCTGCTCACAAGCCCCGGGG + Intronic
1062317865 9:135977334-135977356 GGCCCAGGTCACAGGCTCTGGGG + Intergenic
1062490096 9:136800835-136800857 AGCCCTGCTTACAGGCCCAGCGG - Intronic
1185837812 X:3361293-3361315 GTCCGTGGGCACAGGCCCACAGG + Intergenic
1186196880 X:7117796-7117818 CTCTCTCATCACAGGCCCAGGGG + Intronic
1186664311 X:11702860-11702882 GTGGCTTGTCACAGGCCTAGGGG - Intergenic
1187138458 X:16570810-16570832 GTCCGTGGGCACAGGCCTGGGGG - Intergenic
1187365375 X:18661982-18662004 GTCCGTGGGCACAGGCCTGGGGG + Intronic
1187885227 X:23883170-23883192 GTTGGTGGGCACAGGCCCAGGGG - Intronic
1189084003 X:38001092-38001114 GTCCCTGGTCACAGGCCCAGGGG + Intronic
1189340536 X:40201448-40201470 GTCCCAGCTGACAGCCCCAGAGG - Intergenic
1190333562 X:49249842-49249864 GTCCCAGGTCACAGGCACTAAGG - Intronic
1190935058 X:54992443-54992465 GTCCAAGGTCACAGACACAGGGG + Intronic
1191006515 X:55716127-55716149 GTCCATGGGCACAGGCCCCAGGG + Intergenic
1191205878 X:57833751-57833773 GTCCATGGGCACAGGCCCAAGGG - Intergenic
1191586659 X:62834260-62834282 CTCTCTGATCATAGGCCCAGAGG - Intergenic
1191615846 X:63168634-63168656 GTCCTTGGTCACAAGGGCAGAGG - Intergenic
1191620452 X:63210289-63210311 GTCCTTGGTCACAAGGGCAGAGG + Intergenic
1192098594 X:68239467-68239489 GTCCGTGGGCACAGGCCCAGGGG + Intronic
1194119426 X:89942713-89942735 GTCCATGGGTACAGGCCCAAGGG - Intergenic
1194864878 X:99053710-99053732 CCCTCTGATCACAGGCCCAGAGG + Intergenic
1195367352 X:104139037-104139059 GTCCATGGGCATAGGCCCGGGGG + Intronic
1195402099 X:104472036-104472058 GGGCCTGGTCAAAGGCCCAGAGG + Intergenic
1195664135 X:107413176-107413198 CTCTCTGGTCACAAGCCCACAGG - Intergenic
1196241991 X:113353055-113353077 GTACATGGGCACAGGCCCAGTGG - Intergenic
1196258942 X:113555106-113555128 GTCCGTGGGCACAGGCCCGAGGG + Intergenic
1197241428 X:124127062-124127084 GTCCATGGGCACAGGCCCAAGGG - Intronic
1197459526 X:126723568-126723590 GGCCGTGGGCACAGGCCCAGAGG - Intergenic
1197945042 X:131829702-131829724 TTACCTGGTTACAGGCCTAGAGG + Intergenic
1198091431 X:133334676-133334698 GCCCCAGGTCACAGTCACAGTGG + Intronic
1198711345 X:139507812-139507834 GCCCATGGGCACAGGCCCAGAGG - Intergenic
1198713784 X:139534354-139534376 GTCCAAGGTCACAGGTCTAGAGG + Intronic
1198883358 X:141306223-141306245 GTCCGTCGGCACAGGCCCAAGGG - Intergenic
1199754287 X:150850035-150850057 GTGCCTGTTTACAAGCCCAGTGG + Intronic
1200472298 Y:3600270-3600292 GTCCATGGGTACAGGCCCAAGGG - Intergenic
1201238029 Y:11930440-11930462 GTCCATGGGCACAGGCCCACAGG - Intergenic