ID: 1189085515

View in Genome Browser
Species Human (GRCh38)
Location X:38019109-38019131
Sequence TATAAGTTAGATTTCCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189085515_1189085519 29 Left 1189085515 X:38019109-38019131 CCTACCAGGAAATCTAACTTATA 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1189085519 X:38019161-38019183 GAAGCAGTCGTCGGCGCCACAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1189085515_1189085518 20 Left 1189085515 X:38019109-38019131 CCTACCAGGAAATCTAACTTATA 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1189085518 X:38019152-38019174 GCTCTGTTTGAAGCAGTCGTCGG 0: 1
1: 0
2: 0
3: 6
4: 100
1189085515_1189085517 -7 Left 1189085515 X:38019109-38019131 CCTACCAGGAAATCTAACTTATA 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1189085517 X:38019125-38019147 ACTTATAGAACAGATGAAAACGG 0: 1
1: 0
2: 3
3: 44
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189085515 Original CRISPR TATAAGTTAGATTTCCTGGT AGG (reversed) Intronic
905934301 1:41811503-41811525 TATCAGTTACATTTGCTGTTAGG + Intronic
911385269 1:97167104-97167126 TATATTTCAGTTTTCCTGGTGGG + Intronic
915593203 1:156882143-156882165 TGGAAGTTAGATGTACTGGTAGG + Intergenic
915735953 1:158085211-158085233 TCAAAGCCAGATTTCCTGGTTGG + Intronic
916103646 1:161414226-161414248 TTTATGTTAGGTTTCCTGTTGGG - Intergenic
916299454 1:163257663-163257685 TAGAAGTGACATTTCCTGGAAGG + Intronic
918880063 1:190107640-190107662 TATATGTTAGCTTTCCTAATTGG + Intronic
919397407 1:197068625-197068647 TAGAAGTGAGATTTGCTTGTTGG + Intergenic
919664251 1:200277123-200277145 TATAGGGTAGATTTCCAGGAGGG + Intergenic
923668728 1:236021696-236021718 TAGAAGTAAGCTTCCCTGGTGGG - Intronic
1064411146 10:15105372-15105394 TATACGTTAGATTTCCAAGGAGG - Intronic
1072714356 10:97739840-97739862 TAGAAGTTAGATTTAAAGGTTGG + Intronic
1073253543 10:102136640-102136662 TATAAGTTAAACTTCATCGTTGG + Intronic
1073762822 10:106648962-106648984 TATAGGATAGTTCTCCTGGTCGG - Intronic
1075012689 10:118888297-118888319 AATAAGATAGATTTCCTGCCTGG - Intergenic
1079223773 11:18587934-18587956 TATAGGTCAGATTTCTAGGTCGG + Intronic
1079546666 11:21641696-21641718 TACGACTTAGATTTCCTGATTGG - Intergenic
1081955295 11:47086684-47086706 TATAAGCTAGATTTCCTTATTGG + Intronic
1086393553 11:86390722-86390744 TATGACTCAGATTTCTTGGTTGG + Intronic
1088284946 11:108178301-108178323 TTTGAGTTAGATTTCTTGCTGGG + Intronic
1092519620 12:9255211-9255233 TAAAAGTTAGACATCTTGGTGGG - Intergenic
1095593773 12:43936402-43936424 ACTGAGTTTGATTTCCTGGTAGG + Intronic
1096783067 12:54001800-54001822 TATATCTTAGTTTTCCTGTTTGG - Intronic
1097488042 12:60230881-60230903 TTTAAGATATATTTCTTGGTCGG - Intergenic
1097930755 12:65182687-65182709 TAAAAGGTAGATTTGCTGATAGG + Intronic
1098055972 12:66505507-66505529 TATAAGTTAGAAATCCAGGCAGG - Intronic
1098399333 12:70056790-70056812 TATGAGTTAAATTTACTTGTTGG + Intergenic
1098516574 12:71384075-71384097 TTTTAGTTACAGTTCCTGGTTGG - Intronic
1098932829 12:76440074-76440096 TATTTTTTAGATTTCCTGCTTGG + Intronic
1099359738 12:81685313-81685335 TATAGGGTAAATTTCCTGGGAGG + Intronic
1100186976 12:92149215-92149237 AATAAGTTAGCTTTTCTTGTGGG + Intergenic
1100722649 12:97375116-97375138 TATAACTTTGATCTCCTGATTGG + Intergenic
1101518438 12:105459507-105459529 TATTTGTTAGATTTTGTGGTGGG - Intergenic
1101996957 12:109532613-109532635 TATCACTTAGATTTCCAGGCTGG + Intronic
1105817323 13:24048912-24048934 TACAAGTTAGAATTCATGTTAGG + Intronic
1108391868 13:49954911-49954933 TATGGGAAAGATTTCCTGGTGGG - Intergenic
1109258136 13:60109265-60109287 TGTAAGTGAGAAATCCTGGTCGG - Intronic
1109340730 13:61054988-61055010 TAACAGTTAAATTTCCTGTTGGG + Intergenic
1111866749 13:93778348-93778370 TATAAGAGAGATTTCCTGGGTGG + Intronic
1112027481 13:95424750-95424772 TAGAAGTTAGATATTCTGGATGG + Intergenic
1112469392 13:99673903-99673925 AATCAATGAGATTTCCTGGTGGG + Intronic
1112969342 13:105240454-105240476 TTTATGTTAGATTTCCTGAGTGG - Intergenic
1113311034 13:109133078-109133100 TATAACTTTTCTTTCCTGGTGGG - Intronic
1115792992 14:36900590-36900612 TATAAATTAGAATTCCTAATAGG - Intronic
1116258336 14:42586935-42586957 GATCAGTGAGATTTCCTGTTTGG - Intergenic
1120317582 14:82915736-82915758 TTGAAGTTAGATAGCCTGGTGGG - Intergenic
1121676367 14:95756487-95756509 TAGAAATTAGAGTTCCTGGCTGG + Intergenic
1121945454 14:98116834-98116856 TATAAGCTATATTTCATAGTAGG + Intergenic
1126596628 15:50389934-50389956 TATGGGGCAGATTTCCTGGTGGG + Intergenic
1126796176 15:52261891-52261913 AATCATGTAGATTTCCTGGTGGG - Intronic
1126833209 15:52631698-52631720 GAAAAGTTAGATTTCCTCGTTGG + Intronic
1130733559 15:86524501-86524523 GCTAAGTGAGGTTTCCTGGTTGG - Intronic
1132051315 15:98609941-98609963 AATAAGTTAGCGTTCGTGGTTGG + Intergenic
1137230792 16:46565332-46565354 TATAAGTTATATTTTGTGGCCGG + Intergenic
1139614167 16:68079093-68079115 CAGAAGTTAGATGTCCTGGCAGG + Exonic
1139660038 16:68414518-68414540 TGGCAGTCAGATTTCCTGGTGGG + Intronic
1139900505 16:70324414-70324436 TAGAAATAAGATTTTCTGGTGGG - Intronic
1139963526 16:70731573-70731595 TAAAAGTAAGAATTCATGGTGGG + Exonic
1140565745 16:76039562-76039584 TGTAATTTAGCTTTGCTGGTTGG + Intergenic
1140916854 16:79501549-79501571 TCTAAGTTAATTTTCCTGATTGG + Intergenic
1144245901 17:13364303-13364325 TTCAAGTTAGATTTCCTGTTGGG + Intergenic
1144609083 17:16693166-16693188 GATAGGTTAGATTTCTTGGTAGG + Intronic
1144903679 17:18622360-18622382 GATAGGTTAGATTTCTTGGTAGG - Intergenic
1145128899 17:20324370-20324392 GATAGGTTAGATTTCTTGGTAGG + Intergenic
1145195771 17:20893253-20893275 GATAGGTTAGATTTCTTGGTAGG - Intronic
1148514475 17:48203506-48203528 TATAAGTAATAATGCCTGGTGGG + Intronic
1150070852 17:62148734-62148756 TATTAGTTAGGATTCCTGTTAGG + Intergenic
1150097565 17:62391106-62391128 TATAAGTCAGAAGTCCAGGTGGG + Intronic
1150136549 17:62698597-62698619 TATCAATTTGATTTCCTGGCAGG - Intergenic
1152733652 17:81986098-81986120 TATTAGGAAGATTTTCTGGTGGG - Intronic
1156117542 18:33804137-33804159 CATAAGTTATATTTCCTTCTGGG - Intergenic
1157827131 18:50822617-50822639 TTTAAGATAAATTTCCTGGCAGG - Intronic
1158367181 18:56750425-56750447 TATAATTTAACTTTCCTAGTTGG + Intronic
1164050544 19:21582742-21582764 TATAAGTCAGAAGTCCAGGTGGG - Intergenic
1166020599 19:40025133-40025155 TGGAATTCAGATTTCCTGGTTGG + Intergenic
1167024295 19:46903865-46903887 TATAAGTAACATATCCTGTTGGG - Intergenic
926784235 2:16504851-16504873 TATAAGTCACATTTCCTATTAGG - Intergenic
929929714 2:46243773-46243795 TTTAATTTACATTTCATGGTGGG + Intergenic
931918552 2:66986781-66986803 GATAAGGTAGATTTCCTTTTAGG - Intergenic
934670118 2:96207061-96207083 TAAAAGTTATCTTTCCTGCTAGG + Intronic
938889666 2:135691642-135691664 TATAAGCTGGATTTGGTGGTGGG + Intronic
938923648 2:136018776-136018798 AATAAGATAAATTTGCTGGTGGG + Intergenic
939299391 2:140315645-140315667 TATAAGGAAGATTTCTTGGTTGG - Intronic
939557999 2:143700357-143700379 TATAAGTAAAGTTTGCTGGTTGG + Intronic
940738336 2:157479285-157479307 TTTAATTTACATTTCCTGGTAGG + Intronic
944852069 2:203729952-203729974 TATGAGTTAGATTTCCCAGAAGG + Intronic
945817072 2:214618624-214618646 TATAACATAGATTTCCGGGGAGG + Intergenic
1174111216 20:48199204-48199226 TATAAATTAGATTTATTGGGAGG - Intergenic
1174669283 20:52291487-52291509 TGCAAGTTAGATTTGCTGTTTGG - Intergenic
1175213833 20:57378957-57378979 TGTAATTTAAAATTCCTGGTTGG + Exonic
1178042706 21:28657764-28657786 GCTAAGTTATTTTTCCTGGTTGG - Intergenic
1178213628 21:30568234-30568256 TATAATTTGGATTTCCATGTAGG + Intergenic
1183558700 22:38552811-38552833 TATAAGTAAGATTTGCCAGTTGG - Intronic
952345416 3:32479603-32479625 TAGAAGTTAAATTGTCTGGTGGG - Intronic
952520012 3:34147176-34147198 TGTAAGTTAGCTCTTCTGGTAGG + Intergenic
952589651 3:34934948-34934970 TGTAAGTAAGATGTCCTAGTGGG + Intergenic
955544493 3:60013536-60013558 TAGAAGCTAGATTCACTGGTTGG - Intronic
956239200 3:67110098-67110120 CATACTTAAGATTTCCTGGTTGG + Intergenic
959651524 3:108755699-108755721 TTTGAGTTAGATTTCTTGGTTGG + Exonic
961092874 3:124130147-124130169 TATAAATTAAAGTTCCTGATTGG + Intronic
962449996 3:135505217-135505239 AATAAGTTAGAACTCCTGGAGGG - Intergenic
964157448 3:153603093-153603115 TAGAAGATACATTTCCTTGTTGG + Intergenic
967007924 3:185401939-185401961 TATAGGTTATATTTTCTGGTAGG - Intronic
971976084 4:33689206-33689228 TGTAACTTAGATTTCATGCTTGG + Intergenic
972063788 4:34913014-34913036 TAGAAAATAGAATTCCTGGTTGG - Intergenic
972433497 4:39007856-39007878 AATTAGTTAGATTTCCTCCTAGG + Intronic
975429888 4:74276821-74276843 TATAAATTATATTTAATGGTTGG - Intronic
975531051 4:75399702-75399724 TCTAAGTGACATTTTCTGGTGGG - Intergenic
976474992 4:85473842-85473864 TATAAACTTGATTTTCTGGTGGG - Intergenic
976500162 4:85778646-85778668 TTTAAGGTATATTTCCTTGTAGG + Intronic
976678301 4:87726895-87726917 TATAAATTAGATCTCCATGTGGG + Intergenic
977267559 4:94873707-94873729 TAGAAGTAAGAATTCATGGTCGG - Intronic
977756730 4:100680509-100680531 TAAAAGTAAGATCTCCTGGCTGG + Intronic
977960538 4:103079859-103079881 TTTAAGTGAGGTTTCCTGTTAGG - Intronic
979536980 4:121833215-121833237 AATAAGTTAGATTTACCTGTAGG + Exonic
980314158 4:131174625-131174647 TATAAGTTAGATTTGCTACCAGG - Intergenic
980598284 4:134985234-134985256 TATAATTTAGATCTTCTGGATGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
984763275 4:183380381-183380403 TATAAGTAAGATTTCCAAATAGG - Intergenic
987434168 5:17873393-17873415 AATAAATTAGATGTCCTTGTGGG + Intergenic
991939921 5:71840691-71840713 TTTAAGTTATATTTCCTAGTTGG + Intergenic
994174755 5:96699585-96699607 TATAACATGGATTTCCTGGTGGG + Intronic
994663257 5:102678329-102678351 TATAAATTAGATTTTCCTGTAGG - Intergenic
995099186 5:108278203-108278225 TGTAAGTTAGATTTGGGGGTTGG - Intronic
995682562 5:114736754-114736776 TATAAGTTTTATTACCTGGTGGG - Intergenic
996183552 5:120449953-120449975 TATATTTTAGAGTTCTTGGTGGG + Intergenic
996878412 5:128265232-128265254 TCTAATTTAGATTCCCTGTTAGG - Intronic
998960988 5:147486816-147486838 TCTAAGTCAGATTTCCTGAATGG + Intronic
1006821059 6:36895476-36895498 TATAAAGTAGATTTCCAGATGGG - Intronic
1007141473 6:39579099-39579121 TAGAAGTAGGATTTCCTGGCTGG + Intronic
1009588072 6:65631766-65631788 TATAAGTAAAATTTACTAGTAGG + Intronic
1010806843 6:80246970-80246992 TATAAGTTTGATTGCCTTCTAGG - Intronic
1010867583 6:80998273-80998295 TATAAGTTGATTTTCATGGTGGG + Intergenic
1011828570 6:91340635-91340657 TATAAGTCAGATTTTCTCATAGG - Intergenic
1012359888 6:98364134-98364156 TATAAAATACATTTCCTAGTAGG - Intergenic
1012540042 6:100352008-100352030 TATATGTTTGTTTGCCTGGTGGG + Intergenic
1012884355 6:104827988-104828010 TGTAAGTTAGATTACATGGCAGG - Intronic
1016640035 6:146337639-146337661 TAGAAGAGAGATTTCCTGGCAGG - Intronic
1020922834 7:14286173-14286195 TATAAGATAGATTTCATGTAGGG - Intronic
1021419106 7:20425015-20425037 TTTAAATTACATTTCCTGGCCGG + Intergenic
1022433284 7:30349972-30349994 TCTTAGTTTGATTTCATGGTTGG + Intronic
1023624850 7:42105937-42105959 GAGAAATTTGATTTCCTGGTGGG - Intronic
1023638977 7:42238724-42238746 TTTAAGTTACATGTCCAGGTTGG - Intergenic
1026376571 7:69757271-69757293 AAGAAGTTAGATTTCCCTGTTGG + Intronic
1030828267 7:114188119-114188141 AATAAATTAAATTTTCTGGTGGG - Intronic
1032348884 7:131141979-131142001 TATAAATTAAATTTCCGGCTGGG + Intronic
1032355310 7:131205540-131205562 TATAGGTCAGAAGTCCTGGTGGG + Intronic
1033227039 7:139570577-139570599 TATAAGTAAGAATTTATGGTTGG + Exonic
1034847975 7:154464947-154464969 TATAAGTTAAATTTTATCGTAGG - Intronic
1036275637 8:7349132-7349154 TGGAAGTGAGATTTCCTGGAAGG + Intergenic
1036700516 8:11010581-11010603 TCAAAGATAGATTTCTTGGTTGG - Intronic
1037200067 8:16241610-16241632 ATTAAGTTAGTTTTCCTGATAGG - Intronic
1038120614 8:24610278-24610300 TATAATTAACATTTCCTGATAGG + Intergenic
1039613787 8:38938866-38938888 GATAAGTTAGATTTCCTTCTTGG + Intronic
1041138516 8:54788317-54788339 TAAAAGTTAGATGTCCATGTGGG + Intergenic
1043316918 8:78934207-78934229 AAGAAGGTAGATTTCCTGTTAGG - Intergenic
1043704641 8:83332734-83332756 TATAGGTTAGGTTTCCTGGGAGG + Intergenic
1045194263 8:99914096-99914118 TATCAGTTATATGTCATGGTAGG + Intergenic
1047711406 8:127556216-127556238 AATAAGTTAAAGTTCCTGGTGGG - Intergenic
1048014402 8:130484480-130484502 TTTAAATTACAATTCCTGGTTGG + Intergenic
1048483446 8:134824842-134824864 TAAAAGTCAGAATTCATGGTTGG + Intergenic
1050416487 9:5422876-5422898 AGCAAGTTAGATTTGCTGGTGGG + Intronic
1050528989 9:6571342-6571364 TATAAGTTAGATTTTATCATAGG - Intronic
1051955814 9:22691874-22691896 TATAAACTAGGTTTCCTGGTTGG + Intergenic
1052283495 9:26758586-26758608 AATGAGTTTGATTTCTTGGTGGG + Intergenic
1055611106 9:78025566-78025588 TTAAAGTCAAATTTCCTGGTTGG - Intronic
1057983798 9:99688966-99688988 GAGAAGTAAGATTACCTGGTTGG + Intergenic
1058191385 9:101920444-101920466 TATAATTTACATTTCCTCGCAGG + Intergenic
1060559632 9:124532228-124532250 TAGAAGTTAGAGATCCTGGATGG - Intronic
1185986756 X:4843497-4843519 TATAATTTAGGCTTCCAGGTAGG - Intergenic
1186052585 X:5614686-5614708 TAGATGATAGATTTGCTGGTAGG - Intergenic
1186226663 X:7406365-7406387 TATAAGAGACATTTCATGGTAGG - Intergenic
1187173966 X:16878851-16878873 GATAATTAAGATTTCCTGGCCGG - Intergenic
1188199094 X:27277738-27277760 TATGGGGTAGATTCCCTGGTGGG + Intergenic
1188751103 X:33906611-33906633 TTTAAGGTACATTTCCTAGTCGG + Intergenic
1189085515 X:38019109-38019131 TATAAGTTAGATTTCCTGGTAGG - Intronic
1192378200 X:70586697-70586719 ATTAAGATACATTTCCTGGTGGG + Intronic
1197192796 X:123666855-123666877 TACAAGTTAGACTTCTAGGTTGG - Intronic
1198745981 X:139891079-139891101 AAGAAGTTAGATATCCTTGTGGG + Intronic