ID: 1189087072

View in Genome Browser
Species Human (GRCh38)
Location X:38036566-38036588
Sequence CAGTTAATGCAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189087072_1189087074 28 Left 1189087072 X:38036566-38036588 CCTTGTTCCATCTGCATTAACTG 0: 1
1: 0
2: 3
3: 12
4: 173
Right 1189087074 X:38036617-38036639 GAGTTCTTGTAATATGACTCAGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189087072 Original CRISPR CAGTTAATGCAGATGGAACA AGG (reversed) Intronic
900989709 1:6092722-6092744 CAGTTAAAGCAGGTGGCCCAGGG + Intronic
901417424 1:9127519-9127541 CAGATGCTGCAGATGGAATAGGG - Intronic
903050998 1:20600986-20601008 CAGTTAATACAGTTGGAATATGG - Intronic
903517529 1:23921909-23921931 AGGTTAAAGCAGAGGGAACATGG - Intergenic
905907217 1:41627113-41627135 CAGGGCATGCAGATGGCACAGGG + Intronic
909600866 1:77459621-77459643 CAGGTAATGCCGATGGTCCAGGG + Intronic
915466017 1:156098506-156098528 CAGTTATTCCTGATGTAACATGG - Intronic
916421498 1:164641614-164641636 CAGTTAATGAAGAAGACACAAGG + Intronic
917196231 1:172468812-172468834 CTGTTTATGAAAATGGAACATGG + Exonic
919684647 1:200472378-200472400 CAGGTAAAGCACATGGAACCAGG + Intergenic
922659234 1:227414969-227414991 CATATAATTCAGATAGAACAGGG - Intergenic
923008294 1:230068504-230068526 GAGTTAATGGAGATGGACTACGG + Intronic
923580028 1:235200788-235200810 TAGTCAATGCAGATAGAAAATGG + Intronic
923933974 1:238739356-238739378 AAGTTAATGAAGCAGGAACACGG + Intergenic
924759261 1:246968856-246968878 CAGCTAAAGCACAGGGAACAGGG + Intronic
1065597437 10:27328548-27328570 CATTTAATCCAGATGGGAGATGG - Intergenic
1066219998 10:33327392-33327414 CATATAATGAAGCTGGAACAAGG + Intronic
1067234615 10:44437243-44437265 CAGTCAGTGTAGCTGGAACAGGG - Intergenic
1067786826 10:49256351-49256373 CAGCTAATGCAGAATGAACAAGG + Intergenic
1068208046 10:53882932-53882954 CATTAAATGCAAATGGACCAAGG + Intronic
1068615838 10:59115412-59115434 CATTTAATGCACATAGACCATGG - Intergenic
1068949415 10:62762160-62762182 CAGTTCCTGCAGTTGGAAAATGG - Intergenic
1071370903 10:84950590-84950612 CAGGTAATGCTTCTGGAACAGGG + Intergenic
1073419722 10:103414867-103414889 CTGTTATTCCAGATGGCACATGG - Intronic
1074957238 10:118404116-118404138 CAGTTAATGCTGTTAGAAAATGG + Intergenic
1076468662 10:130703342-130703364 CAGTTGATGCAGGTGGATGAGGG - Intergenic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1077951650 11:6965186-6965208 CAGTAAAGGCATATTGAACACGG + Intronic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1080154506 11:29093036-29093058 CACTTAATGAAGAGGTAACAAGG + Intergenic
1081368731 11:42271706-42271728 CAGTTGGTGCAGATGTAAAATGG + Intergenic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1089116000 11:116095649-116095671 CAGTTACAGCAGCTGGGACATGG + Intergenic
1089773582 11:120820391-120820413 CAGGTTTTGCTGATGGAACAAGG + Intronic
1090186810 11:124744691-124744713 CCGTTATTGCACCTGGAACAAGG + Intronic
1091983173 12:4883065-4883087 TAGTTATTGCAGATGAAACGTGG - Intergenic
1092914914 12:13180910-13180932 CAGTTAATGCAAATATTACAGGG + Intergenic
1093274667 12:17109449-17109471 CACTCAATGCAAATGGAACACGG + Intergenic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1095045758 12:37502272-37502294 CAGTTTATGGAGATGAAGCAAGG - Intergenic
1095087108 12:38069086-38069108 CAGTTAATGCAATTGTCACAGGG - Intergenic
1095839867 12:46681500-46681522 TAATTAATGCAGAAGGAAGATGG - Intergenic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1097971454 12:65637754-65637776 CAGGTAGTGCTCATGGAACATGG - Intergenic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1100782745 12:98046902-98046924 CAGTTCATGCTGCTGGCACAGGG - Intergenic
1101276788 12:103211012-103211034 CAATCAATCCAGATGGAAAAAGG - Intergenic
1101566595 12:105911655-105911677 CACTTACTGCAGCTGGAAGATGG - Intergenic
1102509062 12:113402113-113402135 CAGTTAATTCAGATAGACAAGGG - Intronic
1103500286 12:121396491-121396513 GAGTTAATGCAGCTGGAAAGTGG - Intronic
1105796590 13:23860265-23860287 CAGTTAATCCAGATGAGAAAGGG + Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1107657937 13:42610783-42610805 CATCTAATGGAGATGGAACCAGG + Intergenic
1110116164 13:71819112-71819134 CAGTTGCTGCAATTGGAACATGG + Intronic
1111009564 13:82293588-82293610 AAGTTAATGAAAATGGAAGAAGG + Intergenic
1113000846 13:105634349-105634371 CAGTTAATGCAGATCAAACAGGG + Intergenic
1113094707 13:106651542-106651564 AAGTTAATGGAACTGGAACAAGG - Intergenic
1114940317 14:27601688-27601710 CAGGTTATGCAAATGGACCAAGG + Intergenic
1115055731 14:29124172-29124194 CAGTAAATGCACAAGGAAAAAGG + Intergenic
1117605851 14:57428342-57428364 CAGGTAATACACATTGAACAAGG - Intergenic
1120631617 14:86898747-86898769 CAGTGAATGCATATTGAAAATGG - Intergenic
1120816617 14:88866579-88866601 TAGTCAATGCAGCTGGAACTTGG - Intronic
1121688882 14:95860534-95860556 CAGGTAATGGGGATGGATCACGG - Intergenic
1122104043 14:99437805-99437827 CAGTTAATGTAGATGTGAAATGG - Intronic
1122135464 14:99630305-99630327 CAGGGACTGCAGATGGACCAGGG - Intergenic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123929285 15:25153220-25153242 CAGTTAATGGTGCTGCAACAAGG + Intergenic
1124703305 15:31936490-31936512 CAGATTATGCATCTGGAACAGGG + Intergenic
1126393950 15:48191886-48191908 CAGTTAATGCGGAGGGAAGGGGG - Intronic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1131866077 15:96711539-96711561 CAGTAAATGCAGAATTAACATGG - Intergenic
1133048567 16:3103221-3103243 CAGTCTTTGCAGCTGGAACATGG - Intergenic
1133831528 16:9327755-9327777 GAGTTACTGCAGATGGGAGAGGG + Intergenic
1133997088 16:10756673-10756695 CACGTACTGCAGAGGGAACAGGG - Exonic
1135208005 16:20499217-20499239 CAGTGCTTGCACATGGAACATGG + Intergenic
1135210894 16:20524483-20524505 CAGTGCTTGCACATGGAACATGG - Intergenic
1136072798 16:27798414-27798436 CATTTCATGCAGAAAGAACAGGG + Intronic
1136238009 16:28926169-28926191 CAGATAATGCAGTTTGAAAATGG + Intronic
1137066572 16:35851947-35851969 CAGTGATTGCCGTTGGAACATGG - Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138401919 16:56753182-56753204 CAGCTAATGAAGATGGAATTAGG + Intronic
1138837107 16:60451070-60451092 CACCTAATGCAGTTGGGACAAGG + Intergenic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1142537987 17:633414-633436 AAGTTAATTCTGAAGGAACAGGG - Intronic
1144016378 17:11200294-11200316 CAGTTTATGCAGGTGTAAAAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148516857 17:48227163-48227185 CTGTGAATGGAGAGGGAACATGG + Intronic
1151615001 17:75204284-75204306 CAGTTAATCCTAATGGAAAACGG + Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1153777847 18:8469412-8469434 CAGTTCTTGCAGATAGAACCCGG - Intergenic
1156734611 18:40239284-40239306 AAGTTTATGCAGAGAGAACATGG - Intergenic
1160039588 18:75333591-75333613 CAGTTAATGAAGAGGGATCTTGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1166869108 19:45860153-45860175 CAGTTAATATATATTGAACACGG + Intronic
925711835 2:6748635-6748657 TAGTTACAGCAGGTGGAACAGGG - Intergenic
926771015 2:16375285-16375307 CAGTCAATTCAGTTGAAACAAGG - Intergenic
928099012 2:28423910-28423932 CATTTAATGCTGATGGGAAAGGG - Intergenic
928536787 2:32248924-32248946 TAGTTATGGCAGATGGAACAGGG - Intronic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
930178413 2:48324833-48324855 ATGTAAATGCAGTTGGAACACGG + Intronic
930200294 2:48546291-48546313 GAGTTAATGCAGGTGACACAGGG - Intronic
934148943 2:89126745-89126767 CAATAAATGCACATGGCACATGG - Intergenic
934218352 2:90055301-90055323 CAATAAATGCACATGGCACATGG + Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
935549002 2:104431797-104431819 AAGTTAATGTAGCTTGAACAAGG + Intergenic
935665388 2:105507754-105507776 TAGTTAAGGCTGGTGGAACAGGG + Intergenic
936264533 2:110992635-110992657 GAGGTAAGGCAGATGGAGCATGG + Intronic
938162107 2:128995293-128995315 CAGTTGATGCAATGGGAACAAGG - Intergenic
939523752 2:143265131-143265153 CAGAAAATGCTCATGGAACAGGG + Intronic
941336450 2:164250162-164250184 CTGTCAATGTAGATGGAATAGGG - Intergenic
941614979 2:167708695-167708717 CACTTCATGCAGATTGAACCAGG + Intergenic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1173735638 20:45359532-45359554 CAGGTGATTCAGATGGCACAGGG + Intergenic
1175630143 20:60528774-60528796 CAGGCAATGAAGATGCAACATGG - Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1178727157 21:35063913-35063935 CAGGTAATTCAGATGAAACCAGG + Intronic
1181999248 22:26906777-26906799 CAGTTAAAGCTTATGGAAGAAGG + Intergenic
1184001918 22:41681014-41681036 CAGTAAATTCAGGTGGAATACGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949419246 3:3848307-3848329 CATTTAGAGCAGATGGAACTAGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952170519 3:30801681-30801703 CAGTAAATGCAAATGGAATTTGG - Intronic
954429705 3:50463999-50464021 CAGATCATGCAGAGGGAGCATGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
958430419 3:94033551-94033573 TAGTAAATGCAGAAGGAATATGG + Intronic
962205190 3:133428440-133428462 GAGTGAATGCACATGGAACGTGG + Intronic
965733014 3:171792422-171792444 CTGGGAATGCAGATGGATCAGGG + Intronic
967222381 3:187258210-187258232 CAGTTATGGCTGGTGGAACAGGG - Intronic
968787730 4:2635973-2635995 CAGATAATGTAGTTGGAAAAAGG + Intronic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
973749691 4:54001710-54001732 CAGTTCCTGCAGCTGGACCAAGG + Intronic
976125718 4:81832172-81832194 CATTTAATGAAGGTGGAAAAGGG - Intronic
976813477 4:89121259-89121281 TAGTTATGGCTGATGGAACAGGG - Intergenic
978006530 4:103623959-103623981 CAGTTAACCTAGATTGAACAAGG - Intronic
979760859 4:124402571-124402593 CAGCTAAGTCAGATGGAAAAGGG - Intergenic
981028427 4:140099644-140099666 CAGTTACTGCATATGAAAAATGG + Intronic
987765936 5:22229750-22229772 GAGAAACTGCAGATGGAACATGG - Intronic
989174177 5:38505004-38505026 GTGTTAATGCACATGGACCATGG + Intronic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
1000356432 5:160400363-160400385 CATTTATTCCACATGGAACATGG - Intergenic
1001791273 5:174459688-174459710 CAGTTCATGGAATTGGAACAGGG - Intergenic
1005938395 6:30542475-30542497 CAGTTTATGCAAATGGAGCTTGG - Exonic
1006995432 6:38255611-38255633 CATTTAATGCATATGGCACTGGG - Intronic
1011547257 6:88494727-88494749 CAGTTAAAGCAGATTGACCAAGG + Intergenic
1012074890 6:94670995-94671017 CAATTAGGGCAGATGGATCATGG + Intergenic
1012175534 6:96077570-96077592 CAATCAATCCAGATGGAAAAAGG - Intronic
1012362640 6:98402703-98402725 CAGATAATGGAGTTGGAAAATGG - Intergenic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1014658886 6:124141746-124141768 CAGTAAATGCATCAGGAACAAGG - Intronic
1015966237 6:138697281-138697303 AAGTGACTGCAGATGGAAGAGGG - Intergenic
1018862011 6:167717821-167717843 GAGACAAGGCAGATGGAACAAGG + Intergenic
1024339169 7:48239559-48239581 CAGTTGATGCACATGGGACAAGG - Intronic
1026527124 7:71163791-71163813 GAGTTGATGCAGATCGAAAAGGG + Intronic
1031351875 7:120742858-120742880 CAGTTAATGCAGATGAAGAGTGG + Intronic
1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG + Exonic
1033635234 7:143205910-143205932 CAGTAAATGAAGGTGGCACAGGG + Intergenic
1034189069 7:149199733-149199755 CAGCTAATGCAGCTGGAATTTGG - Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035705477 8:1671323-1671345 CATTGAATGCTGGTGGAACACGG - Intronic
1039179141 8:34844483-34844505 CAGAGAATGCAGACAGAACAGGG + Intergenic
1041559739 8:59202273-59202295 CAGTTAATGCAGTTATTACAGGG + Intergenic
1044384271 8:91568687-91568709 CGATTGATGCAGATGGAAGAGGG - Intergenic
1048099163 8:131329046-131329068 CAGATAATGCAGTTGGAACAAGG - Intergenic
1049141166 8:140955810-140955832 CACTAAATGCAGACAGAACAAGG + Intronic
1051200224 9:14609872-14609894 CAGATAATGTAGTTGGAAAAAGG - Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1059462953 9:114446751-114446773 GAGTTAAGGCAGATGGAAGGAGG - Intronic
1059727011 9:117018787-117018809 CATTGAATGCACATGGAAAATGG + Intronic
1060777167 9:126383408-126383430 CAGGTAATGCAGAAAGTACAGGG - Intronic
1186081238 X:5935460-5935482 CAGTGAATGCAGAGAGGACAGGG + Intronic
1186175092 X:6918357-6918379 CAGTGAATGCCCATGGAACTGGG - Intergenic
1186312590 X:8336863-8336885 CAGTTGATGCATCTGGCACAGGG + Intergenic
1187787107 X:22904185-22904207 TGATTAATGCAGATGAAACATGG + Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1189915610 X:45851997-45852019 TAGTTAATGTAGAAGAAACAGGG - Intergenic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1197261793 X:124327760-124327782 CAGTAAAGGCAGATGGGAAAAGG + Intronic
1198847679 X:140930558-140930580 CAATTATTGCAAATTGAACAAGG + Intergenic
1202353190 Y:24016530-24016552 CAGTTAATGCAGAAACAAAATGG - Intergenic
1202517589 Y:25653585-25653607 CAGTTAATGCAGAAACAAAATGG + Intergenic