ID: 1189087266

View in Genome Browser
Species Human (GRCh38)
Location X:38038723-38038745
Sequence AACTGATTAGTACAGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189087266_1189087268 -9 Left 1189087266 X:38038723-38038745 CCTTCAGACTGTACTAATCAGTT 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1189087268 X:38038737-38038759 TAATCAGTTTCAGAAGGAAATGG 0: 1
1: 0
2: 1
3: 39
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189087266 Original CRISPR AACTGATTAGTACAGTCTGA AGG (reversed) Intronic
907807061 1:57831303-57831325 AAAACATTAGTAGAGTCTGAAGG - Intronic
911502698 1:98708422-98708444 AGCTGATAAGTAAATTCTGATGG - Intronic
913484561 1:119322069-119322091 AACGGCATAGTTCAGTCTGAAGG + Intergenic
914696517 1:150086864-150086886 AACAGATTAGGACAGTAAGATGG - Intronic
915268905 1:154738400-154738422 AAAGTATTAGTTCAGTCTGAGGG + Intronic
917541107 1:175915616-175915638 AACTGATTAGTACAAGTTGTTGG - Intergenic
918459404 1:184760404-184760426 AAATATTTAGTACAGTTTGAAGG + Intergenic
921084386 1:211774981-211775003 AACTTATTAACACAGTATGAAGG + Intronic
1066093580 10:32051033-32051055 AAATAATTAGTACAGACTGTAGG + Intronic
1068412795 10:56679225-56679247 AACTGATTGGAACAGTTTGGAGG - Intergenic
1070019664 10:72571659-72571681 AAGTGATGAGTACAGCCAGAAGG + Intronic
1072838325 10:98741427-98741449 AACTATGTAGCACAGTCTGAAGG + Intronic
1073383717 10:103103730-103103752 AACTCATTAGCAAAGCCTGATGG + Intronic
1073930917 10:108575638-108575660 AACTGGAAAGTACACTCTGAAGG - Intergenic
1081170297 11:39860471-39860493 CACAGATTAGTACTGTATGAAGG + Intergenic
1086301837 11:85434767-85434789 AACTGTTTGGAATAGTCTGAGGG - Intronic
1086790096 11:91026405-91026427 AACTGATTATTACAGTGGTACGG - Intergenic
1087114998 11:94515050-94515072 AACTGATTAGTAGAGTGTGGTGG + Intergenic
1093801473 12:23378104-23378126 ATCTGTTTAGTACAGTCAGTTGG - Intergenic
1093822042 12:23632371-23632393 AACTGAGTAGTACAGTATTTTGG + Intronic
1098227104 12:68335488-68335510 ATGTGATTTGCACAGTCTGAAGG + Intergenic
1098775704 12:74612218-74612240 AAGAGATGAGTACAGTCTGAAGG - Intergenic
1100704243 12:97182936-97182958 TAATGATTAGAACAGTCTGCAGG - Intergenic
1107342264 13:39420547-39420569 AACTGATTTGTAGATACTGAAGG + Intronic
1109579169 13:64303083-64303105 ATCTGATTATTACATTCTGATGG - Intergenic
1118481195 14:66167751-66167773 AAATAATTAGTACAGTGTGGTGG - Intergenic
1119547517 14:75482919-75482941 AACAGGTTAGTATAGACTGAAGG - Intergenic
1123794099 15:23754307-23754329 ATCTGATTAATACTGACTGAGGG - Intergenic
1147627618 17:41910117-41910139 AGCTGATGAGGACAGTCAGAGGG - Intronic
1149759129 17:59213691-59213713 AACTAATTATTTCAGGCTGAGGG + Intronic
1156370473 18:36467963-36467985 AAATGATTTGCACAGTCTGAAGG + Intronic
1161164871 19:2781099-2781121 AAGTGCTCAGTACAGGCTGAAGG - Intronic
1163110052 19:15154554-15154576 AACTGATTAGTACAATCATATGG + Intergenic
927265406 2:21142700-21142722 AACTGAATACTGAAGTCTGATGG - Exonic
929830483 2:45343084-45343106 AACAGACTGGTACAGCCTGAGGG - Intergenic
932018856 2:68062246-68062268 AACCTATTAGGACTGTCTGATGG - Intronic
932387321 2:71347731-71347753 AAGGGGGTAGTACAGTCTGATGG + Intronic
939748778 2:146014292-146014314 AAGTGTTAAGTACATTCTGAGGG - Intergenic
940847735 2:158659845-158659867 CACTGCTTAGAACACTCTGATGG - Intronic
943344509 2:186722691-186722713 AACTGTTTAGTACAGCCCAAAGG - Intronic
1174315559 20:49697992-49698014 AACTTAATAGTACAGTATAATGG - Intronic
1176197219 20:63842927-63842949 TTCAGATTAGCACAGTCTGATGG + Intergenic
1178080547 21:29059282-29059304 AACTGGTTAATACAGTTGGATGG + Intronic
949460379 3:4285726-4285748 AAGTGATCAGTACTGTATGAGGG + Intronic
960989770 3:123302966-123302988 AGCTGCTCAGGACAGTCTGAAGG - Intronic
964435950 3:156653838-156653860 AAATGATTAGTACAGGCTCATGG - Intergenic
966574364 3:181482975-181482997 AACTGATTAGGAAAGTGTCATGG - Intergenic
982110843 4:152052119-152052141 AACTGGTGAGTACAGGCAGATGG + Intergenic
984145800 4:176058694-176058716 AAATGAGTAGTACATTCCGAAGG + Intergenic
986149783 5:5117142-5117164 AACTCATGAGAACAGTATGAGGG + Intergenic
990794409 5:59524053-59524075 AACAGATTAGTACAGTCAGTTGG + Intronic
991052340 5:62286757-62286779 AAGTGATGAGTTCAGTATGATGG + Intergenic
993622429 5:90184896-90184918 GAATGATTAGTACAGGCGGAAGG + Intergenic
995919324 5:117292549-117292571 AACAGATTTATACAGACTGACGG - Intergenic
996602912 5:125287549-125287571 AAATGTTTATTACACTCTGAGGG + Intergenic
999002130 5:147935697-147935719 AACTAATTTGTCCAGTCTCATGG + Intergenic
1000121568 5:158202957-158202979 AACTGATGAGTACAGTCTGTTGG + Intergenic
1000429803 5:161137690-161137712 TGCTGATTAGTATTGTCTGAGGG - Intergenic
1003044885 6:2724587-2724609 AACTGATCATAAAAGTCTGAAGG - Intronic
1005237692 6:23784649-23784671 AACTGATGAGCCCATTCTGAAGG + Intergenic
1005749677 6:28871172-28871194 AACTGTTTTGGACAGCCTGAAGG - Intergenic
1007379176 6:41475884-41475906 AACTGACTAATACAGCCTCAAGG - Intergenic
1008383999 6:50866714-50866736 AACTAATAAGTACAATTTGATGG + Intergenic
1011183299 6:84646163-84646185 AACTTATTAGTTGAGTCTAATGG - Intergenic
1012880444 6:104781695-104781717 AGCTGATCAGTGCTGTCTGATGG - Intronic
1015085686 6:129288458-129288480 AACTGATTAACACCTTCTGATGG - Intronic
1016689456 6:146919742-146919764 CACTCATTAATACAGTCTGCAGG - Intergenic
1017412632 6:154185451-154185473 AACTGATTTGTAAAGTTTGGGGG - Intronic
1018045965 6:159966837-159966859 AGCTGTTTAGTACAGTCTTTTGG + Intergenic
1024364685 7:48507638-48507660 AACTGAGGAGCACAGTTTGAGGG - Intronic
1030311725 7:108075638-108075660 AGATCATTAGTACAGTATGAAGG - Intronic
1030469519 7:109946084-109946106 AACTGATGAGTTCAGCCTGATGG - Intergenic
1037712477 8:21366093-21366115 AAATGGTTAGTAGAGTCTGGAGG - Intergenic
1041553734 8:59129570-59129592 ATCAGAAAAGTACAGTCTGATGG - Intergenic
1043283225 8:78495688-78495710 AAGTGATTAGTGAAGTCAGAGGG + Intergenic
1055835368 9:80434132-80434154 AATTCATTAATACAGTCTGTGGG + Intergenic
1056016996 9:82399969-82399991 AGCTGACTAGAACAATCTGAAGG + Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1189087266 X:38038723-38038745 AACTGATTAGTACAGTCTGAAGG - Intronic
1189274246 X:39773230-39773252 AACTGATGAGAACAGTAGGAGGG - Intergenic
1192231409 X:69267640-69267662 CACAGATTAGGACAGTCTCAGGG + Intergenic
1194323438 X:92480747-92480769 TACTGATCACTACACTCTGATGG + Intronic