ID: 1189088569

View in Genome Browser
Species Human (GRCh38)
Location X:38053211-38053233
Sequence ATGCTGATACTGCTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 1, 1: 0, 2: 24, 3: 202, 4: 642}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189088565_1189088569 -4 Left 1189088565 X:38053192-38053214 CCTAAAACGTTCCCAGGTGATGC 0: 1
1: 1
2: 21
3: 59
4: 213
Right 1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG 0: 1
1: 0
2: 24
3: 202
4: 642
1189088563_1189088569 12 Left 1189088563 X:38053176-38053198 CCTGAGATTCTGCATTCCTAAAA 0: 1
1: 21
2: 207
3: 769
4: 1813
Right 1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG 0: 1
1: 0
2: 24
3: 202
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189088569 Original CRISPR ATGCTGATACTGCTGGAACA AGG Intronic
901056919 1:6452671-6452693 CTGCTGATGCTGCTGGTCCAAGG + Intronic
901274971 1:7984075-7984097 ATGCTGAAACTGAAGGAGCAAGG + Intronic
902271889 1:15310581-15310603 ATGCTGATGCTGCTGGTCCAGGG - Intronic
902766099 1:18616432-18616454 AGGCTGATGCTGCTGGTCCATGG + Intergenic
902831468 1:19016144-19016166 ATGCTGATGCTGCTGGTTCCAGG - Intergenic
903300044 1:22372334-22372356 ATGCTGATGCTGCCGGTCCAGGG - Intergenic
903574932 1:24333447-24333469 AGGCTGATACAGCTAGAACCAGG - Intronic
903643612 1:24876898-24876920 ATGCTGACACTGCTGGTCCCCGG - Intergenic
904126086 1:28240299-28240321 ATGCTGACACTGCTGGCTCATGG - Intronic
904539181 1:31221327-31221349 ATGCTGATGCTGCTAGTCCAGGG - Intronic
904653940 1:32028223-32028245 ATTCTGATATTGCTGGTCCAGGG - Intronic
904975229 1:34451092-34451114 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
904981006 1:34501656-34501678 ATACTGATGCTGCTGGTCCAAGG - Intergenic
905279884 1:36842290-36842312 ATGCTGATGCTGCAGGTGCAGGG - Intronic
906132891 1:43471837-43471859 ATGCTGATGCTGTTGGTCCAGGG + Intergenic
906288081 1:44601393-44601415 ATGCTGATGTTGCTGTAATATGG + Intronic
906946970 1:50302863-50302885 ATGCTGATGCTGCTGATTCATGG - Intergenic
907634897 1:56124595-56124617 AGGCTGATGCTGCTGGTCCAGGG - Intergenic
907748416 1:57238162-57238184 ATGCTGATACTGCTGGCCCAAGG - Intronic
907788048 1:57633397-57633419 ATGCTGATGCTGCTGAACCTGGG + Intronic
907866999 1:58408041-58408063 ATGCTGAGGCTGCTGGTCCAGGG - Intronic
907947881 1:59152222-59152244 ATGCTGATTCTGCTGGCTCCAGG + Intergenic
907952583 1:59197844-59197866 AAGCTGATGCTGCTGGTCCAGGG + Intergenic
908332031 1:63080689-63080711 ACCCTGATAATGCTGGTACATGG - Intergenic
908349211 1:63267726-63267748 ATGCTAATAATGATGGAAAAAGG + Intergenic
908381593 1:63602065-63602087 ATGCTAATGGTGTTGGAACAGGG + Intronic
908615275 1:65913811-65913833 ATGCTAATACTGCTAGTCCAAGG - Intronic
908793778 1:67810978-67811000 ATGCTGATGCTGCCGGTCCAGGG - Intronic
908815196 1:68024611-68024633 ATGCTGAGATCGCTGGAACTGGG - Intergenic
909566213 1:77056146-77056168 ATGCTGTTTCTGGTGCAACATGG - Intronic
910154160 1:84194126-84194148 ATGAGGATTCTGCTTGAACAAGG - Intronic
910651834 1:89576542-89576564 ATGTTGATGCTGCTGGTCCAAGG - Intronic
910677798 1:89832334-89832356 ATGCTGAAATTCCAGGAACAAGG - Intronic
911072062 1:93839967-93839989 ATGCTGATACTCCTGGTTCATGG + Intronic
911524442 1:98966881-98966903 TTGCTGATACTGTTGGTTCAGGG - Intronic
911604259 1:99884814-99884836 ATGCTGACACTGCTGGTCCTTGG - Intronic
912172389 1:107116552-107116574 ATGCTGCTACTTCTGGTCCAGGG - Intergenic
912324041 1:108740984-108741006 ATGCTGATACTTTTGGCACCAGG - Intronic
913171585 1:116237583-116237605 ATGCTGGTGCTGCTGGTTCATGG - Intergenic
913486786 1:119339179-119339201 ATCCAGATACTGCAGAAACAGGG + Intergenic
915349192 1:155213934-155213956 ATGCTGACACTGCTGCTCCACGG + Intergenic
915352379 1:155234561-155234583 ATGCTGACACTGCTGCTCCACGG + Exonic
915674052 1:157514601-157514623 ATGCTGATGCTGCTGGCCCTGGG - Exonic
916472609 1:165138643-165138665 ATGCTGATGCTGCTGATCCATGG + Intergenic
916788673 1:168105378-168105400 ATGGTGATCCTGCTGGTTCAGGG - Intronic
916968128 1:169975889-169975911 ATGTTGATAATGGTGCAACAGGG - Intronic
917184222 1:172334668-172334690 AAGCAGTTACTGCTGAAACATGG - Intronic
917672676 1:177287853-177287875 ATGCTGATGCTGCTGGTCCATGG + Intergenic
917696605 1:177532235-177532257 CTGCTGCTGCTGCTAGAACATGG + Intergenic
918131766 1:181635682-181635704 ATGCTGACACTGCAGGTCCAGGG + Intronic
918247546 1:182672907-182672929 ATGCTGACACTGCTGGTTCAGGG - Exonic
918250610 1:182699854-182699876 GAGCTGGCACTGCTGGAACACGG - Intergenic
918552994 1:185765733-185765755 ATGCTGATGCTGCTAGTCCAGGG - Intronic
918594667 1:186279185-186279207 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
918693010 1:187506116-187506138 ATGCTGATGCTTCTGGCACCTGG + Intergenic
919128429 1:193425217-193425239 ATTCTGATACTGGTGGTATAGGG - Intergenic
919468680 1:197952328-197952350 ATGCTGATGTTGCTGGTCCATGG + Intergenic
920264273 1:204710263-204710285 ATGTTGATGCTGCTGGTCCAGGG + Intergenic
920281857 1:204849534-204849556 CTGCTGATGCTGCTGGTCCAGGG + Intronic
920763634 1:208810115-208810137 ATGCTGATGCTGCTGGTTCAGGG + Intergenic
921071285 1:211660300-211660322 ATCCTCATACTGCAAGAACACGG + Intronic
921127286 1:212189114-212189136 CTGTTGATGCTGCTGGTACAAGG - Intergenic
921221608 1:212977837-212977859 ATGCTGATCCTGCTGGTCCGGGG + Intronic
921424123 1:214982809-214982831 ACGCTGATGCTGCTGGCCCAGGG - Intergenic
921855171 1:219974276-219974298 ATGCTGACACTGCTGGTCCTAGG + Intronic
921900064 1:220440695-220440717 AAGCTGATGCTGCTGGTCCAGGG + Intergenic
921913411 1:220577637-220577659 ATTCTGATGGTGCTGGACCAGGG + Intronic
921964798 1:221076737-221076759 CTGCTGCTACTGCTTGATCAAGG + Intergenic
922033091 1:221823362-221823384 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
923542381 1:234897791-234897813 ATGCTGATGATGCTGGCCCAAGG + Intergenic
923947888 1:238910262-238910284 ATGCTGGTGCTGCTAGACCAGGG - Intergenic
1063350389 10:5348810-5348832 GTGCTGATGCTGCTGGTCCATGG + Intergenic
1063515678 10:6692707-6692729 ATGCTGATGCTGCTGGTTCAGGG + Intergenic
1063815768 10:9769487-9769509 ATACAGATAATGGTGGAACAGGG + Intergenic
1064795408 10:19006436-19006458 AGGGTGATGCTGCTGGTACAGGG + Intergenic
1064925186 10:20561917-20561939 ATGCTGATGCTGTTGGTCCATGG + Intergenic
1064941965 10:20745358-20745380 ATGCTGATGCTGCTGGTTCATGG - Intergenic
1065111109 10:22440657-22440679 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1065389681 10:25169867-25169889 ATGCTAATACTGCTGGCCCAGGG - Intergenic
1065415973 10:25486680-25486702 ATGCTGATGCTGTTGGTCCATGG + Intronic
1065764087 10:29010164-29010186 ATGCTGATACTGCCAGTCCATGG + Intergenic
1065880143 10:30030741-30030763 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1065942217 10:30575241-30575263 ATTCTGATATTGCTGGAGGAGGG - Intergenic
1067220386 10:44339872-44339894 ATGCTGATGCTGCCGGTCCAGGG + Intergenic
1067696696 10:48541095-48541117 ATGCTGATGCAGCTGGCCCATGG + Intronic
1067791643 10:49292885-49292907 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1068012775 10:51475282-51475304 ATGCTGATGCTGCTGTTCCAGGG - Intronic
1068730046 10:60347843-60347865 ATGCTGATTCTGTTGGCTCAGGG + Intronic
1068773618 10:60849048-60849070 ATGCTGATGCGGCTGGTCCATGG + Intergenic
1069295264 10:66835937-66835959 ATGCTGATACTGCTGATCTAAGG + Intronic
1069443422 10:68450393-68450415 ATGCTGATGCTACTGGTCCAGGG - Intronic
1069597955 10:69684805-69684827 AGGATCATACAGCTGGAACAGGG + Intergenic
1069952095 10:72026084-72026106 ATGCTGATGCTGCTGGTCCCCGG + Intergenic
1070650464 10:78231814-78231836 AGGCTGGTACTGCAGGAAGAAGG - Intergenic
1070742677 10:78913116-78913138 ATGCTGATGCTGCTGGTCCTGGG + Intergenic
1071120365 10:82269824-82269846 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1071278750 10:84080146-84080168 ATGCAAATACTGCTGGCCCACGG + Intergenic
1071460294 10:85887462-85887484 ATGCTGATACTGTTGGCCCATGG - Intronic
1071471936 10:85989523-85989545 ATGCCGATGCTGATTGAACAGGG - Intronic
1071786344 10:88904386-88904408 ATGCTGATGCTGCCAGTACATGG + Intronic
1072096026 10:92180793-92180815 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1072438039 10:95431257-95431279 ATGCTGATGCTGCTAGTGCAAGG - Intronic
1072609452 10:97006909-97006931 ATGTTGACGCTGCTGGACCAGGG - Intronic
1072699240 10:97628418-97628440 ATACTGTTCCTTCTGGAACAAGG - Intronic
1072718370 10:97766286-97766308 ATGCTCATGCTGCTGGACCAGGG + Intergenic
1072909044 10:99483800-99483822 ATGCTGATTCTGCTGGTTCTGGG + Intergenic
1072926981 10:99624427-99624449 ATGCTGATGCTGCTAGACCTTGG + Intergenic
1074143299 10:110695995-110696017 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1074178630 10:111036308-111036330 ATACTGATAATGCTACAACATGG + Intergenic
1074310828 10:112321953-112321975 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1075070666 10:119318032-119318054 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1075178200 10:120185283-120185305 ATGCTGATGCAGCTGGTCCAGGG - Intergenic
1075224843 10:120619110-120619132 ATGCTGATGCTGCTGGGTCCAGG + Intergenic
1076427155 10:130375386-130375408 ATGCTGGTGCTACTGGTACAGGG - Intergenic
1078252211 11:9625539-9625561 ATTCTGATACTGCTGGTCCAGGG + Intergenic
1078528300 11:12117403-12117425 ATGTTGGTACTGCTGCAGCAAGG - Intronic
1078761142 11:14252942-14252964 TTGCTGATGCTGCTGGTCCAAGG + Intronic
1080249326 11:30215317-30215339 ATGCTGATCCTGCTGGCCCAGGG + Intergenic
1080757389 11:35215150-35215172 ATACTGACACTGCTGGGACAGGG + Intronic
1081099743 11:38986827-38986849 ATGCTGTTACTGCTGGGATGAGG - Intergenic
1081300503 11:41445215-41445237 ATGCAGAATCTTCTGGAACATGG - Intronic
1082175082 11:49049476-49049498 AGGCTGATACCGCTGGCCCAGGG - Intergenic
1082243410 11:49893074-49893096 AGGCTGATGCTGCTGGCCCAGGG - Intergenic
1082626147 11:55488563-55488585 ATTGTGATAATGCTAGAACATGG - Intergenic
1083977854 11:66138409-66138431 ATGCTGATGCTGATGGTCCATGG + Intronic
1084852659 11:71955419-71955441 ATGCTGATACTGCCAGTCCATGG + Intronic
1085587357 11:77722401-77722423 ATGCTGATACTGCTGGTTAGAGG - Intronic
1085786486 11:79456165-79456187 ATGCTGATGCTGCTGGTCCCAGG + Intergenic
1087025716 11:93647532-93647554 ATGCTGATACTGATGGTCCACGG - Intergenic
1087043379 11:93823120-93823142 ATGCTGATACAACTGGAAACTGG + Intronic
1087760773 11:102102190-102102212 ATGCTGATGCTGCTGGTTTAGGG + Intergenic
1087767675 11:102174081-102174103 ATGCTGATACTGCTGGTTAAAGG + Intronic
1088169796 11:106982920-106982942 ATGCTGATGCTGCTTGTCCAGGG - Intronic
1088574040 11:111252413-111252435 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1089024742 11:115257944-115257966 ATGCTGACACTGCTGATCCAGGG + Intronic
1089329795 11:117681253-117681275 ATGCCGATGCTGCTGGCTCAGGG - Intronic
1089533290 11:119145669-119145691 ATGCTGATGCTGCTAGTCCAGGG - Intergenic
1089947598 11:122493721-122493743 ATGCTGATGCTGCTGATACATGG - Intergenic
1091105858 11:132919287-132919309 ATGCTGATGCTGCTTGTCCAAGG - Intronic
1091336968 11:134778840-134778862 ATTCTGATAGTGCTCCAACATGG + Intergenic
1092378452 12:7975256-7975278 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1092778772 12:11966354-11966376 GTGCTGATACAGCTGGTCCAGGG - Intergenic
1093685479 12:22049003-22049025 ATTCTGTTACTACTGCAACAGGG - Intronic
1093746167 12:22742945-22742967 ATGCTAATACTGCTGGTTCATGG - Intergenic
1094399857 12:30050770-30050792 ATGCTGATGCTGCTGGTCCCTGG - Intergenic
1094640398 12:32269074-32269096 ATGTTGATACTGCTGGTTCTGGG + Intronic
1095416212 12:41979535-41979557 ATGCTGATGCTGCTGGTGTATGG - Intergenic
1095801646 12:46275211-46275233 AAGGTGATACAGCTGGAAAAAGG + Intergenic
1096629497 12:52916788-52916810 ATGCTGACCATGCTGGAGCAGGG + Intronic
1097100187 12:56582549-56582571 ATGCTGATGCTGCTTGTTCAGGG - Intronic
1097826557 12:64180094-64180116 TTGCTGATGCTGCAGGACCAGGG - Intergenic
1097919377 12:65055440-65055462 ATTTTGAAACTGCTGGAGCATGG + Intronic
1098752649 12:74315362-74315384 ATGCTGATGCTGCTTGTCCACGG - Intergenic
1098806885 12:75032142-75032164 AGGCTGATACTGCTGGGAGTTGG - Intergenic
1099247400 12:80210150-80210172 ATGCTGATAGTTATGGAACTGGG - Intronic
1100240086 12:92702289-92702311 ATAGTGATACTGCTGGTCCAGGG + Intergenic
1100527962 12:95437838-95437860 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
1101706718 12:107227405-107227427 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1101820311 12:108179164-108179186 ATGTTGATGCTGCTGGTCCAGGG - Intronic
1102202271 12:111065759-111065781 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1102533790 12:113566243-113566265 ATGCCAATACTGCTGGTCCAGGG - Intergenic
1102751768 12:115300795-115300817 GTGCTGATGCTGCTGGGCCAAGG + Intergenic
1102859321 12:116321645-116321667 ATGCTGATGCTGCCGGTCCATGG + Intergenic
1102926212 12:116828354-116828376 ATGCTGATGGTGCTGGTTCATGG + Intronic
1103023800 12:117557530-117557552 ATCCTGATGCTGCTGGTCCACGG + Intronic
1103065004 12:117890109-117890131 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1104794692 12:131509336-131509358 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1105014043 12:132775177-132775199 CTGCTGGTTCTGCTGGAGCAGGG + Exonic
1105054202 12:133081851-133081873 ATGCTGATACTGCTGGTCCAAGG - Intronic
1105532960 13:21236825-21236847 ATGTTGATACTGCTGGTCTATGG + Intergenic
1105842625 13:24268012-24268034 ATGCTGATACTGCTGGTCCATGG + Intronic
1106303279 13:28488550-28488572 ATGCTGATGTTGCTGGACCTCGG + Intronic
1107007601 13:35632325-35632347 ATGCTGATTCTGCTGGGTTATGG - Intronic
1108003316 13:45924201-45924223 ATGCTGATACTGTTGGTCCCGGG - Intergenic
1108095112 13:46893404-46893426 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1108382687 13:49869234-49869256 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1109968130 13:69728506-69728528 ATGCTAATAATTCTGGAACCTGG - Intronic
1110416265 13:75256541-75256563 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1111281737 13:86034542-86034564 ATGCTTATACTGGTGGTCCATGG + Intergenic
1111638890 13:90942266-90942288 ATGTTGAGACTGGTGGACCAGGG - Intergenic
1111651745 13:91099526-91099548 ATGCTGTTACCTCTTGAACAAGG - Intergenic
1111882483 13:93975032-93975054 ATGCTGAAGCTGCTGGTCCAGGG - Intronic
1112353475 13:98655526-98655548 CTGCTGATGCTGCTGGTCCAGGG + Intergenic
1112359603 13:98705530-98705552 ATGCTGCTGCTGCTGGAGCCTGG - Intronic
1112365999 13:98756000-98756022 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1113041544 13:106108485-106108507 ATGCTGAGGCTGCTGGTCCAGGG - Intergenic
1113412711 13:110104647-110104669 ATGGTGATGCTGCTGGTGCAGGG + Intergenic
1113485097 13:110647292-110647314 ACACTGATTCTGCTGGACCAGGG - Intronic
1113598447 13:111550772-111550794 AGGTTGATGCTGCTGGATCAAGG - Intergenic
1115153047 14:30307485-30307507 ATGTTGATGCTGCTGGTGCAGGG - Intergenic
1115503178 14:34067223-34067245 ATGTTGATGCTGCTGGTCCAGGG + Intronic
1115705901 14:35997995-35998017 ATGCCGATGCTGCTGGTCCACGG - Intergenic
1115812671 14:37127275-37127297 ATCCTGGTTCTGCTGCAACATGG - Intronic
1116486316 14:45453147-45453169 AGGCTGTCACTGCTGGGACAGGG - Intergenic
1116654170 14:47629957-47629979 ATACTGATACTGCTGGTCTATGG + Intronic
1117107185 14:52409945-52409967 ATGTTGATACTGTTGGTCCATGG - Intergenic
1117258670 14:54006468-54006490 ATGCTGATGCTACTGGTCCAGGG - Intergenic
1117440480 14:55754547-55754569 ATGCTGAGGCTGCTGGTCCAAGG - Intergenic
1117584061 14:57182118-57182140 ATGCTGATACTGCTTGGCCTGGG + Intergenic
1118333003 14:64828284-64828306 ATGCTGCAGCTGCTGGAATAGGG + Intronic
1118561947 14:67095274-67095296 ATGCTGAGGCTGCTGGTCCATGG - Intronic
1118626998 14:67668829-67668851 ATGCTGATGCAGCTGGTTCATGG + Intronic
1119433351 14:74582729-74582751 ATGCTGATGCTACTGGGCCACGG - Intronic
1119499838 14:75115717-75115739 ATGCTGATGCTGCTGGTCCATGG - Intronic
1119767824 14:77201550-77201572 ATGCTGATGCCGCTGGGCCAGGG - Intronic
1119924447 14:78479441-78479463 ATGCTGATACTGCTGGTTCTGGG + Intronic
1120529838 14:85618842-85618864 AGGCTCATGCTGCTGGACCAAGG + Intronic
1120942698 14:89964011-89964033 ATGCTGAGGCTGCTGGTCCAGGG - Intronic
1121226541 14:92325316-92325338 GTGCTGATTCTGCTGGTCCAGGG - Intronic
1121439400 14:93939334-93939356 ATGCAGCTGCTGCTGGACCACGG - Exonic
1121469272 14:94139308-94139330 ATGCTGACACTGCTGGTCCATGG + Intergenic
1121556627 14:94842783-94842805 ATGCTGATGCTGCTCGCCCATGG + Intergenic
1122738701 14:103858490-103858512 CTGCTGATGCTGCTGGTCCAGGG + Intergenic
1202847386 14_GL000009v2_random:192266-192288 ATGCTGATGCTGCTAGCACAGGG + Intergenic
1202875936 14_KI270722v1_random:372-394 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
1124029351 15:25995331-25995353 ATGCTGGTACTGCTGGTACATGG + Intergenic
1124360848 15:29035712-29035734 ATGCTGAGGCTGCTGGTCCAGGG - Intronic
1124817987 15:33015928-33015950 ATGCTGATGCTCCTGGTCCAGGG - Intronic
1124996203 15:34725424-34725446 ATGCTGCTCCTATTGGAACATGG + Intergenic
1125289850 15:38133958-38133980 ATGCTGATGCTGCTGATCCAGGG + Intergenic
1125487238 15:40120490-40120512 ATGCTGATGCTGCTGAACCAGGG - Intergenic
1125511153 15:40293087-40293109 ATGCTGAGACTTCTGGAGCCAGG - Intronic
1125774694 15:42201646-42201668 ATGCTGATGCTGGTGGTTCAAGG + Intronic
1126223174 15:46238999-46239021 ATGCTGATGCTGCTGGTCCTTGG - Intergenic
1126266744 15:46763705-46763727 ATACTTACACTGCTAGAACAAGG + Intergenic
1126580668 15:50239836-50239858 CTGCTGATGCTGCTGGCTCAGGG - Intergenic
1126924063 15:53562492-53562514 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1126966728 15:54062648-54062670 ATGCTCATACTGCTGGTCTAAGG - Intronic
1127658325 15:61076260-61076282 ATGCTGACGCTGCTGGTTCAGGG + Intronic
1127904956 15:63369613-63369635 ATGCTAATGCTGCTGGCCCAGGG + Intronic
1128338529 15:66803669-66803691 CTGCTGATGCTGCTGGTTCAGGG - Intergenic
1128378223 15:67092428-67092450 ATGCTGACGCTGCTGGCCCAGGG - Intronic
1128615258 15:69103904-69103926 GTGCTGATGCTGCTGGTCCAAGG + Intergenic
1128691977 15:69731564-69731586 ATGCTGATACAGTCGGTACAGGG + Intergenic
1128850235 15:70947631-70947653 ATGCTAATACTGCTGGTTCAAGG - Intronic
1128941011 15:71787643-71787665 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1129032182 15:72627502-72627524 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129113951 15:73354523-73354545 ATGCTGAGACTGCTGGTGCAGGG + Intronic
1129217715 15:74109737-74109759 ATGCTGATGCTGTTGGCCCAGGG + Intronic
1129406948 15:75326240-75326262 ATGCTGATGTTGCTGGCCCAGGG - Intergenic
1129470154 15:75749110-75749132 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129734876 15:77954032-77954054 ATGCTGATGCTGCTGGCTCAGGG + Intergenic
1129840715 15:78741959-78741981 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1130205012 15:81867734-81867756 AGCATGATTCTGCTGGAACAGGG - Intergenic
1130380481 15:83367932-83367954 ATGCTGATGCTGCTGGCCCCTGG + Intergenic
1130402812 15:83573401-83573423 ATGCTGATGTTGCTGGTCCAGGG - Intronic
1130556354 15:84925266-84925288 ATGCTGACAATGCTGGTCCATGG - Intronic
1130771178 15:86925341-86925363 ATGCTGATACTGCTGGTCCAAGG + Intronic
1130795107 15:87199511-87199533 ATGCTGATGCTGCTGGTCCTGGG + Intergenic
1131029109 15:89171369-89171391 ATGCTGATGCTGCTTGCTCAGGG + Intronic
1131208253 15:90470475-90470497 ATGTTGATGCTGCTGGCCCAAGG + Intronic
1131670055 15:94610340-94610362 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1132250222 15:100330430-100330452 ATGCTGATGCTGCTGGCCCGGGG + Intronic
1133907528 16:10035665-10035687 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1133911513 16:10070309-10070331 ATGCTGATGCTGCTGGCCCATGG - Intronic
1133964646 16:10521713-10521735 AATCTGTTACTGCTAGAACATGG - Intergenic
1133974405 16:10590329-10590351 ACGCTGATGCTGCTGGTCCATGG - Intergenic
1133985391 16:10664446-10664468 ATGCTGATGCTGATGGTCCAAGG + Intronic
1134313326 16:13095964-13095986 ATGCTGTTGCTGCTGGTCCAAGG + Intronic
1134382725 16:13743281-13743303 ATGCTGATACTCCTTGAGAATGG + Intergenic
1134419799 16:14075607-14075629 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1134431233 16:14208535-14208557 AGGTTGATACTTCTGGAACATGG - Intronic
1134888624 16:17818423-17818445 ATGCTGATGCTGCTGATTCAGGG + Intergenic
1135046318 16:19158913-19158935 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1136054348 16:27677298-27677320 ATCCTGACACTGCTGGTCCAGGG - Intronic
1136135232 16:28252494-28252516 ATGCTGATGCTACTGGTCCATGG + Intergenic
1137572242 16:49574490-49574512 ATGCTGATGCTGCTGGTCCTTGG + Intronic
1137658106 16:50178636-50178658 ATGCTGACACTGCTGTAACATGG + Intronic
1137795962 16:51220269-51220291 ATGATGATTCAGCTAGAACAAGG + Intergenic
1138269955 16:55688705-55688727 ATGCTGATGCTGCTGGTCTATGG + Intronic
1138876274 16:60954240-60954262 ATGCTGATGCTGCTGTTCCAAGG - Intergenic
1138905921 16:61333148-61333170 ATGCTGAGGCTGCGGGAACAGGG - Intergenic
1139153766 16:64415894-64415916 ATGCTGATAGTGCTGGTCTAGGG + Intergenic
1139229818 16:65272881-65272903 ATGCTGATTCAGCTGGTCCAAGG - Intergenic
1139683310 16:68582109-68582131 ATGTTGATACTGCTGGCCCAGGG + Intergenic
1139756269 16:69146440-69146462 ATACTGATAATGCTGCAAGATGG - Intronic
1140525225 16:75617434-75617456 ATGCTGATGCTGCTGGTACAGGG - Intronic
1140785224 16:78335010-78335032 ATGCTGACACTGCAGGTCCAGGG - Intronic
1140832194 16:78762283-78762305 ATGCTGAAGCTGCTGGTTCATGG - Intronic
1141064756 16:80905019-80905041 ATGCTGGTTCTCCTGGAGCATGG - Intergenic
1141238662 16:82244161-82244183 ATGCTGATGCTGCTGGAATGTGG + Intergenic
1141293774 16:82747494-82747516 ATGCAGATGCTGCTGGTCCAGGG - Intronic
1141734029 16:85840395-85840417 ATGCTGGGACTGCAGGAAGAGGG + Intergenic
1142307858 16:89295549-89295571 GTGCTGGTGCTGCTGGAGCACGG + Intronic
1143252772 17:5535329-5535351 ATGCTCATGCTGCTGGTCCACGG + Intronic
1143945999 17:10592612-10592634 GTGCTGATGCTGCTGGCCCATGG - Intergenic
1143996978 17:11015033-11015055 ATGCTGATACTGCTGGTCGGGGG + Intergenic
1144088587 17:11833067-11833089 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144099389 17:11930585-11930607 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1144138078 17:12318409-12318431 ATGCTGATATTGCTGGTCCAAGG - Intergenic
1144146664 17:12405474-12405496 ATGCTGATGCTGCTGGCCCGTGG - Intergenic
1144194243 17:12875213-12875235 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144273632 17:13643892-13643914 AGGCTGATGCTGCTGGTCCAGGG - Intergenic
1144337458 17:14284466-14284488 ATGCTAATACTGCTGGTCCAAGG + Intergenic
1144377639 17:14661376-14661398 ATGTAGATGCTGCTGGAACATGG - Intergenic
1144385632 17:14746773-14746795 ATGTTGATGCTGCTGGTACTGGG + Intergenic
1144394102 17:14826842-14826864 ATGCTGATGCTGCTGGTCTAGGG - Intergenic
1146467767 17:33100161-33100183 ATGCTGATACTGCTGGTCAGAGG + Intronic
1146488016 17:33259899-33259921 ATGCTGATGCTGCTGGTCCTGGG + Intronic
1146521574 17:33529405-33529427 ATGCTGATGCCGCTGGCCCAGGG - Intronic
1146639615 17:34530483-34530505 ATACTAATACTGCTGGGCCATGG + Intergenic
1147997109 17:44366250-44366272 ATGCTGTTACTGTTGGCCCAGGG + Intergenic
1148220623 17:45859239-45859261 ATGCAGAGGCTGCTGGATCAGGG - Intergenic
1148549194 17:48540316-48540338 GTGCTGATGCTGCTGGTCCATGG + Intergenic
1148699872 17:49580932-49580954 ATGCTGATGCTGCTGCTCCAGGG + Intronic
1149026786 17:52036109-52036131 ATGTTGATGCTGCTGGGCCAGGG + Intronic
1149067116 17:52494081-52494103 ATGCTGACACTGTTGGTTCATGG + Intergenic
1149189507 17:54042569-54042591 ATGCTGATGCTGCCGGTCCAGGG + Intergenic
1149462088 17:56837060-56837082 ATGCTGATGCTGCTGGTCTAGGG - Intronic
1150320931 17:64213839-64213861 ATACTTGTGCTGCTGGAACAGGG + Exonic
1151003318 17:70403729-70403751 ATGCTGATGCTGCTAGTCCAAGG + Intergenic
1151036302 17:70804556-70804578 ATTCTGAGACTGCTGGAGCAGGG - Intergenic
1151372913 17:73660303-73660325 ATGCTGATGATGCTGGTCCAGGG + Intergenic
1151913661 17:77101712-77101734 ATGCTGATACTGCTGGTCTGAGG + Intronic
1153555595 18:6310081-6310103 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1153689131 18:7573918-7573940 ATGCTGATGCTGCTGGCTCAAGG - Intronic
1153776492 18:8458759-8458781 ATGCTGATACTGCTGGGTCTGGG - Intergenic
1154204581 18:12326048-12326070 ATCCTGGTACTGCTGGTACTCGG - Exonic
1154336684 18:13471570-13471592 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1155008080 18:21747441-21747463 ATGCAGATACTGCAGGCTCAAGG + Intronic
1155118289 18:22792204-22792226 ATGCCCATACTGCTGGTCCATGG - Intergenic
1155248958 18:23937641-23937663 ATGCTTATGCTGCTGACACACGG + Intronic
1156173441 18:34514409-34514431 ATGCTGACACTGCTGACCCAGGG + Intronic
1156367183 18:36440169-36440191 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1156420395 18:36946425-36946447 ATGCTGATGTTGCTGGTCCAGGG - Intronic
1156427866 18:37035270-37035292 ATGCTGATGCTGCTGGACTGGGG - Intronic
1157201431 18:45663222-45663244 ATGCTGATGCTACTGGTCCAGGG + Intronic
1157226318 18:45868253-45868275 ATGCTGATGCTGCTGTCCCAGGG + Intronic
1157471781 18:47994408-47994430 GTGCTGATGCTGCAGGGACAGGG + Intergenic
1157490301 18:48119161-48119183 ATGCTGATGCTGTTGGTTCAGGG + Intronic
1157710435 18:49846357-49846379 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1158476707 18:57786490-57786512 ATGCTGATGTTGCTGGTCCAGGG + Intronic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1159147685 18:64475680-64475702 ATGCTGATGCTGCTGGTCTAAGG - Intergenic
1159479567 18:68971013-68971035 ATGTTCATACTTCTTGAACATGG - Intronic
1160290298 18:77586919-77586941 ATGGTGATGCTGCTGGTCCAGGG - Intergenic
1160323899 18:77922636-77922658 ATGCTGATACTGCTTTAGCTTGG - Intergenic
1162832616 19:13296126-13296148 AGGCTGATACTACTGGTCCAGGG - Intronic
1163330917 19:16637179-16637201 ATGCTAATACTGCTGGTCCACGG - Intronic
1164455006 19:28399609-28399631 AGGCTGATAAAGCTGCAACAAGG - Intergenic
1164702391 19:30295156-30295178 ATGCTGATGCTGCTGGTCCTTGG + Intronic
1165734311 19:38166089-38166111 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1165908795 19:39211010-39211032 ATGCTGATGCTGTTGGTCCAGGG - Intergenic
1166068485 19:40374167-40374189 ATGCTGTTGCCGCTGGATCAGGG + Intronic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
1167220186 19:48194277-48194299 ATGGTGATGCTGCTGGTCCAGGG + Intronic
1168083350 19:54026857-54026879 ATGCTGACGCTGCTGGTTCAGGG - Intergenic
1168379324 19:55906853-55906875 ATGCTGCTCTTGCTGGATCATGG - Intronic
1202674729 1_KI270710v1_random:32438-32460 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
925635821 2:5940860-5940882 ACGCTGATGCTGCTGGTTCATGG - Intergenic
925866471 2:8232377-8232399 ATGCTGGAACTGGTGGGACAGGG - Intergenic
926309024 2:11661078-11661100 ATGTTGACACTGCTGGTCCAGGG - Intronic
926422552 2:12714641-12714663 CAGCTGCCACTGCTGGAACATGG + Intergenic
926597400 2:14806192-14806214 ATGCTGGCACTGCTGGTCCAGGG + Intergenic
926671150 2:15578061-15578083 ATGCTAATACTCCTGGTCCAGGG - Intergenic
926760669 2:16276216-16276238 ATGCTGATACTGCTTTTCCAGGG - Intergenic
926768828 2:16350021-16350043 TTGCTGATACTGCTGGTCCAGGG + Intergenic
927084322 2:19659498-19659520 ATGCTGCCGCTGCTGCAACATGG + Intergenic
927290634 2:21401745-21401767 ATGCTGATACTGCTGGTTCAAGG + Intergenic
927340503 2:21978433-21978455 ATGCTGATATTGCTGGTCCCAGG - Intergenic
927436168 2:23068379-23068401 ATGTTGATGCTGCTGGTTCAAGG - Intergenic
927553840 2:24019218-24019240 TTGCTGATGCTGCTGGTCCAGGG - Intronic
927776501 2:25907903-25907925 ATGCTAATACTGCTGGTCCCAGG + Intergenic
928246936 2:29638538-29638560 ATGCGGATAATGCTGGGGCAGGG + Intronic
928579550 2:32693321-32693343 ACGCTGATGCTGCTGGTCCAGGG - Intronic
928912193 2:36433082-36433104 ATGCCGATGCTGCTGGTGCAAGG + Intronic
929054261 2:37862625-37862647 CTGCTGAGACTGGAGGAACATGG + Intergenic
929419569 2:41777112-41777134 ATGCTGGTCCTGCTGGTTCAGGG - Intergenic
929615487 2:43303935-43303957 ATGCTGATGCTGCTGGGGCAGGG + Intronic
929629135 2:43441196-43441218 ATGCTCAGAGTGCTTGAACAAGG - Intronic
930527942 2:52554750-52554772 ATGCTGATATTGCTGGTCCAGGG - Intergenic
930804742 2:55479161-55479183 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
931080035 2:58758645-58758667 ATGTTGATACTGCTGGTTTAAGG - Intergenic
931381567 2:61758207-61758229 ATGCTGATGCTGCTGATTCATGG + Intergenic
931440808 2:62289073-62289095 ATGCTGATATTGCTGGTCCTGGG + Intergenic
931569194 2:63650328-63650350 ATGCTTATGCTGCTGGTCCAGGG + Intronic
931700122 2:64902545-64902567 ATGCCGATGCTGCTGGCCCAGGG + Intergenic
932042655 2:68317747-68317769 ATGCTGATACTGCTGGTCCAGGG - Intronic
932130729 2:69185114-69185136 ATGCTGATGCTGCTGTTCCAGGG - Intronic
932416745 2:71578200-71578222 ATGCTGATGCTGCTGGTCCAGGG + Intronic
932712471 2:74077362-74077384 ATGCTGATGCTGCTGGCCCTGGG + Intronic
932753751 2:74390696-74390718 ATGCTAATGCTGCTGGCCCATGG - Intronic
933196593 2:79397054-79397076 ATGCTGACACTGCTGGTCCAGGG + Intronic
933600284 2:84321937-84321959 ATGCTGATGCTGCTGGGCCATGG + Intergenic
933691563 2:85182940-85182962 ATGCCGATGCTGCTGGTCCAGGG + Intronic
933891845 2:86779027-86779049 ATGCTGATGCTGCTGGTCCATGG - Intergenic
934059771 2:88283242-88283264 ATGCCGATGCTGCTGGTCCAGGG + Intergenic
934733420 2:96673737-96673759 ATGCGGATGCTGCTGGCCCAGGG - Intergenic
934903823 2:98181879-98181901 ATGCTAACACTGCTGGTCCAGGG + Intronic
935203995 2:100881981-100882003 ATGCTGAAACTGCTGGGGCTGGG + Intronic
935384001 2:102482402-102482424 ATGATGATACGCCTAGAACAAGG + Intronic
935557493 2:104526258-104526280 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
935619073 2:105113060-105113082 ATGCTGATCCTGCTGGTCCAGGG + Intergenic
935763331 2:106341828-106341850 ATGCTAATGCTGCTGGTCCAGGG + Intergenic
935935676 2:108180423-108180445 AAGCTGATGCTGCTAGATCAGGG + Intergenic
936012712 2:108935335-108935357 ATGCTAATGCTGCTGGTCCAGGG - Intronic
936652761 2:114448492-114448514 ATGCTGATACTGCTGGTCTAGGG - Intronic
936724678 2:115298795-115298817 ATGCTGATCCTACTGGTCCATGG + Intronic
936976959 2:118230129-118230151 ATGCTGATGCTGCTGGCGCTTGG - Intergenic
937056502 2:118941811-118941833 ATACTAATACTGCTGGTCCATGG + Intergenic
937680416 2:124638260-124638282 ATACTGACATTGCTGAAACAAGG - Intronic
937701258 2:124865608-124865630 ATGCTGATACTGGTGGGACATGG - Intronic
938590005 2:132727439-132727461 ATGCTGATGCTGCTGATCCATGG - Intronic
938590325 2:132729615-132729637 ATGCTGATGATGCTGGCCCATGG + Intronic
938760835 2:134424438-134424460 CTGCTGAAACTGCTGAAACTGGG - Intronic
939220999 2:139301471-139301493 ATGCTGATAATGCTGGATCAAGG - Intergenic
939848685 2:147278510-147278532 ATGCTGATACTGCTAGTTCAGGG + Intergenic
940202471 2:151166746-151166768 ATGCTGATACTGCTAGAATGGGG + Intergenic
941068009 2:160924961-160924983 ATGCTCATGCTGCTGGTCCAGGG + Intergenic
941291037 2:163675418-163675440 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
941389567 2:164894982-164895004 ATGCTGCTGCTGCTGGTTCAGGG - Intergenic
941548753 2:166888397-166888419 AATCTGATTCTGATGGAACATGG + Intergenic
941746761 2:169095196-169095218 ATGCTGATGCTGCTGGTCCAGGG - Intronic
942107438 2:172647054-172647076 ATGATCATGCTGCTGGTACATGG + Intergenic
942220186 2:173761609-173761631 ATGCTGAAGCTGCTGGTTCATGG - Intergenic
942838344 2:180328974-180328996 ATGCTGCTACTGCTGGGGGATGG - Intergenic
943268077 2:185763128-185763150 AAGCTGATATTGCTGGGACAAGG - Intronic
943285554 2:185994341-185994363 ATCCTGAGAGTGCTGGATCAAGG + Intergenic
943394636 2:187318732-187318754 ATGCTGATGCACCTGGACCAGGG - Intergenic
943598360 2:189884846-189884868 ATGCTGATGCTGCTGGTTCAGGG + Intronic
944556773 2:200894940-200894962 ATGCTGATGTTGCTGGTCCAAGG - Intronic
944658979 2:201904674-201904696 ATGCTGATGTTGCTGGTACAGGG - Intergenic
945412470 2:209527721-209527743 ATGCTGATGGTGCTGGTTCAGGG - Intronic
945435825 2:209816631-209816653 ATGCTGATGCTGCTGGTCCAGGG + Intronic
945446254 2:209941738-209941760 ATGCTGATGCTGCTGGCCCAGGG - Intronic
945860294 2:215113530-215113552 ATGCTGATGCAGCTGGTCCATGG + Intronic
946063662 2:216967952-216967974 ATGCTCCTCCTGCTGGAACTGGG - Intergenic
946704510 2:222445146-222445168 TTGCTGCTGCTGCTGGAACCTGG + Intronic
946854416 2:223939118-223939140 ATGCTGATGCTGCTAGTCCAGGG - Intronic
947861093 2:233357867-233357889 ATGCTGATGCTGCTGGTCCATGG + Intronic
948084772 2:235238290-235238312 GTGCTGATGCTGCTGGTGCAGGG - Intergenic
948708456 2:239810397-239810419 ATGCTGATGCTGCTGGTTCCTGG + Intergenic
948812993 2:240494523-240494545 AAGCTGTCACTGCTGGGACAGGG - Intronic
1168850203 20:971325-971347 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1169325170 20:4669953-4669975 ATGCGGATGCTGCTGGTCCAGGG + Intergenic
1169333235 20:4732926-4732948 ATGTTGATGCTGCTGGTCCATGG + Exonic
1169503664 20:6185499-6185521 ATGCTGATGCTGCTGGTCCCAGG - Intergenic
1169509200 20:6245410-6245432 ATGCTGATGCTGCTGTTCCAGGG + Intergenic
1169675354 20:8147132-8147154 ATGCTGATGCTGTTGGTCCAGGG - Intronic
1169748384 20:8965935-8965957 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
1169797427 20:9478773-9478795 ATGCTGATGCTGCTTGTACATGG + Intronic
1169847726 20:10013775-10013797 ATGCTGTTGCTGCTGGTCCAAGG - Intronic
1170009274 20:11703788-11703810 ATGCTGATGCAGCTGGTCCAGGG - Intergenic
1170040445 20:12034544-12034566 ATGCTGATTCTGTTGGTCCATGG + Intergenic
1170096720 20:12653314-12653336 ATGCTGACACTGCTGGCCCAAGG + Intergenic
1170364734 20:15586311-15586333 ATGCTAATACTGCTGGCCCAGGG + Intronic
1170402574 20:16004001-16004023 ATGGTGGTACTGCTGGTCCAGGG + Intronic
1170412284 20:16104625-16104647 ATGCTGATACTGCTGGGCAAGGG - Intergenic
1170557865 20:17530155-17530177 ATGCCAATACTGCTGGTCCATGG + Intronic
1170759109 20:19234189-19234211 ATGCTGATGCTGCTGTTCCAAGG - Intronic
1170777503 20:19390603-19390625 ATGCTGAGTTTGCTGGACCATGG + Intronic
1170784974 20:19460006-19460028 ATGCTGATACTGCTGGCCCGTGG + Intronic
1170846946 20:19970155-19970177 ATGCTGATGCTGCTGGACCCTGG - Intronic
1171041330 20:21766452-21766474 ATGCTGATGCTGCTAGTCCAAGG - Intergenic
1171377675 20:24704491-24704513 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1171964557 20:31519555-31519577 ATGCTGACACTGCTGGCCCAGGG - Intronic
1172374793 20:34429512-34429534 ATGCTGATGCTGCTAGACCAGGG + Intronic
1172684257 20:36741748-36741770 ATGCTGATGCTGCTGGTCTAAGG - Intronic
1172976818 20:38912329-38912351 ATGCTGATGTTGCTGGTACAGGG - Intronic
1173026210 20:39309818-39309840 ATGCTAATGCTGCTGGTTCATGG + Intergenic
1173066639 20:39719419-39719441 ATGCTGATGCTGCTTGTCCAAGG - Intergenic
1173304705 20:41837184-41837206 ATGCTGATGCTGCTGGTCTAAGG - Intergenic
1173343548 20:42177225-42177247 ATGCTGATGATGCTGGTCCATGG + Intronic
1173349523 20:42232465-42232487 ATGCTGATGCTACTGGTCCAGGG + Intronic
1173451842 20:43171773-43171795 ATGCTGACACTGCTGGTCCAGGG + Intronic
1173704391 20:45099214-45099236 ATGCTGATGCTGCTGGTCCGGGG - Exonic
1173725612 20:45295282-45295304 ATGCCGATGCTGCTGGTCCAAGG - Intronic
1174132678 20:48357152-48357174 ATGCTGATGTTGCTGGTCCATGG + Intergenic
1174530892 20:51213070-51213092 ATGCTGATGCTGTTGGTACAGGG + Intergenic
1174709269 20:52687428-52687450 ATGCTGATGCTCCTGGTCCAGGG + Intergenic
1174732202 20:52928839-52928861 ATGCGGATGCTGCTGGTCCAGGG - Intergenic
1175573659 20:60043298-60043320 ATGCTGATGCTGCCGGTCCAGGG - Intergenic
1175677767 20:60961563-60961585 ATGCTGATACTGCTGGTCTGAGG - Intergenic
1175677771 20:60961609-60961631 ATGCTGATACTGCTGGTCTGTGG - Intergenic
1176637209 21:9257742-9257764 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
1176987049 21:15449307-15449329 ATACTGATAATGCTACAACATGG - Intergenic
1177536821 21:22439183-22439205 ACGCTGATACTGCTGGTTCATGG - Intergenic
1178454518 21:32735739-32735761 ATGCTGATACTGCTGGTCCAGGG + Intronic
1178765021 21:35442274-35442296 ATGCTGACACTGCTGGTGCAGGG + Intronic
1179377467 21:40863455-40863477 ATGCTGACACTGCTGCTCCATGG + Intergenic
1180681746 22:17632141-17632163 ATACTGATAATGCTGGATAAAGG + Intronic
1181825384 22:25511136-25511158 ATTCTGATACTGATGGTCCAGGG + Intergenic
1181856787 22:25787408-25787430 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1181867525 22:25870684-25870706 ATGCTGATGCTGCTGGTTCAGGG - Intronic
1181913165 22:26256682-26256704 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1183038408 22:35157919-35157941 GTGCTGATGCTGCTGGATCTGGG - Intergenic
1183093110 22:35536838-35536860 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1184842761 22:47062195-47062217 ATGCTGAGGCTGCTGGTCCAGGG - Intronic
949371295 3:3337410-3337432 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
949465629 3:4340225-4340247 ATGCTGATGCTGCTGAATCCGGG + Intronic
949830002 3:8204117-8204139 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
949934688 3:9107607-9107629 ATGCTGCTGCTGCTGGTTCAGGG - Intronic
949961712 3:9317773-9317795 ATGCTGATGCTGCTGGTCCAGGG + Intronic
950010096 3:9716879-9716901 ATGCTGATGCTGCTGGCTCATGG - Intronic
950495548 3:13331946-13331968 ATGCTGATGCTTCTGGCTCATGG + Intronic
950652080 3:14413512-14413534 ATGCCCATACTGCTGGGCCAGGG - Intronic
950892929 3:16420926-16420948 ATGCTGATGCTGCTGGTGCATGG + Intronic
951068044 3:18290537-18290559 ATGCTGTTGCTGCTGGTCCAGGG + Intronic
951105053 3:18732629-18732651 ATGCTGATGCTGCTGAAACCAGG - Intergenic
951192900 3:19790883-19790905 ATGCTGATGATGCTGGTCCAGGG + Intergenic
951471886 3:23065277-23065299 ATGCTGATGCTGTTGGCACGTGG - Intergenic
951530985 3:23697927-23697949 ATGGTGATGCTGCTGGTCCAGGG - Intergenic
951612313 3:24504192-24504214 ATGCTGATACTGCTAGAGGGAGG - Intergenic
951657741 3:25028388-25028410 ACACTGATACTGCTGGTCCAGGG - Intergenic
951689572 3:25381704-25381726 ATGCTGATGCTGCTGGTCCAAGG - Intronic
951729278 3:25792722-25792744 ATGGTGATACTGCTGGTTTAAGG + Intronic
951766365 3:26204066-26204088 ATGCTGATGCTGTTGGACCAGGG + Intergenic
951786439 3:26424800-26424822 ATGCTGATGCGGCTGATACAGGG + Intergenic
951941415 3:28082947-28082969 ATGCTGATGCTACTGGTTCATGG - Intergenic
952112873 3:30144845-30144867 ATACTGATATTGCTGGACTATGG - Intergenic
952329635 3:32352376-32352398 ATGCTGATGCTGCTGGCTCAGGG - Intronic
952427297 3:33188587-33188609 ATGTTGAGACTGCTGGTACAAGG + Intronic
952622483 3:35362162-35362184 ATGCTGATGCTGCTAGTCCAGGG + Intergenic
952740409 3:36728911-36728933 ATGCTGATGGTGCTGGTCCAGGG - Intronic
952857065 3:37780975-37780997 ATGCTGATGCTGCTGGTCCTCGG - Intronic
953199999 3:40770064-40770086 ATGCTGATGCTGCTGGCCCTGGG - Intergenic
953224260 3:41001995-41002017 ATGCTCATGCTGCTGGTGCATGG + Intergenic
953704880 3:45223697-45223719 ATGCTGATGTTGCTGGTCCAGGG + Intergenic
953795342 3:45981077-45981099 ATGCTGATGCTGCTGGTCTATGG + Intronic
953843819 3:46410917-46410939 ATGCAGATACTGCTGACCCAAGG + Intronic
954642943 3:52112907-52112929 ATGCTGATGCTGCTGATCCAGGG - Intronic
954954798 3:54509668-54509690 ATGCTCATATTGCTGGAATAGGG - Intronic
955531157 3:59874511-59874533 ATGCTGATGCTGCTGGTCCAGGG + Intronic
955837061 3:63067662-63067684 ATGCTGATGTTGCTGGCCCATGG - Intergenic
956304893 3:67812865-67812887 ATGCAGATGCTACTGGTACAGGG + Intergenic
956988122 3:74728319-74728341 ATGCTGACACTGCTGGTTCATGG + Intergenic
957015504 3:75059484-75059506 ATCCTGATACTGCTGGATCATGG - Intergenic
957103683 3:75859203-75859225 ATGCTGATGCTGCTAGCACAGGG + Intergenic
958882737 3:99691471-99691493 ATGCTGATGCTGCTGGTCCATGG - Intronic
959022332 3:101201461-101201483 ATGCTGATGCTACTGGTCCAGGG + Intergenic
959051766 3:101531208-101531230 ATGGTGATGCTGCTGGTCCAAGG + Intergenic
959374457 3:105571261-105571283 ATGCTGATACTGCTGGTCTGGGG + Intronic
959774589 3:110141718-110141740 ATACTGATGCTGCTGGTCCAAGG + Intergenic
959912466 3:111779127-111779149 ATGTTGATGCTGCTGGTCCAGGG + Intronic
960171095 3:114461701-114461723 ATGCTGATGCTGCTGGCCCAAGG - Intronic
960536796 3:118824050-118824072 ATGCTGATACAGCTGTTTCAGGG + Intergenic
960639412 3:119811925-119811947 ATGCTGATGCTGCTGACCCAGGG - Intronic
960949208 3:122988164-122988186 ATGCTGCTGCTGCTGGTGCAAGG + Intronic
962099859 3:132330369-132330391 ATGGTGATGCTGCTGGTCCAGGG - Intronic
962171975 3:133110895-133110917 ATGCTAATGCTGCTGGTCCAGGG + Intronic
962207609 3:133447759-133447781 ATGCTGATCCTGCTGGTCCTGGG + Intronic
962364067 3:134765778-134765800 ATGCTGATGCTGCTGGCCAAAGG - Intronic
962386899 3:134939065-134939087 ATGCAGATAATACTGTAACAAGG - Intronic
962425029 3:135262137-135262159 CTGCTGATGCTGCTGGTCCAGGG + Intergenic
962875313 3:139531588-139531610 ATGCTGATGCTGTTGGTTCAAGG - Intronic
962938831 3:140107078-140107100 ATGCTGGTACAGCTGAAAAAAGG + Intronic
962942676 3:140140139-140140161 ATGCTGATGCTGATGGTCCAGGG + Intronic
962953579 3:140243710-140243732 ATGCTGACACTGCTAGCCCATGG - Intronic
962971175 3:140403480-140403502 ATGCTGATGCTGCTGGCTCGTGG + Intronic
963254795 3:143134174-143134196 GGGCTGATACTGCTGGTCCAAGG - Intergenic
963346686 3:144103385-144103407 ATGCTGACACTGCTGGTCCAGGG + Intergenic
963547633 3:146680855-146680877 ATGCTAATACTGCTTGAGAATGG + Intergenic
963734416 3:149003720-149003742 ATGCCCATGCTGCTGGAACCCGG + Intronic
963756751 3:149242498-149242520 ATGCTGATGCTGCTGGTCCTTGG + Intergenic
963901441 3:150736849-150736871 ATGCTGATGCCGCTGGTGCACGG + Intergenic
964161364 3:153649317-153649339 ATGTTGATGCTGCTGGTTCAAGG + Intergenic
964503263 3:157371491-157371513 ATGCTGATGCCGCTGGTCCAGGG - Intronic
964621186 3:158721434-158721456 ATGCTGATCCTGTTGGTCCAGGG + Intronic
964665926 3:159171893-159171915 ATGTTGATACTTCTGGTCCAAGG + Intronic
964723324 3:159789654-159789676 ACGCTGATTCTGCTGGTCCAGGG + Intronic
964989120 3:162784944-162784966 ATTCTGATGCTGCTGGTGCAGGG - Intergenic
965507466 3:169532272-169532294 ATGCTGATGCTGCTGGCCCAGGG + Intronic
965513437 3:169594404-169594426 ATGCTGATACTGCTAGTCCAGGG - Intronic
965641006 3:170829018-170829040 ATGCTGATGCTGCTGGTCCAGGG - Intronic
965867802 3:173226575-173226597 AAGCTGATGCTGCTGGTCCAGGG + Intergenic
966402850 3:179564052-179564074 ATGCTGACACTGCTGGTCCATGG - Intronic
966927527 3:184655099-184655121 ATGCTGATGTTGCTGGTCCAGGG + Intronic
967113196 3:186313571-186313593 ATGCTGATGCTGCTGGTCCAGGG - Intronic
967319567 3:188182234-188182256 ATACTGATGCTGCTGGCCCAAGG - Intronic
967738551 3:192980314-192980336 ATGCTGATGCTGCTGATCCAGGG + Intergenic
967874640 3:194259272-194259294 ATGCTGATGCTGCTGGCCCATGG + Intergenic
967966743 3:194966629-194966651 ATGCCGACACTGCTGGTCCATGG - Intergenic
967977800 3:195045105-195045127 ATGTTGATGCTGCTGGACCCAGG - Intergenic
968019018 3:195367271-195367293 GTGCTGATGCTGCTGGTCCAGGG + Intronic
1202749685 3_GL000221v1_random:147277-147299 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
969954726 4:10877168-10877190 ATGCTGATGCTGCTGGCCCAAGG - Intergenic
970019834 4:11555596-11555618 ATGCTGATACTGTTAGTCCATGG + Intergenic
970474708 4:16410539-16410561 GTGCTGCTTCTGCTGAAACAGGG - Intergenic
971108031 4:23548704-23548726 ATGATGATGATGCTGGCACAAGG + Intergenic
971464476 4:26940945-26940967 GTGCTGATACTGCTGGTCCAGGG + Intronic
972447800 4:39162836-39162858 ATGCTGATTTTGCTGGTCCAGGG - Intergenic
973226765 4:47793909-47793931 ATGCTGATGCTGCTCGTCCATGG + Intronic
973869283 4:55148844-55148866 ATGCTAATGCTGCTGGTACATGG + Intergenic
974675385 4:65081050-65081072 ATGGTGATGCTGCTGGTCCATGG + Intergenic
974780030 4:66543139-66543161 ATGTTGACACTGCTGGGGCATGG - Intergenic
975575965 4:75862980-75863002 AAACTGATACTGCTGCAACATGG + Intronic
976088017 4:81425955-81425977 ATGCTGATGCTGCTGGTCCTGGG - Intergenic
976101988 4:81574478-81574500 CTGCTGTTACTGCTGGACCCTGG - Intronic
976164713 4:82242014-82242036 ATGCTGATGCTGATGGCCCAAGG - Intergenic
977152409 4:93529368-93529390 GTGCTGATGCAGCTGGACCAGGG - Intronic
977163822 4:93671118-93671140 ATCCTAAGACTGCTGGAAAAGGG + Intronic
977418438 4:96764643-96764665 ATGCTGAGACTGTTGGAACCCGG + Intergenic
978503003 4:109428958-109428980 ATGCTGATGCTGCTGATCCATGG - Intergenic
978588198 4:110295224-110295246 GTGCTGATTCTGGTGGAGCAAGG - Intergenic
980693103 4:136320984-136321006 ATGCTAAGCCTCCTGGAACAGGG - Intergenic
981718887 4:147779156-147779178 ATGCTGATGTTGCTGGTTCAGGG + Intronic
981732942 4:147919315-147919337 ATGCTGATACTGTAGCAAAATGG - Intronic
981826017 4:148942502-148942524 ATGCTGATGCTGCTGGCTTATGG + Intergenic
982035252 4:151339586-151339608 ATGCTGACGCTGCTGGTCCATGG - Intergenic
982092701 4:151894300-151894322 ATGATGATAATGCTGGTCCAGGG - Intergenic
982300158 4:153870058-153870080 ATGCTGATGCTACTGGTTCAGGG + Intergenic
982658574 4:158178814-158178836 AAGCTGATGCTGCTGGTTCAGGG - Intergenic
983539138 4:168889848-168889870 ATGCTAATGCTGCTGGTCCAGGG + Intronic
983701480 4:170600713-170600735 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
983823395 4:172225828-172225850 ATGCTGATGCTGCTGGTCTATGG + Intronic
983905507 4:173177229-173177251 ATGCTGATGCTGCTGGTCCAGGG + Intronic
984086037 4:175312137-175312159 ATGCTCATTTAGCTGGAACATGG + Intergenic
984716752 4:182933244-182933266 TTGCTGTTACTTCTGGAGCAGGG - Intergenic
1202752102 4_GL000008v2_random:16169-16191 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
985726191 5:1516922-1516944 AAGCTCATGCTGCTGGCACATGG + Intronic
986073470 5:4310929-4310951 ATGCTCATGCTGCTGGTACTTGG + Intergenic
986178246 5:5369902-5369924 ATGCTGATACTGCCAGTCCAGGG + Intergenic
987025332 5:13921277-13921299 ATGCTGATCCTGCTGGGATTGGG - Intronic
988035418 5:25822210-25822232 ATGCTTACATTGATGGAACATGG - Intergenic
988293716 5:29326616-29326638 GTACTGATACTGCTACAACATGG + Intergenic
988706881 5:33735314-33735336 ATGCTGATGCTGCTGGTCCGGGG + Intronic
988766459 5:34382675-34382697 ATGCAGACACTACTTGAACATGG + Intergenic
988799474 5:34683061-34683083 ATGCTGAGACAGCTGGCACCTGG + Intronic
990687756 5:58326225-58326247 ATGTTGATATTTCTGAAACATGG - Intergenic
991399050 5:66234724-66234746 ATGCTGATGCTGCTGGTTCTGGG + Intergenic
991405128 5:66293962-66293984 ATGCTGATGCTGCTGGTTCTGGG - Intergenic
992465635 5:77001055-77001077 ATGTTGATGCTGCTGGACCAGGG + Intergenic
992496300 5:77297511-77297533 ATGCTGATGCTGCTGGTTCAGGG + Intronic
992714627 5:79497863-79497885 ATGCTGATGCTGCTGGTCCAGGG - Intronic
992890037 5:81195636-81195658 ATGCTGATGCTGCTGGCCCGGGG - Intronic
993199003 5:84788353-84788375 ATGCTGGTAATGCTGGTAGAAGG + Intergenic
993564482 5:89456164-89456186 ATGCTGAAAGTTCAGGAACAGGG - Intergenic
994351762 5:98753830-98753852 ATGCTGTTGCTGTTGGACCAGGG + Intergenic
995549077 5:113262845-113262867 ATGCTGATACTGCTGGTTCACGG + Intronic
995600712 5:113792248-113792270 ATTCTGATAATGCTACAACATGG + Intergenic
995836128 5:116401342-116401364 ATGCAGATGCTGCTGGTCCACGG + Intronic
996465639 5:123799434-123799456 ATGCTGATACTGCTGGCCCAGGG + Intergenic
996577247 5:124988975-124988997 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
997531041 5:134581474-134581496 GTGCTGAGACTGCTGGACCCTGG - Exonic
997614285 5:135235935-135235957 ATGCTGATGTTGCTGGTCCAGGG + Intronic
997628525 5:135348528-135348550 GTCCTGAGACTGCTGGAAGAAGG - Intronic
998240504 5:140439014-140439036 ATGCTGATACTGCCAGTCCATGG - Intronic
998257773 5:140601693-140601715 ATGCTGAGACTGCTGGCACAGGG - Intergenic
998313604 5:141158231-141158253 ATACTGATAATTCTGGGACAGGG - Intergenic
998466230 5:142346429-142346451 ATGCTGCCACAGCTGGAATAAGG + Intergenic
998603841 5:143613743-143613765 AGGCTGAAGCTGATGGAACAGGG + Intergenic
999626678 5:153528582-153528604 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1000348173 5:160331865-160331887 ATGCTGATGCTGCTGGTTCAGGG - Intronic
1000452124 5:161402682-161402704 ATACAGATACTGCTGGTGCAGGG - Intronic
1000568884 5:162885544-162885566 TTGCTGATACTGCTGGTCCAGGG - Intergenic
1000836407 5:166160211-166160233 ATGCTGATGCTGCTGATACAGGG + Intergenic
1001279603 5:170377349-170377371 ATCCTGATGCTGCTGGCCCAGGG + Exonic
1001780475 5:174364625-174364647 ATGCTGATGCTGCTGGCCCAGGG - Intergenic
1001916843 5:175569029-175569051 ATGGTGATACAGCTGGATGAGGG + Intergenic
1002168989 5:177364870-177364892 ATGCTGATGCTGCTGGTTCAGGG - Intronic
1002185109 5:177450761-177450783 ATGCTGGTACTGCAGGGCCAGGG - Intronic
1003025359 6:2550302-2550324 ATGCTGATGCTGCCGGTCCATGG - Intergenic
1003120590 6:3316123-3316145 ATGCTGATGCTGCTGGCCCAGGG + Intronic
1003328538 6:5110880-5110902 ATGCTGATGCTGCTGGTCCACGG + Intronic
1003389292 6:5699400-5699422 ATGTTGATACTGCTGGTCTATGG - Intronic
1003444708 6:6173965-6173987 ATGCTGATGCAGCTGGCTCATGG + Intronic
1003534904 6:6968370-6968392 ATGCTGATGCTGCTGGTCCTTGG - Intergenic
1003633172 6:7807238-7807260 ATGCTGATGCTGCTGGTCCATGG - Intronic
1003826708 6:9960832-9960854 ATGCTGATGCTGCTGGTGCAAGG + Intronic
1003830150 6:10000544-10000566 ACGCTGATATTGCTGGCCCAGGG - Intronic
1004171462 6:13298731-13298753 ATGCTGATGCTGCTTGTCCAGGG - Intronic
1004191210 6:13465383-13465405 ATGCTGATGCTGCTGGTTCATGG - Intronic
1004319729 6:14622874-14622896 ATGCAGTTGCTGCTGGACCAGGG - Intergenic
1004409043 6:15363288-15363310 ATGCTAATGCTGCTGGTTCAGGG - Intronic
1004534775 6:16489957-16489979 ATGCTGATACTGCTGGTCCAGGG + Intronic
1004582594 6:16968617-16968639 ATGCTGATGTTGCTGGTTCAAGG + Intergenic
1004966984 6:20863172-20863194 ATGCTGATACTGCTGGTGCATGG + Intronic
1005106602 6:22230379-22230401 ATGGTGATGCTGCTGGCTCAGGG - Intergenic
1005854349 6:29849624-29849646 ATGCTGGTTCTGCTGGTTCATGG - Intergenic
1006170960 6:32092255-32092277 ATGCTGATGCTGCAGGTCCAGGG + Intronic
1007035520 6:38669411-38669433 ATGCTGATGCTGCCGGTACAGGG + Intergenic
1007163958 6:39815040-39815062 ATTCTGATACTGCTGGTCTAAGG - Intronic
1007311729 6:40952085-40952107 ATGCTGATGCTGCTAGTCCAGGG - Intergenic
1007316176 6:40991004-40991026 ATGTTGATGCTGCTGGTACAAGG - Intergenic
1008081278 6:47196845-47196867 AAGCTGATGCTGCTGGTTCAGGG - Intergenic
1008391223 6:50954304-50954326 ATGCTGATGTTGCTGGTCCAAGG + Intergenic
1008639651 6:53448884-53448906 ATGCTGCTACTGCTGGTCCAGGG - Intergenic
1009449530 6:63785060-63785082 ATGCTGATATTGCTGACCCAGGG + Intronic
1010787992 6:80027956-80027978 ATGCTGTTGCTGCTGGAAACAGG - Exonic
1011732555 6:90280701-90280723 ATGCCGATGCTGCTGGTCCAGGG + Intronic
1011739996 6:90350000-90350022 ATGCTGCTGCTGCTGGTCCAGGG + Intergenic
1012445043 6:99298479-99298501 ATGCTGATACTGCTGCTCCAGGG + Intronic
1013309919 6:108884263-108884285 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1013623494 6:111914343-111914365 ATGCTGATGCTGCTGGTCTAAGG - Intergenic
1013765430 6:113568802-113568824 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG + Intronic
1015423001 6:133032797-133032819 ATGCTGATGGTGCTGGTCCAAGG - Intergenic
1015433410 6:133156580-133156602 ATGCAGATATTGTTGGAAAATGG + Intergenic
1015512651 6:134054058-134054080 CTGCTGATAGTGCTAGAAAATGG + Intergenic
1015864778 6:137717039-137717061 ATGCTGATTCTGCTGGTCTAAGG + Intergenic
1016356377 6:143223188-143223210 ATGCTGATGCTGCTGGCACAGGG - Intronic
1016376136 6:143422377-143422399 ATGCCCATAGTGCTGGACCATGG - Intergenic
1017795127 6:157836922-157836944 ATGCTGATGCTGCTGGTCTAGGG + Intronic
1017873135 6:158502941-158502963 AAGCTGACAGTGCTGGGACAGGG - Exonic
1019053631 6:169203783-169203805 ATACTGATACAGCTACAACATGG - Intergenic
1019310249 7:356982-357004 AGGCTGCTGCTGCGGGAACAGGG + Intergenic
1019519335 7:1453625-1453647 ATGGTGAGACGGCTGGAACTGGG + Intronic
1019584185 7:1787831-1787853 ATGCTGGTACTGCCGGTGCATGG + Intergenic
1020371932 7:7441735-7441757 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1020463560 7:8450693-8450715 AAGATGATACTGCTGCAAAATGG - Intronic
1021290035 7:18831906-18831928 ATGCTGAAACTGCTGGACAAAGG - Intronic
1021327192 7:19287670-19287692 ATGCTGATGCTGTTGGACCTTGG + Intergenic
1021372307 7:19863736-19863758 ATGCTTATGCTGCTGGTATAGGG - Intergenic
1021817984 7:24466897-24466919 ATGGGGATACTGCTGGTCCAGGG + Intergenic
1021903395 7:25310084-25310106 GTGCTGATGCTGCTGGTTCAGGG - Intergenic
1022047477 7:26633761-26633783 ATGCTGATGCTGTTGGTTCATGG - Intergenic
1022128499 7:27380468-27380490 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1022256566 7:28664077-28664099 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1022501626 7:30885649-30885671 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1022745401 7:33166720-33166742 TTGCTGAGACTGTTGGAAAAGGG + Intronic
1022799402 7:33761400-33761422 ATGCTGATGCTGCTGGACCAGGG + Intergenic
1023044841 7:36201962-36201984 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1023185682 7:37530583-37530605 ATGCTGATGCTGCAGGCCCAAGG + Intergenic
1023760655 7:43462438-43462460 ATCCTGATGCTGCTGGCCCAGGG - Intronic
1024305946 7:47929683-47929705 ATGCTGATGCTGCTGGCCCTGGG - Intronic
1024650001 7:51395340-51395362 ATACTGCTACTGCACGAACATGG - Intergenic
1026059253 7:67011457-67011479 ATGCTGATGCTGCTGGCTCAGGG - Intronic
1026369160 7:69681516-69681538 AAGGTCATACTGCTGGACCAGGG + Intronic
1026718842 7:72813590-72813612 ATGCTGATGCTGCTGGCTCAGGG + Intronic
1027527391 7:79287114-79287136 ATGCTGATGCTGCTAGTTCAAGG - Intronic
1027584096 7:80035264-80035286 ATGCTGATGCTGCTGGTCTATGG - Intergenic
1027775109 7:82455158-82455180 ATACTGATTCTGCTGGTAAACGG + Intergenic
1028473756 7:91232031-91232053 AAACTGATACTGCTTGAGCAAGG + Intergenic
1028838493 7:95400335-95400357 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1029802706 7:102966349-102966371 ATGCTGATACTACTGGTTCCAGG + Intronic
1030084632 7:105805968-105805990 ATGCTGAGCTTGCTGGAACAAGG + Intronic
1030408451 7:109144010-109144032 ATGTTGCCACTGCTGGAAGAGGG + Intergenic
1030650187 7:112109175-112109197 ATGCTGCTTCTGCTGCACCAGGG - Intronic
1031556550 7:123183615-123183637 ATGCTGACGCTGCTGGTTCATGG - Intronic
1032313085 7:130806585-130806607 ATGCTGAGGCTGCTGGACCAGGG + Intergenic
1032442953 7:131956189-131956211 ATGCTGATGCTGCTGGTTCAGGG - Intergenic
1032710231 7:134454776-134454798 GTGCTGATAATCCTGGAGCAAGG + Intronic
1032848622 7:135773197-135773219 ATGCTGGTGCTGCTGGTTCAGGG - Intergenic
1032989437 7:137375675-137375697 ATGCTGATACTGCTGGTCCCAGG + Intergenic
1035327557 7:158074791-158074813 ATGCTGATCCTGCTGGCAGAGGG - Intronic
1035600198 8:892765-892787 TTGCTGCTACTGCTGGAGCATGG - Intergenic
1036694588 8:10966261-10966283 ATGCTGATGCCGCTGGTCCATGG + Intronic
1037301515 8:17456501-17456523 ATTCTGATGCTGCTGAAAGAGGG + Intergenic
1037713137 8:21371589-21371611 ATGCTGATGCTGCAGGTCCAAGG - Intergenic
1037737097 8:21576705-21576727 ATGCTGATGCTGCTGGTCCGTGG - Intergenic
1037932497 8:22890335-22890357 ATGCCGATGCTGCTGGTCCACGG + Intronic
1038411063 8:27360372-27360394 ATGCTGATGCTGATGGGAGACGG + Intronic
1039072926 8:33662488-33662510 ATGCTGATGTTGCTGGCCCAGGG + Intergenic
1039335148 8:36581030-36581052 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1039593759 8:38771938-38771960 ATGCTGATGTTGCTGGCCCAGGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041569815 8:59324744-59324766 ATGCTGATACAGATTGAAGAGGG + Intergenic
1041592366 8:59603040-59603062 ATGCTGATAGTGCTACAACTTGG - Intergenic
1042404547 8:68388859-68388881 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1042804895 8:72760496-72760518 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
1043133164 8:76487554-76487576 ATGCTGAGGCTGCTGGTTCAGGG + Intergenic
1043142070 8:76603005-76603027 AGCCTGGTACTTCTGGAACAAGG + Intergenic
1043425732 8:80146917-80146939 ATGCTGATACTGCTGGTTCAGGG - Intronic
1043554076 8:81409663-81409685 ATGCTGCCACTGCTGGAGGAAGG - Intergenic
1044263668 8:90157709-90157731 ATGCTGCTACTGCAGGTTCATGG - Intergenic
1044500964 8:92956215-92956237 ATATTGATAATGCTGCAACATGG + Intronic
1045183434 8:99811533-99811555 CTGCTGATGCTGCTGGTCCAGGG + Intronic
1045901926 8:107292108-107292130 ATGCTAATACTGCTGGTCCCTGG + Intronic
1046019167 8:108643301-108643323 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1046714620 8:117554022-117554044 AGGCTGATGATGCTGGACCATGG - Intergenic
1046935627 8:119882904-119882926 AGGCTGATAATACTAGAACAAGG - Intronic
1047216152 8:122877640-122877662 ATGGTGGTACTCCAGGAACACGG + Intronic
1047645530 8:126866126-126866148 ATGCTGATGCTGCTGGATCAAGG + Intergenic
1047692657 8:127372116-127372138 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
1049023693 8:139974389-139974411 ATGCTGCAGCTGCTGGAACGGGG - Intronic
1049914774 9:306758-306780 ATGCTGATGCTGCTGGTCCCAGG + Intronic
1050247264 9:3703730-3703752 GTGCTGATGCTGCTGGTCCAGGG - Intergenic
1050250535 9:3739392-3739414 ATGCTGATGTTGCTGGTCCAGGG - Intergenic
1050501903 9:6307446-6307468 ATGCTGCTGCTGCTGGTATATGG - Intergenic
1050800919 9:9613073-9613095 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1051055873 9:12984783-12984805 TTGATGATACTGGTGGACCAAGG + Intergenic
1051062845 9:13065092-13065114 ATGCCTATACTGATGGAAAAGGG - Intergenic
1051125578 9:13800864-13800886 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1051235247 9:14992716-14992738 ATGCTGAGGCTGCTGGTTCAGGG + Intergenic
1051619153 9:19033870-19033892 ATGCTGGTTCTGCTGGGCCACGG + Intronic
1051657843 9:19399840-19399862 ATGCAGATGCTGCTGGTCCATGG - Intergenic
1051677337 9:19571551-19571573 ATGCTGATGCTGTTGGTCCAAGG - Intronic
1052366711 9:27620130-27620152 ATGCTGACACTGCTGGTCCCTGG - Intergenic
1052600286 9:30619005-30619027 ATGCTTATATTTCAGGAACAGGG - Intergenic
1054729404 9:68685566-68685588 ATGCTGAGGCTGCTGGTCCAGGG + Intergenic
1054814589 9:69462930-69462952 ATGCTGATGCTACTGGTCCAGGG + Intronic
1054887984 9:70219896-70219918 TTGCTGATGCTGCTGGTACCTGG - Intronic
1055115482 9:72600921-72600943 ATGCTGAGGCTGCTGGTCCAGGG + Intronic
1055296317 9:74837350-74837372 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1055715531 9:79113588-79113610 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1056081608 9:83100740-83100762 ATGCTGCTACTTCTGACACAGGG + Intergenic
1056105998 9:83346855-83346877 ATGCTGACATTGCTGGCCCAGGG + Intronic
1056618797 9:88192967-88192989 ATGCAGATCCTGCTGGTCCAAGG + Intergenic
1057396154 9:94682357-94682379 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1057897236 9:98919087-98919109 ATGCTGATACTGCCGGATCAGGG + Intergenic
1057902007 9:98956748-98956770 ATGCTGATGCTGCTGGTCCATGG - Intronic
1058001646 9:99872013-99872035 ATGCTGATACTGCTGATCCTAGG - Intergenic
1058350418 9:104014887-104014909 ATGCTGATGCTGCTGATCCAGGG + Intergenic
1058524873 9:105847362-105847384 AGACTGATACTGCTGGTCCAAGG + Intergenic
1058623658 9:106911572-106911594 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1058784996 9:108378260-108378282 ATGCTGATGCTGCTGATCCATGG - Intergenic
1058981674 9:110176180-110176202 ATGCTGCTGCTGCTGGTCCAGGG + Intergenic
1059011346 9:110465087-110465109 ATGCTGATTCTACTGGTCCAGGG - Intronic
1059989828 9:119854413-119854435 ATGCTCATCCTGCTGGTCCAGGG + Intergenic
1060898035 9:127231663-127231685 ATGCAGATGCTGCTGGTCCAGGG - Intronic
1060908545 9:127330021-127330043 ATGCTGATACTGCTGGCCTAGGG - Intronic
1061465349 9:130774261-130774283 TTGCTCATACTGCAGGAAAAAGG - Intronic
1061697517 9:132388014-132388036 ATGCGGAAAGTGCTGGAACAGGG + Intronic
1061785502 9:133025536-133025558 CTGATGCTACTGCTAGAACACGG - Intergenic
1062584583 9:137243477-137243499 ATCCTGGTACTGCTGGTACTCGG - Exonic
1203718328 Un_KI270742v1:177365-177387 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
1203532888 Un_KI270743v1:857-879 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
1203652542 Un_KI270751v1:141058-141080 ATGCTGATGCTGCTAGCACAGGG + Intergenic
1186321653 X:8433199-8433221 ATGCTGTTTCCACTGGAACAAGG + Intergenic
1186572254 X:10727609-10727631 CTGCTGCTACTGCTGGTTCAGGG - Intronic
1186610004 X:11129784-11129806 ATGCTGATGCTGCTGGGCCAGGG + Intergenic
1186710679 X:12192822-12192844 ATGCTGATGCTGCTGATCCAGGG + Intronic
1186763523 X:12747684-12747706 AGGCTGATGCTGCTGGCCCAGGG + Intergenic
1186809866 X:13177731-13177753 ATGCTAATGCTGCTGGTCCACGG + Intergenic
1186839344 X:13469523-13469545 ATGCTGATGCTGCTAGTCCAGGG + Intergenic
1186883655 X:13891200-13891222 ATGCTGAGACTACTGGGCCATGG - Intronic
1186970163 X:14833392-14833414 ATGCAGATTCTGCTGGTTCATGG - Intergenic
1186996404 X:15128225-15128247 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1187021572 X:15387930-15387952 ATGCTGATACTGCTGGTCCATGG + Intronic
1187117871 X:16371775-16371797 ATGCTGATACTGCTGGTCTGGGG + Intergenic
1187212305 X:17243539-17243561 ATGGTGATGCTGCTGGTCCATGG + Intergenic
1187305355 X:18090429-18090451 ATGCTGTTGCTGCTGGTTCAGGG + Intergenic
1187420685 X:19131074-19131096 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1187564436 X:20434462-20434484 ATGCTGATGCTGCTGGTTCCTGG + Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1187590485 X:20712175-20712197 ATACTGATATTGCTGGTCCAAGG + Intergenic
1187940703 X:24378069-24378091 CTGCTGCTGCTGCTGGATCAGGG + Intergenic
1187987431 X:24829496-24829518 ATGCTGAAACTCCTGGAAGGGGG - Intronic
1188069524 X:25701918-25701940 ATGCTGATACTGCTGGTCTGTGG + Intergenic
1188167142 X:26875428-26875450 ATGGAGATACTGCTGGACCTGGG + Intergenic
1188350678 X:29127376-29127398 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188403605 X:29779035-29779057 ATGCTGATGCTGCTGATATATGG + Intronic
1188538722 X:31225753-31225775 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188613290 X:32125892-32125914 ATGCTGATGCTGCTGGTTCCAGG - Intronic
1188965848 X:36550114-36550136 GTTCTGATACTGCTGCAACATGG + Intergenic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1189124036 X:38426443-38426465 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1189166562 X:38866675-38866697 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1189553774 X:42120514-42120536 ATACTGATAATGCTGGTCCAGGG - Intergenic
1189560813 X:42189724-42189746 ATGCTGATGCTGCTGGTTCGGGG - Intergenic
1189621881 X:42849546-42849568 GTACTGATACTGCTGCAATATGG + Intergenic
1189855989 X:45225517-45225539 ATGCTGATGCTGCTGAACCAGGG - Intergenic
1189862892 X:45291592-45291614 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1189871109 X:45383792-45383814 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1189943912 X:46157402-46157424 ATGCTGATGCTGCTGGTCCGGGG - Intergenic
1190021952 X:46886624-46886646 ATACTGATGCTGCTGGCCCATGG - Intergenic
1190423904 X:50313389-50313411 AAACTGATACTGCTGAACCAAGG - Intronic
1190827605 X:54031957-54031979 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1191011119 X:55760435-55760457 ATGCTGATCCTGCTGGTCCAGGG + Intergenic
1192374594 X:70547061-70547083 ATACTGATAATGCTACAACATGG + Intronic
1193692711 X:84667407-84667429 ATGCTGCAACTGCTGGGGCATGG - Intergenic
1194702763 X:97134634-97134656 ATACTGATATTGCTGGTCCAGGG + Intronic
1194744743 X:97616049-97616071 ATGCTGATGCTGCTGGACCGTGG - Intergenic
1194985619 X:100486520-100486542 ATGCTGATGCTTCTGGTTCAGGG + Intergenic
1195369036 X:104155331-104155353 ATGCTGATACTCCTGGACATGGG - Intronic
1195821294 X:108947507-108947529 ATGCTGCAGCTGCTGGAAGATGG + Intergenic
1195821781 X:108953517-108953539 GTGCTGATGCTGCTGGTAAAGGG - Intergenic
1195865848 X:109432043-109432065 ATGCTGATGCAGCTGGTCCAGGG - Intronic
1195961222 X:110388744-110388766 ATGCTGATGCTCCTGGTCCAGGG + Intronic
1195981240 X:110580757-110580779 ATGCTGGTGCTGCTGGTCCATGG + Intergenic
1196986850 X:121282714-121282736 ATGCTGCCACTGCTGCAACCAGG - Intergenic
1197644316 X:129001613-129001635 ATGCTGATGCTGCTGATCCATGG - Intergenic
1197717402 X:129719387-129719409 ATGCTGATGTTGCTGGTCCAGGG + Intergenic
1197787207 X:130210855-130210877 ATGCTGATGATGCTGGTCCATGG - Intronic
1198090698 X:133326342-133326364 ATGCTGATCCTGCTGGTCCCAGG - Intronic
1200839535 Y:7766574-7766596 ATGCTGATGATGCTGGTCCATGG + Intergenic
1201172479 Y:11282215-11282237 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
1202350466 Y:23984975-23984997 ATGTTGCAACTGATGGAACAAGG + Intergenic
1202520313 Y:25685146-25685168 ATGTTGCAACTGATGGAACAAGG - Intergenic