ID: 1189088836

View in Genome Browser
Species Human (GRCh38)
Location X:38055968-38055990
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3194
Summary {0: 1, 1: 20, 2: 529, 3: 1082, 4: 1562}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189088836 Original CRISPR AATAACTAAAAGAGTATAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr