ID: 1189091489

View in Genome Browser
Species Human (GRCh38)
Location X:38087701-38087723
Sequence ATCAAACAGAAGTTAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189091489_1189091490 8 Left 1189091489 X:38087701-38087723 CCTTTGATTAACTTCTGTTTGAT 0: 1
1: 0
2: 2
3: 25
4: 332
Right 1189091490 X:38087732-38087754 CTATAAATGCAAAACCTGCCTGG 0: 1
1: 0
2: 1
3: 80
4: 2058
1189091489_1189091491 12 Left 1189091489 X:38087701-38087723 CCTTTGATTAACTTCTGTTTGAT 0: 1
1: 0
2: 2
3: 25
4: 332
Right 1189091491 X:38087736-38087758 AAATGCAAAACCTGCCTGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189091489 Original CRISPR ATCAAACAGAAGTTAATCAA AGG (reversed) Intronic
904689901 1:32286049-32286071 ATCATCCAGAAGTTCCTCAAGGG + Exonic
904715946 1:32467749-32467771 AATAAACAGGAGTTAACCAAGGG + Intronic
905701831 1:40022317-40022339 ATAAAATAGAAGTTTTTCAAAGG + Intergenic
906760261 1:48370747-48370769 ATCAAACAGCTGTTAAGCAGTGG + Intronic
906882805 1:49610919-49610941 AACAAAAAGAATTTAATAAATGG + Intronic
906968114 1:50480033-50480055 ATCAAACTGAAGTTTAACACTGG - Intronic
907035774 1:51214942-51214964 TTCAAACAGAAGAAAAACAAAGG - Intergenic
907062518 1:51444956-51444978 ATCAGTCAGAAGTTAATCAAGGG - Exonic
909709492 1:78630555-78630577 ATCAAACAAAAAATAATAAAGGG + Intronic
909832517 1:80210664-80210686 ATCAAAGAAATTTTAATCAAAGG - Intergenic
911108626 1:94159878-94159900 ATCAAAAAGAAGTTAAAAGACGG - Intronic
911340839 1:96634317-96634339 ATTTAACAGAAGCTAATTAAAGG + Intergenic
913140302 1:115934643-115934665 GTCACACAGCAGTTAATAAAAGG - Intergenic
915735531 1:158082361-158082383 ATCACACAGCAGGTAAACAAAGG + Intronic
916156924 1:161860576-161860598 ATGAAACAGATGCAAATCAAGGG - Intronic
916163820 1:161946309-161946331 ATCAAACAGAAGTGAATATTAGG + Intronic
916830206 1:168483167-168483189 ATCACACAGAACTAATTCAATGG - Intergenic
916859085 1:168783616-168783638 ATCAGCCAGCAGTTAATCCAGGG + Intergenic
917049872 1:170909509-170909531 ATCTAACTGAAGGTAATTAAGGG + Intergenic
918752882 1:188294619-188294641 AACAACCAGAAGTTAAAAAAAGG + Intergenic
918791074 1:188829878-188829900 AACAAACAGAAAATAAACAAAGG + Intergenic
919359735 1:196577552-196577574 AACATACATATGTTAATCAAGGG - Intronic
919495247 1:198257291-198257313 AACAAACATAAGTAAATAAAAGG - Intronic
919617835 1:199829722-199829744 AGAAAACAGAAGAAAATCAAGGG - Intergenic
919624028 1:199893864-199893886 ATAAAAAAAAAGTTAAACAAGGG - Intergenic
920001141 1:202799726-202799748 ATAAAAAAGAGGTTTATCAAGGG - Intronic
920761372 1:208786584-208786606 ATCAGATAGAAGCTAATGAAGGG + Intergenic
921761826 1:218923908-218923930 CTCAAAGGCAAGTTAATCAAGGG + Intergenic
922238644 1:223740227-223740249 TTCAAACAGAGGTGACTCAATGG - Intronic
922947464 1:229529368-229529390 GTCACATAGAAGTTAATCACTGG + Intronic
922976262 1:229785924-229785946 ATAAAACAGAACTTGATCTAGGG + Intergenic
923802505 1:237224104-237224126 TTCAAACATACGTTACTCAAGGG - Intronic
924637224 1:245799702-245799724 ACCACAGAGAAGTTAATCCAGGG - Intronic
1063017155 10:2089856-2089878 ATAACACAGAAGATAAGCAAGGG + Intergenic
1063828095 10:9921351-9921373 ACCAAAAAGAAGTTACTGAAGGG - Intergenic
1063966051 10:11346643-11346665 AAAAAAAAGAAGTTAAGCAAGGG + Intergenic
1065226356 10:23547621-23547643 CTCAAAAAAAAGTTATTCAAAGG - Intergenic
1066340897 10:34532360-34532382 TTCAAACACAAGTTGTTCAAGGG + Intronic
1066511038 10:36096277-36096299 ATCAAAAAACAGTTTATCAATGG - Intergenic
1066809413 10:39307785-39307807 ATCACAAAGAAGTTTCTCAAAGG + Intergenic
1069151539 10:64966681-64966703 ATCAAAAATAAGATAAACAATGG + Intergenic
1069438135 10:68404982-68405004 TGTAAAGAGAAGTTAATCAAGGG - Intronic
1069474900 10:68723448-68723470 ATCAATTAAAAGTTAATCTAAGG - Intronic
1069623472 10:69852265-69852287 AACAAACAGAAATAAATAAATGG - Intronic
1069864919 10:71496264-71496286 ATTAAAAAGATGTTAATTAATGG - Intronic
1070247716 10:74747763-74747785 ATAAAACAGAATTTTAGCAATGG - Intergenic
1070619478 10:77997316-77997338 ATCAAGCAGAAGGAAATAAAGGG + Intronic
1071237390 10:83665089-83665111 ATCAAACAGGAGTAATTAAAGGG + Intergenic
1071605252 10:86981380-86981402 ATAGATTAGAAGTTAATCAAAGG - Intronic
1071758412 10:88572268-88572290 ATCAAAAAGAAATTAAACAAAGG + Intronic
1072688718 10:97555386-97555408 ATCAAAACCAGGTTAATCAAAGG - Intronic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1078114975 11:8438415-8438437 ATTAAATAGAAATGAATCAAAGG + Intronic
1079740328 11:24050664-24050686 ATAAAACAGAAGTTATTGAAAGG - Intergenic
1080049767 11:27847569-27847591 ATTAGACAAAAGTTACTCAAAGG + Intergenic
1080140083 11:28906975-28906997 AATCAACAGAAGTTGATCAAAGG - Intergenic
1080229192 11:29999384-29999406 ATGAAGCAGAATTGAATCAATGG + Intergenic
1081190309 11:40095970-40095992 ATTAAACAGGATTTAATAAAAGG + Intergenic
1087974024 11:104522067-104522089 ATAAAACAGAAATTATCCAATGG - Intergenic
1088498327 11:110455468-110455490 ATCAAACTGAAGTTACTCTGAGG + Intronic
1089328161 11:117671594-117671616 ATCAATAAGTAGTTAATCAATGG + Intronic
1090118036 11:123995557-123995579 ATCAAACTGAAGGAAAACAATGG - Intergenic
1091892266 12:4068563-4068585 TTCAAACTTAAGATAATCAAAGG - Intergenic
1092521760 12:9282828-9282850 ATACAACAGAAGATAATAAAAGG - Intergenic
1092850986 12:12626364-12626386 ATAAAACTGGATTTAATCAAGGG - Intronic
1093312395 12:17606265-17606287 ATCAAAAAGAAGATAGTAAAAGG - Intergenic
1094072807 12:26437243-26437265 AAAAAATTGAAGTTAATCAAGGG + Intronic
1094471181 12:30803175-30803197 TTCAAACAGCAGTTAATAATTGG - Intergenic
1095445934 12:42282285-42282307 AGCTAAAAGAAGTAAATCAAGGG - Intronic
1095552852 12:43464445-43464467 ATCAAAAAGAGGTTAAGAAAAGG - Intronic
1097715550 12:62962280-62962302 ATCAATCTGATGTTAATCTAGGG - Intergenic
1098747461 12:74257898-74257920 AACAAACAAAACTTAATAAATGG - Intergenic
1098795535 12:74883900-74883922 ATCAAACAGTGGTTAATGAGAGG + Intergenic
1099072446 12:78063047-78063069 TTTAACCAGAAGTTGATCAAAGG - Intronic
1099081104 12:78182462-78182484 ATAAAACAGAATTTTATAAAAGG - Intronic
1099417517 12:82409897-82409919 GTCAAACAGAAATTTGTCAAGGG + Intronic
1099804676 12:87503733-87503755 AACAAATAAAAGTTAATAAATGG - Intergenic
1099937349 12:89142675-89142697 ATCAAACAGAATTTTATTAGAGG + Intergenic
1100878022 12:98983602-98983624 ATGAAACAGTAGTGAATCATGGG - Intronic
1101095903 12:101340858-101340880 ATGAATCAGAAGCTAAACAAGGG - Intronic
1104076403 12:125393650-125393672 CTCAAAGAGAACTTAATGAAGGG + Intronic
1105548893 13:21373918-21373940 ATCAAAGATAAGTAATTCAAAGG + Exonic
1105820331 13:24075424-24075446 ATAAAACAAATGTTAATAAAGGG + Intronic
1107135187 13:36936844-36936866 ATCATACAAACTTTAATCAAAGG - Intergenic
1108893367 13:55292095-55292117 ATAAAACAGACTTTAAACAATGG + Intergenic
1109571677 13:64200420-64200442 ATCAAAAAGAAGTACATCAGGGG - Intergenic
1109924208 13:69113322-69113344 ATCACACAGAAGTTATATAAGGG + Intergenic
1110571987 13:77014419-77014441 ATAAAACAGAAGTTAAGAATAGG - Intronic
1110587796 13:77215179-77215201 ATGAAATAAAACTTAATCAAAGG + Intronic
1110608116 13:77457163-77457185 ATGAAAGAGATGTTGATCAAAGG + Intergenic
1110903393 13:80854095-80854117 ATCAAACAAAGGTTATTCAGGGG - Intergenic
1110977444 13:81857971-81857993 ATCAAACATAAATTATTCAAAGG - Intergenic
1111134395 13:84021580-84021602 ATGAAACAGAATTTTCTCAAGGG + Intergenic
1111345516 13:86948048-86948070 TTCAAACCCAAGTTATTCAAGGG - Intergenic
1111812786 13:93112775-93112797 TTCAAAGATAAATTAATCAAGGG - Intergenic
1113274228 13:108710335-108710357 ATCAAACAAAAGTAGAACAAAGG - Intronic
1115815378 14:37158386-37158408 ATCAAACAGGATTTATTCCAGGG + Intronic
1116224801 14:42136571-42136593 ATCACACAGATTCTAATCAAAGG - Intergenic
1117285188 14:54279899-54279921 AGCAACCAGAAGCTAATCTATGG + Intergenic
1117441542 14:55764286-55764308 ATGAAACAGAATGGAATCAAAGG + Intergenic
1117635665 14:57740513-57740535 GATAAACAGAAGTTAATTAATGG + Intronic
1117818971 14:59628576-59628598 ATCTAACAAAAGGAAATCAATGG + Intronic
1118401303 14:65382110-65382132 AGCAAAGAGAATTTCATCAAAGG - Intergenic
1118417648 14:65560058-65560080 TTCAAAGAGAAGAAAATCAAAGG - Intronic
1118626749 14:67666354-67666376 AGCACACAGAAGTTAGTGAAAGG - Intronic
1120053427 14:79895181-79895203 TGCAAACAGAAGTTACTCAGGGG - Intergenic
1120319423 14:82940620-82940642 ATCAAAGGGGAGTTAATCATGGG - Intergenic
1121794703 14:96725207-96725229 ATCAAACTGGACTTAAACAATGG + Intergenic
1124044905 15:26139751-26139773 CTCACACAGTAGTTAATTAAGGG - Intergenic
1125536516 15:40443614-40443636 ATCAAAAAGAACCTAATCACTGG - Intronic
1126221316 15:46217011-46217033 AACAAACAGAAGTCACTGAAGGG - Intergenic
1126302311 15:47211354-47211376 ATCTATCATAAATTAATCAATGG + Intronic
1126369739 15:47933214-47933236 CTCAAACAGGAATTACTCAAGGG - Intergenic
1127928689 15:63574685-63574707 ATGAAACAGAAGTTATTCTGTGG + Intronic
1128541084 15:68533825-68533847 ATCCCAGAGAAGGTAATCAAAGG + Intergenic
1128973324 15:72128695-72128717 AACAAACACAAGTTAATCACAGG - Intronic
1131059228 15:89394335-89394357 AGCAAACAGAAGTAGAACAAAGG - Intergenic
1131075269 15:89491432-89491454 ATGAAACAGAAATTAATAAATGG - Intronic
1131945072 15:97610442-97610464 ATCAAACAGAAGAAAATTAGTGG + Intergenic
1132437435 15:101820348-101820370 ATAAAATAGAATTGAATCAAGGG - Intergenic
1134045428 16:11097703-11097725 ATAAAACAGACGTAAACCAATGG - Intronic
1138812636 16:60168811-60168833 ATTAAAAAGAATTTAGTCAAGGG - Intergenic
1139149165 16:64359819-64359841 AAGAAACAGAAGGTGATCAATGG + Intergenic
1139501026 16:67365909-67365931 AACAAACAGTAGTAAATTAATGG - Intronic
1140033421 16:71355986-71356008 ACCAAAAAGAATGTAATCAAGGG - Intergenic
1140319116 16:73930677-73930699 TTCATAGAGAAGTTAAGCAATGG - Intergenic
1141601848 16:85131548-85131570 AAAAAACAGAAATTAATCATAGG - Intergenic
1141666050 16:85465753-85465775 ATCAGACAGACGTTCCTCAAGGG + Intergenic
1142837525 17:2598878-2598900 ATGTAACAGAAGTTAAACTAAGG - Intronic
1144313186 17:14033541-14033563 ATAAAACAGGAGGTAAGCAAGGG - Intergenic
1146106546 17:30042944-30042966 ATCAAATAGAGCTTAATCCAGGG + Intronic
1148346270 17:46905579-46905601 ATGAAACAGAAGAAAATCTATGG + Intergenic
1148900640 17:50873508-50873530 ATAAAACGCAAGTTAATCACAGG + Intergenic
1149022719 17:51988468-51988490 ATAAAACAGAATTTAAACAGTGG + Intronic
1149132457 17:53320732-53320754 ATCAAAAAGAAGCAAATGAATGG + Intergenic
1149681321 17:58509245-58509267 ATCAAGCAGAAGATAAACCAAGG - Intronic
1152960656 18:78600-78622 ATGAAACAGAAGTTGATACAAGG - Intergenic
1154382837 18:13868496-13868518 ATCAAACCACAGTGAATCAATGG + Intergenic
1155115111 18:22757362-22757384 ATCAAGCAGAATTTATTCCAGGG + Intergenic
1155832354 18:30533599-30533621 AACAAACAAAAGTAAATCAATGG + Intergenic
1156180023 18:34592331-34592353 ATTAAACACAAGTTAATTAATGG + Intronic
1158350700 18:56562360-56562382 AAAAAAAAGAAGTTAACCAATGG + Intergenic
1158830846 18:61276981-61277003 ATTTAACAAAAATTAATCAAAGG + Intergenic
1158837331 18:61344909-61344931 ATAAGACAGAAGATAACCAAAGG - Intronic
1159272095 18:66166229-66166251 ATCACACAAACATTAATCAAAGG + Intergenic
1159639406 18:70845836-70845858 AACAAAAAGAAGTAAATAAAAGG - Intergenic
1159659616 18:71077828-71077850 TTCAAAGAGAAGTTAGTGAAGGG + Intergenic
1161654501 19:5505791-5505813 AAAAAAAAGAAGTTAATGAAGGG - Intergenic
1162837202 19:13328205-13328227 ATAAAACAGATTTTAAACAATGG + Intronic
1163100597 19:15093758-15093780 GTGAAACAGACATTAATCAAAGG - Intergenic
1164389536 19:27805887-27805909 ATCAAGGTGAAGTTAATCCATGG - Intergenic
1165546125 19:36537777-36537799 ATCAAAAAGAAAATAAGCAAGGG + Intronic
925953093 2:8934419-8934441 AAGAAACAGAAGTTAGTAAATGG - Intronic
926707763 2:15848748-15848770 AACCAACAGAAGTAGATCAAGGG - Intergenic
927333199 2:21890529-21890551 ATCAAGCAGAATTTAGTCTATGG + Intergenic
929040815 2:37742603-37742625 ACAAAACAGAACTTAATAAAAGG + Intergenic
929846160 2:45530446-45530468 ATGAATCAAAAGTCAATCAAAGG + Intronic
930256787 2:49102346-49102368 ATAAAGCAGAAGTTCATCAAGGG + Intronic
930285163 2:49418605-49418627 ATCAAAGAGAAGCAAATGAAAGG + Intergenic
930672044 2:54161428-54161450 TTCAAAGAGGAGTTACTCAAGGG + Intronic
931771136 2:65499191-65499213 GTCAAAGAGAGGTTAATAAAGGG + Intergenic
932451839 2:71815689-71815711 AACAAACAGAAGTTCCCCAAAGG - Intergenic
933041617 2:77474763-77474785 ATCCAACATAATTGAATCAAAGG - Intronic
933320663 2:80772071-80772093 TTCACAAAGAAGCTAATCAAAGG - Intergenic
934131100 2:88949890-88949912 TTCAAACCCAAGTTATTCAAGGG + Intergenic
934132997 2:88967695-88967717 TTCAAACCCAAGTTATTCAAGGG + Intergenic
934146761 2:89102462-89102484 TTCAAACCCAAGTTATTCAAGGG + Intergenic
934222503 2:90098130-90098152 TTCAAACCCAAGTTATTCAAGGG - Intergenic
935522921 2:104130892-104130914 ATCAAAGACAAGTAAATAAATGG + Intergenic
936170273 2:110165051-110165073 ATGGAGCAGAAGTTAAGCAAAGG - Exonic
937639526 2:124195723-124195745 ATCAAACAGAGACTAAGCAATGG + Intronic
937731028 2:125229653-125229675 ATCAAAGGGAAGAAAATCAAAGG - Intergenic
937772407 2:125735630-125735652 ATCAAACAGAATTTAAGAATGGG - Intergenic
937810430 2:126193824-126193846 CTGAAACAGAAGTTGATCACTGG + Intergenic
938094664 2:128453641-128453663 ACCAACCAGAAATAAATCAAAGG - Intergenic
938608196 2:132918698-132918720 ATAAAACACAAGTGATTCAAAGG + Intronic
938638387 2:133253431-133253453 AGAAGACAGAAGTTAATCACTGG + Intronic
939822884 2:146978990-146979012 ATTTAACAGAAGTCAGTCAATGG + Intergenic
939957257 2:148537499-148537521 ACCAAACAAAAATTATTCAAAGG + Intergenic
940569969 2:155418367-155418389 ATAAAACAGTATTAAATCAAGGG - Intergenic
941764782 2:169284919-169284941 GTCAAACAGAAGGAAACCAAAGG + Intronic
941985636 2:171508877-171508899 ATCAAATATAACTTAATCAGTGG - Intergenic
942033813 2:171990992-171991014 AGCAAACAGAACATAACCAAAGG + Intronic
942595098 2:177585043-177585065 AACAAACAGAATTTACTGAAAGG - Intergenic
942936702 2:181565631-181565653 ATCACAGACAAGTTAACCAATGG + Intronic
943440435 2:187921459-187921481 ACCAAACTTAAGTTAACCAAAGG + Intergenic
943461760 2:188177815-188177837 ATAAAACAGAATTTAAGCAAGGG + Intergenic
943716391 2:191156914-191156936 CTGAAACAGAAGTAAATAAAAGG - Intergenic
943853774 2:192762520-192762542 ATCAAACAGCAGTGAAGTAAAGG + Intergenic
943887090 2:193232857-193232879 AACAAACACAAATTAATAAATGG + Intergenic
944388905 2:199196886-199196908 ATGAAAAAGCAGTTCATCAAAGG + Intergenic
945645758 2:212490381-212490403 ATCAAAGTGAAATTAATAAAAGG - Intronic
946098410 2:217296318-217296340 GGCAAACAGAAGAAAATCAAAGG + Intronic
946463384 2:219890021-219890043 ATCAGACAGAGGTCAACCAAGGG - Intergenic
948031594 2:234822101-234822123 ATGACACAGAAGTTATTCCAGGG - Intergenic
948194999 2:236088713-236088735 ATCAAACAAAAGAGAATCTATGG - Intronic
1169556557 20:6757266-6757288 ACCAAACAGAAGTTTATACAAGG - Intergenic
1169616506 20:7452478-7452500 AACAAATAGAAGTTTATTAAAGG - Intergenic
1170236810 20:14115540-14115562 AAGAAACAAAAGTTAAACAAAGG - Intronic
1170312891 20:15012055-15012077 ATCAAACAGCCTTTAATAAAAGG - Intronic
1170533920 20:17321749-17321771 ATCAATTAGAGGTTAGTCAAAGG - Intronic
1171178293 20:23071911-23071933 ATATAACAAAAGTTAATGAACGG + Intergenic
1173211480 20:41036250-41036272 CTCTAACAGCAGATAATCAAGGG - Intronic
1173887490 20:46473544-46473566 ATCAAACTGAAGGAAATAAAAGG - Intergenic
1174099091 20:48113488-48113510 AGAAAACAGGAGCTAATCAAAGG + Intergenic
1177794416 21:25758554-25758576 ATCAAACAGAAGGCAACAAATGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178701638 21:34838648-34838670 ATAAAACAGTAGCAAATCAAAGG - Intronic
1179943879 21:44657625-44657647 ATGAAACAAAAGTGAAACAACGG + Intronic
1180944517 22:19683648-19683670 TTCACACAGATATTAATCAAAGG + Intergenic
1182863062 22:33577813-33577835 ACCAATCAGAAATTAATAAAGGG - Intronic
1182895123 22:33853069-33853091 ACCAAAGAGAAATTAATCCAAGG + Intronic
1184588598 22:45464926-45464948 ATCATGCAAATGTTAATCAAAGG + Intergenic
949349100 3:3106117-3106139 ATCAAACAGCTGTTAAGTAATGG + Intronic
949349458 3:3110763-3110785 ATCAAACAGAAATGGAACAAAGG - Intronic
949379584 3:3430179-3430201 ATCAAACAGCAAGTAGTCAATGG + Intergenic
949437787 3:4048041-4048063 ATGAAACAGACCCTAATCAAAGG - Intronic
949508910 3:4751643-4751665 CTCTAACAGAAGTTAATAAAGGG - Intronic
949543777 3:5054770-5054792 GTCAAAGAGAGGTTAAACAACGG + Intergenic
951840127 3:27025361-27025383 ATAAAATAGTATTTAATCAATGG - Intergenic
951864545 3:27293182-27293204 ATCAAAGGGAATTTAATCAAAGG - Intronic
953461116 3:43081806-43081828 AGCAGACAGAACATAATCAAAGG + Intronic
955053901 3:55439166-55439188 GTTAAAGAGAAGTTGATCAATGG + Intergenic
956379026 3:68646487-68646509 ATCAAACAGAAGGCAATACATGG - Intergenic
956429591 3:69172209-69172231 ATGAAACACAAGTTAAACAAAGG - Intronic
957699941 3:83696207-83696229 ATCAAAAAGAAGGAAATAAAAGG + Intergenic
958071565 3:88620551-88620573 ATCAAACAAAACATAATGAAAGG - Intergenic
958950901 3:100414551-100414573 AAAAAAAAAAAGTTAATCAAAGG + Intronic
961846454 3:129768496-129768518 AACAAACAGAATCTAATCAGTGG - Intronic
962208452 3:133455606-133455628 ATCTAACATAATTTAATCATTGG + Intronic
963612067 3:147482404-147482426 ATTAAACAGAAGTAGAACAAAGG - Intronic
965223132 3:165953445-165953467 TTCAACCAGAAGGTAGTCAAGGG + Intergenic
965334198 3:167416042-167416064 CTAAAACAGAAGTTAAAAAAAGG - Intergenic
965907415 3:173726061-173726083 ATAGAACATAACTTAATCAAGGG + Intronic
966719093 3:183043610-183043632 TTCAAACAGAGGTAAAACAAAGG - Intronic
967941640 3:194770925-194770947 AACAAAAAGAAGTCAATAAAGGG - Intergenic
970900915 4:21159257-21159279 ATAAAAGACAAGTTAATCAATGG + Intronic
971587903 4:28429096-28429118 ATCAAACAGGATTTATCCAAGGG - Intergenic
971611665 4:28733626-28733648 ATAAAAAAGAATTTAATAAATGG - Intergenic
972289911 4:37681997-37682019 ATCAAACAGATCTGACTCAATGG + Intronic
974703001 4:65475140-65475162 ATAAAACAGAAATGAATGAATGG - Intronic
975461893 4:74663320-74663342 AAAAGACAGAAGTTAATAAAAGG + Intergenic
976153602 4:82118469-82118491 GGCAAACAGAAGTAACTCAAAGG + Intergenic
976463048 4:85335272-85335294 ATCAAATAAATGTTCATCAAGGG - Intergenic
977586684 4:98782275-98782297 AACAAACAGTAGTTATTCAGTGG + Intergenic
978935566 4:114370718-114370740 ATCAACCAGAAGTTAAATGAAGG - Intergenic
978950062 4:114547396-114547418 ATAAAACAGAGGTGAATGAAAGG - Intergenic
979151840 4:117327105-117327127 ATACAACAGAAGTTGTTCAATGG + Intergenic
979292650 4:118994906-118994928 ATCCAAGAAAATTTAATCAAAGG - Intronic
979809732 4:125021554-125021576 AACAAACAGAAGTTTATTAATGG - Intergenic
979979653 4:127238701-127238723 ATCACAAAGAAGTTAAGCCAGGG + Intergenic
981119843 4:141037777-141037799 ATGAAAGAAAAGATAATCAATGG + Intronic
981187887 4:141826356-141826378 ATCAAACAGCAGTTATTCTATGG - Intergenic
981588591 4:146331319-146331341 AGTAAATAGAAGTTAAACAAAGG - Intronic
982098201 4:151942582-151942604 ATTTAACAGAAACTAATCAAGGG - Intergenic
982197418 4:152930358-152930380 AACATACAAAAGTTGATCAAAGG + Intergenic
982283844 4:153714439-153714461 ATTAAACAGAATTGAATCATAGG + Intronic
982935752 4:161473196-161473218 ACCAGACAGAAGATAATAAAGGG - Intronic
983307709 4:166014334-166014356 TTCAAACTCAAGTCAATCAAAGG - Intronic
983391696 4:167140139-167140161 ATCTCACAGAAGGAAATCAAAGG - Intronic
983396050 4:167196953-167196975 ATATAACAGAAGCTAATCATGGG + Intronic
983749377 4:171246346-171246368 ATAAAACTGAAGATTATCAATGG - Intergenic
984355230 4:178650419-178650441 AACAACAAGAAGTTAAACAACGG - Intergenic
984470434 4:180164547-180164569 ATAAAACTGAAGTTTATTAAGGG - Intergenic
984585435 4:181559016-181559038 ACCAAACAGAAGATAAACAAAGG - Intergenic
985087787 4:186331614-186331636 ATCAAACAAACATTAATCAAAGG - Intergenic
986225659 5:5809740-5809762 ATCAGACCCAAGTTAAACAAAGG + Intergenic
986250268 5:6049781-6049803 AACTAACAGAAATTAATAAATGG + Intergenic
986585030 5:9307314-9307336 GTCAAACATATGTTAAACAAGGG + Intronic
988355493 5:30168533-30168555 ATCAAACAGAAATAATTAAAGGG + Intergenic
991060350 5:62368231-62368253 ATTCCACAGAAGTTAATCCATGG - Intronic
991071698 5:62490030-62490052 ATGAAACATATGTTAATTAAAGG - Intronic
991389659 5:66128913-66128935 AACATACACAAATTAATCAATGG + Intergenic
991493114 5:67202499-67202521 ATGAAAGAGAAGTTAGTGAACGG - Intergenic
992302444 5:75397254-75397276 ATAAAACAGTACATAATCAAAGG + Intronic
992567691 5:78015571-78015593 TTCAAAAAGAAATTAATAAAAGG - Intronic
993134899 5:83947946-83947968 TTAAAACAGATGTTAGTCAATGG - Intronic
993782286 5:92082245-92082267 AACAAACAGAAACTAATCACAGG - Intergenic
994751545 5:103744110-103744132 ATCAGACAGAAGATAACCCACGG + Intergenic
994986128 5:106936019-106936041 AGCAAACAGAAGTTATTAAAGGG - Intergenic
995001932 5:107143745-107143767 ATCACAGAGAAGATAAGCAAAGG - Intergenic
995235095 5:109819847-109819869 ATCAAACCGAAGTAAAACAAAGG - Exonic
995901801 5:117078039-117078061 TTTAAACAGAAGGTAAACAAAGG + Intergenic
996187506 5:120496123-120496145 ATCAAGTAGCATTTAATCAAGGG - Intronic
996442329 5:123506202-123506224 ATCAAACAGAATTTAGTGAAAGG + Intergenic
998752503 5:145338772-145338794 ATCACACAGCAATTAATCCATGG + Intergenic
1004862009 6:19813978-19814000 ATAAAAAAGAAGTTGATCACAGG - Intergenic
1005303256 6:24491305-24491327 ATCCAAGAGCAGTCAATCAATGG + Intronic
1007986408 6:46211571-46211593 ATTACACAGAAGGTCATCAAAGG - Intergenic
1009716297 6:67401242-67401264 ATAAAACAGACGTTAGTAAAAGG - Intergenic
1010060362 6:71615616-71615638 AACAAACAGGAGATGATCAAAGG - Intergenic
1010266771 6:73876509-73876531 AACAAACAGAAATAAAACAAAGG + Intergenic
1010415812 6:75610086-75610108 ATCAACTAGAAGTTAAACTAAGG - Intronic
1011026895 6:82879265-82879287 ATCAAACTGATGATAGTCAAAGG - Intergenic
1011439785 6:87375679-87375701 ATCTAAAAGAAGTGAATGAAAGG + Exonic
1011511905 6:88110729-88110751 AACAAGCAGAAATTAATAAATGG + Intergenic
1011594919 6:89007188-89007210 CTCAAACAGAAGAAAAACAAAGG - Intergenic
1012049781 6:94327254-94327276 ACAAAACAGAAATGAATCAATGG - Intergenic
1012405160 6:98887808-98887830 GTCAAATAGAAATAAATCAAAGG + Intronic
1012524477 6:100160840-100160862 CTGAAAGAGAAATTAATCAAAGG + Intergenic
1012698473 6:102420547-102420569 AACAAACAGAAGATCAACAAAGG + Intergenic
1012778897 6:103531859-103531881 ATCAAACAAAAATAAAACAAAGG - Intergenic
1014900440 6:126957273-126957295 ATCACAGAGAAGTGAAACAAAGG - Intergenic
1015092715 6:129378006-129378028 ATAAAAGAAAAGGTAATCAAAGG + Intronic
1016622745 6:146131674-146131696 ATTTAACAGAAGTTATTGAATGG + Intronic
1017728019 6:157289087-157289109 ATCAAACAGTAATGAAACAAAGG + Intergenic
1020480360 7:8652360-8652382 ATCAAATAATAGTTAATGAAAGG + Intronic
1020849495 7:13333069-13333091 ATAAAACAGACTCTAATCAAAGG - Intergenic
1021546588 7:21820414-21820436 ATTAAACAAAATGTAATCAAAGG - Intronic
1022118630 7:27285321-27285343 AAGAAGCAGAAGGTAATCAAAGG - Intergenic
1022268572 7:28783833-28783855 ATCTATGAGAAGTTTATCAAGGG - Intronic
1028462635 7:91113137-91113159 ATCAAACAGAAATGAATCATCGG - Intronic
1029969775 7:104777739-104777761 AAAAAAAAGAAGTTCATCAATGG - Intronic
1030576453 7:111292262-111292284 ATCCAACAGAAATTATTAAAAGG - Intronic
1031319591 7:120307188-120307210 ATAAAAATGAAGTTAAACAAAGG - Intronic
1032745721 7:134784000-134784022 AACACCCAGAAGTTAATAAAAGG + Intronic
1033228532 7:139579474-139579496 ATCCAACCGAATTCAATCAAGGG - Intronic
1035097507 7:156367043-156367065 AGCAAACAGAAGGTCATCTAAGG - Intergenic
1036040996 8:5081570-5081592 ATTAAACAGAAGTTTGTCAAAGG + Intergenic
1036081733 8:5564184-5564206 AAAAAACAAAAGTTAATGAATGG - Intergenic
1036112892 8:5924625-5924647 ATCCAAAAGAAGTCAATGAAAGG + Intergenic
1036473063 8:9068130-9068152 TTTAAAAAGAAGTTAATTAAGGG - Intronic
1039756904 8:40533253-40533275 ATCAAACAGCTGTTAAGCAGTGG + Intronic
1042994122 8:74675182-74675204 AGCAAACAGAAGATAATGGATGG + Intronic
1044649384 8:94478378-94478400 ATCACACAGAAGTTAATGAATGG + Intergenic
1045625944 8:104050558-104050580 ATTAAACAGAAGATAAACTAAGG + Intronic
1045669399 8:104531118-104531140 GACACAAAGAAGTTAATCAATGG + Intronic
1046146279 8:110164320-110164342 CTCAAACAGACGTTTATTAAGGG - Intergenic
1046367799 8:113259238-113259260 ATCAATCAGAACTTGATAAAGGG + Intronic
1046378124 8:113414399-113414421 ATCAATCATAAGTTTATCCATGG - Intronic
1046548017 8:115675791-115675813 ATTAAAGAGAATTTAATGAAGGG - Intronic
1048317630 8:133374076-133374098 ATTAAACAGCAGTTATTGAAGGG + Intergenic
1048700926 8:137088665-137088687 ATTAAAAAGAAGTGAATGAATGG + Intergenic
1049588733 8:143445079-143445101 ATCTAACAAAACCTAATCAAGGG + Intronic
1049905999 9:216669-216691 ATCAAACTGAAGTTACTGATGGG + Intronic
1050776119 9:9262848-9262870 AGAAAACGGAAATTAATCAATGG - Intronic
1052389815 9:27866605-27866627 TTAAAACAGAATTTAAGCAAAGG - Intergenic
1052520248 9:29538119-29538141 AGCAAAAAGATGTTAATAAAAGG + Intergenic
1055981324 9:82005108-82005130 ATCATATAGAAGGTACTCAAAGG - Intergenic
1057495618 9:95558542-95558564 AAGAAACAGAACTTTATCAATGG + Intergenic
1058354710 9:104070649-104070671 CTAAAAGAGAAGTCAATCAAGGG + Intergenic
1062737441 9:138145147-138145169 ATGAAACAGAAGTTGATACAAGG + Intergenic
1203720892 Un_GL000216v2:12587-12609 ATCAAACAGAGTGGAATCAATGG - Intergenic
1203389305 Un_KI270438v1:82927-82949 ATCAAATGGAATGTAATCAAAGG + Intergenic
1188251696 X:27903810-27903832 CTCAAACAGAAGTCAAGCACTGG - Intergenic
1188622061 X:32237833-32237855 ATCCAACACAAGTCAGTCAAGGG - Intronic
1189091489 X:38087701-38087723 ATCAAACAGAAGTTAATCAAAGG - Intronic
1189124112 X:38427474-38427496 AACAAAATTAAGTTAATCAATGG + Intronic
1189967133 X:46386554-46386576 ATCAAACAGAGCTAGATCAAAGG - Intergenic
1191634933 X:63365379-63365401 ATCAAATAGAATTTCATCTAAGG + Intergenic
1192894794 X:75430868-75430890 ATCAAACAAATCTCAATCAAGGG + Intronic
1194167264 X:90533376-90533398 ATAAAAGAGAAGTTAAATAAAGG + Intergenic
1195577382 X:106467230-106467252 ATCAAACAGAGGTTGATAAAAGG + Intergenic
1195859411 X:109365567-109365589 TTCAAACAGAAGTTAAATGATGG - Intergenic
1195947113 X:110226934-110226956 ATAAAACAGATGTTTTTCAATGG - Intronic
1200309653 X:155065255-155065277 AAGAAACAGAAGTTTAGCAAGGG - Exonic
1201447889 Y:14078427-14078449 ATCAAACAAATGTAAGTCAAAGG - Intergenic
1201492161 Y:14554065-14554087 ATCAAACACAAGTTTTTGAAGGG - Intronic
1201757816 Y:17506081-17506103 ATAAAACAGAAATAAAGCAACGG - Intergenic
1201843738 Y:18399901-18399923 ATAAAACAGAAATAAAGCAACGG + Intergenic