ID: 1189096939

View in Genome Browser
Species Human (GRCh38)
Location X:38150433-38150455
Sequence ACCAAAAATATCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 2, 1: 26, 2: 72, 3: 113, 4: 352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189096939_1189096944 24 Left 1189096939 X:38150433-38150455 CCATGTCTGGAGATATTTTTGGT 0: 2
1: 26
2: 72
3: 113
4: 352
Right 1189096944 X:38150480-38150502 GACCGGCATTTAGTGGGTAGAGG 0: 1
1: 2
2: 31
3: 337
4: 863
1189096939_1189096942 17 Left 1189096939 X:38150433-38150455 CCATGTCTGGAGATATTTTTGGT 0: 2
1: 26
2: 72
3: 113
4: 352
Right 1189096942 X:38150473-38150495 AAGATGTGACCGGCATTTAGTGG 0: 1
1: 0
2: 0
3: 6
4: 90
1189096939_1189096941 7 Left 1189096939 X:38150433-38150455 CCATGTCTGGAGATATTTTTGGT 0: 2
1: 26
2: 72
3: 113
4: 352
Right 1189096941 X:38150463-38150485 GTGGAGAGTGAAGATGTGACCGG 0: 1
1: 0
2: 10
3: 40
4: 324
1189096939_1189096946 29 Left 1189096939 X:38150433-38150455 CCATGTCTGGAGATATTTTTGGT 0: 2
1: 26
2: 72
3: 113
4: 352
Right 1189096946 X:38150485-38150507 GCATTTAGTGGGTAGAGGCCAGG 0: 12
1: 207
2: 665
3: 1156
4: 1523
1189096939_1189096943 18 Left 1189096939 X:38150433-38150455 CCATGTCTGGAGATATTTTTGGT 0: 2
1: 26
2: 72
3: 113
4: 352
Right 1189096943 X:38150474-38150496 AGATGTGACCGGCATTTAGTGGG 0: 1
1: 0
2: 1
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189096939 Original CRISPR ACCAAAAATATCTCCAGACA TGG (reversed) Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
903104742 1:21066743-21066765 ACCATTAGTATCTCCAGGCATGG - Intronic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904628139 1:31820254-31820276 ACCAAAAATTTAGTCAGACATGG - Intergenic
904929656 1:34076522-34076544 ACCACAAATTTCTCCAGATGTGG + Intronic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906052284 1:42885592-42885614 ACAAAAAAAATCTCCACAAAAGG - Intergenic
909161519 1:72157116-72157138 AACAAAAACATAGCCAGACAAGG - Intronic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910977239 1:92919686-92919708 AGTAAAAATTTATCCAGACAAGG + Intronic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911333463 1:96552583-96552605 ATCAAACACATCTGCAGACATGG + Intergenic
911505985 1:98752118-98752140 ACCAAAAAAATCTCAAAACCTGG - Intronic
911583347 1:99660728-99660750 ACCAAAAAATTATCCAGGCATGG + Intronic
911622848 1:100086664-100086686 ACCAAAAAAAAAGCCAGACATGG - Intronic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911736322 1:101340371-101340393 ACCCAAAATATCCACAGATATGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
913964966 1:143369273-143369295 TCCAAAAATATTTCCAGCAATGG - Intergenic
914059340 1:144194875-144194897 TCCAAAAATATTTCCAGCAATGG - Intergenic
914119810 1:144771496-144771518 TCCAAAAATATTTCCAGCAATGG + Intergenic
914320283 1:146552390-146552412 AACAAAAATATTTGCAAACAGGG - Intergenic
915317938 1:155040145-155040167 ACCAAAAAATTAGCCAGACATGG + Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916911946 1:169360211-169360233 ACAAAAAATAAGTCCAGAAATGG + Intronic
917657185 1:177138071-177138093 ACCAAAACAAGCTCCAGACCTGG + Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918376164 1:183911373-183911395 ACCAAAACTATATACAGCCAGGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918718822 1:187826059-187826081 ACCAAACATATCTGCAACCAAGG - Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
919281555 1:195495982-195496004 ACCAAACATATCTACAACCAAGG - Intergenic
919730109 1:200908423-200908445 ACAAAAGATAACTGCAGACATGG + Intronic
920217690 1:204373061-204373083 AGAAAAAATATAGCCAGACATGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921511310 1:216034082-216034104 AGGAAAAATATCTGAAGACAAGG + Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1067111507 10:43404560-43404582 ATCAAAACTACCTCCAGACTGGG + Intronic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068474095 10:57503248-57503270 ACCAAAAATATTTCTGGATATGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069064068 10:63924088-63924110 TCCAGAAATATCCCCACACACGG - Intergenic
1069399991 10:68034011-68034033 TCCAAAGATAGCTCCAGAAAGGG + Exonic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070618174 10:77985498-77985520 ACCAGAAATAGGTACAGACAGGG + Intronic
1071542569 10:86500555-86500577 ATCAGAAATATCTCCAATCAAGG - Exonic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074016106 10:109535776-109535798 ATCAAATCTATTTCCAGACAAGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1074665626 10:115720013-115720035 ACAAAAAATATATCCAGGCCTGG - Intronic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078974967 11:16463234-16463256 ACAAAAAATATATAAAGACAAGG - Intronic
1078985209 11:16587570-16587592 ACCAATATTATCTCCATCCATGG + Intronic
1080050900 11:27857945-27857967 GCCATAAATATCTCGAGTCAGGG + Intergenic
1080437324 11:32257254-32257276 AACAAAAATATTTCCATACTAGG + Intergenic
1080905367 11:36539638-36539660 ACTAAAAATATCGCCAGGCGTGG - Intronic
1081229848 11:40572468-40572490 ACCAATAATATCTACAAAAAAGG + Intronic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1083957325 11:65991899-65991921 ACCCAAAAAATCGCCAGGCATGG + Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084444060 11:69193273-69193295 TCCCAAATTATGTCCAGACAGGG + Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085933603 11:81117245-81117267 ACCAAATAGATCTCAATACAAGG - Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086522320 11:87683494-87683516 ATCAAAAAAATCTCCCAACAGGG + Intergenic
1088147387 11:106698272-106698294 AAAAAAAAAATCCCCAGACATGG - Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090064600 11:123492011-123492033 ACCTACAATATCTCCAAACATGG - Intergenic
1091291908 11:134445250-134445272 ACAAAAAAAATTTCCAGGCATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1097349546 12:58533507-58533529 ACCAAAAATTTCACAAGTCAGGG - Intergenic
1097354932 12:58590566-58590588 ACTAAAACCAGCTCCAGACAAGG - Intronic
1098088671 12:66877348-66877370 ACCAACAATATCAACATACATGG - Intergenic
1098311821 12:69156482-69156504 ACCAAAAATCTCTCCTGGCCAGG + Intergenic
1098714296 12:73810209-73810231 ACTAGGAATATCTCCAGACCTGG + Intergenic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1099682774 12:85848980-85849002 AACAAAAATTTATCCAGGCATGG - Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1101004040 12:100384445-100384467 ACAAAAAATTTGGCCAGACATGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103822232 12:123708153-123708175 ACCAAAAATACAGCCAGGCATGG - Exonic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1103913458 12:124364145-124364167 CCCAAAGACATCTCCAGGCAAGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107371016 13:39748317-39748339 TCAAAAAATATCTCCAGGCTGGG + Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107871143 13:44747853-44747875 AGCAAATATATCTCAAGAAAAGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109178910 13:59189594-59189616 ACCAAACATAGCTGCAGAGAAGG - Intergenic
1110374954 13:74782822-74782844 ACAAAAAATATCTCTGGGCATGG - Intergenic
1110394664 13:75015453-75015475 TAGAAAAATATCTCCAGATAAGG + Intergenic
1110491060 13:76108554-76108576 ACCAAAATTATCTTTATACATGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112082961 13:95996164-95996186 AACAAAAATATTTTCAGACTGGG + Intronic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1112923025 13:104639263-104639285 ACAAAAAAAATCGCCAGGCATGG + Intergenic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116140939 14:40993729-40993751 ACAAAAAATTTAGCCAGACATGG + Intergenic
1116226142 14:42154619-42154641 ACCAAAAATATAGCCGGGCATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116569388 14:46496425-46496447 ACAAAAACTATCTCCAGCCTAGG - Intergenic
1117909618 14:60624561-60624583 ACAAAAAAAAACTCCAGGCATGG + Intergenic
1117995621 14:61475015-61475037 ACCCAAAATATCTTCCCACATGG + Intronic
1119781949 14:77281803-77281825 GCCAAAAATTTCTCCACAGATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1121954222 14:98199399-98199421 ACCAAGAATATGACCAGGCATGG + Intergenic
1122310398 14:100790674-100790696 ACCTAAAATAGCCCCGGACACGG + Intergenic
1126013920 15:44331168-44331190 ACAAAAAATATAGCCAGGCATGG - Intronic
1126296141 15:47137192-47137214 TCCAAAAATATCTCCAGTTTAGG + Intergenic
1126378671 15:48023133-48023155 ACCAAAATAATCCTCAGACATGG + Intergenic
1129904386 15:79175932-79175954 ATCAAAAATATCTCCAGGTGTGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130191904 15:81745143-81745165 ACAAAAAGTATCTCCAGGCCAGG - Intergenic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130876187 15:88016844-88016866 AAAAAAAATATCCCCAGAGAAGG - Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131407914 15:92181802-92181824 ATTAATAATATCTCCAGTCAGGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134161998 16:11898861-11898883 ATTAAAAATATCTGCAGAAAAGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134507002 16:14815849-14815871 AACGATAATATCTCCAGACCAGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134839422 16:17389876-17389898 ACTAAAAATACCTCAAGACCTGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135481633 16:22825617-22825639 ACCAAAAACATCTCTATCCAAGG - Intronic
1135523876 16:23198580-23198602 ACAAAAAAAATCACCAGGCATGG + Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1139212256 16:65090882-65090904 ACTTAAAATATCTCCAAACCTGG - Intronic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140013250 16:71157716-71157738 AACAAAAATATTTGCAAACAGGG + Intronic
1140289864 16:73643319-73643341 CTTAAAAATATCTCCAGAAAAGG - Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146200045 17:30849159-30849181 AGCAAAAATATAGCCAGGCACGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147184144 17:38704812-38704834 TCCAAAAAGACCCCCAGACACGG + Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1155378088 18:25184002-25184024 ACCAAAAATACATCAAAACAAGG + Intronic
1155785544 18:29895266-29895288 TCCAAAAATTGCTCCAGATATGG - Intergenic
1155790822 18:29968527-29968549 AACAAAAATACCACCAGGCACGG - Intergenic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1157087937 18:44601001-44601023 TCCAAAAATATTTACAGAAATGG + Intergenic
1157767314 18:50309638-50309660 AAAAAAAATATAGCCAGACATGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158867465 18:61651728-61651750 AACAAAAATATCCTCAGACCTGG + Intergenic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159309958 18:66694431-66694453 ACTAAAAAAATCTCCAGAAATGG - Intergenic
1160461012 18:79038018-79038040 ACAAAATAAAACTCCAGACATGG - Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161652095 19:5491707-5491729 AGCACAAATACCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162154892 19:8671004-8671026 AAAAAAAAGATTTCCAGACATGG + Intergenic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168423865 19:56223195-56223217 CACAAAAGCATCTCCAGACATGG + Intronic
1168426834 19:56245839-56245861 CACAAACACATCTCCAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
1202698743 1_KI270712v1_random:146762-146784 TCCAAAAATATTTCCAGCAATGG - Intergenic
925742093 2:7014957-7014979 ACCAAATAGATCACTAGACAAGG - Intronic
926124607 2:10264525-10264547 ACCCAAGAGACCTCCAGACAGGG - Intergenic
926215911 2:10905257-10905279 CCCAAAAATCTCTCTAGCCACGG + Intergenic
927664597 2:25021798-25021820 ACTAAAAATATGTACAAACATGG - Intergenic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929252223 2:39771218-39771240 ACCATATATATCTCTAGAGAAGG + Intronic
929298217 2:40272020-40272042 ACCAAAAAAATAGCCAGGCATGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930255935 2:49091457-49091479 ACAAAAAATATAGCCAGGCATGG - Intronic
931542304 2:63342509-63342531 ACTAAAAATATATACAGAAAAGG - Intronic
931606466 2:64058062-64058084 TCTAAAAATATCTCCTTACAGGG - Intergenic
934279993 2:91604547-91604569 TCCAAAAATATTTCCAGCAATGG - Intergenic
935502447 2:103857878-103857900 ACCAAAAATCACTGCAGTCATGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937123372 2:119456409-119456431 AACGAAGATATCTTCAGACATGG + Intronic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939674614 2:145056485-145056507 AAAAAAATTATCTCCAAACATGG - Intergenic
940112370 2:150169031-150169053 AACAAAAATATCTCCATATGGGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940630980 2:156238208-156238230 ACCAAAAAAATCTCTGGACCTGG + Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
945034104 2:205689330-205689352 ACCAAACACATTTACAGACAAGG - Intronic
945209738 2:207369766-207369788 TCTCAAAATATCCCCAGACAAGG + Intergenic
945338218 2:208618020-208618042 ACTAAAAATATCTACAACCAAGG - Intronic
946629974 2:221656532-221656554 ATCAAAAATATTTCTAGAGATGG - Intergenic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
946763937 2:223022581-223022603 CAAAAATATATCTCCAGACATGG + Intergenic
946980221 2:225205112-225205134 ACAAAAAATTTAGCCAGACATGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947287481 2:228532621-228532643 ACCAAAAAAATATCTAGAGAAGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948118418 2:235511052-235511074 ACCGAAAATTGCCCCAGACATGG - Intronic
948553327 2:238790732-238790754 GCCAAACACATCTACAGACATGG + Intergenic
1169836879 20:9890288-9890310 AATAAAAACATCTCCAGACTGGG + Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171001611 20:21421722-21421744 AACTAAAATATCTCCAAATAGGG - Intergenic
1171024790 20:21620115-21620137 CCCAGAAATAAATCCAGACATGG + Intergenic
1171163906 20:22954000-22954022 AACAAAAAAAGCTACAGACAGGG + Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172552856 20:35815285-35815307 ACTCAAAATATGGCCAGACACGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1173985078 20:47254829-47254851 AATAAAAATATCTCCAGGCCAGG + Intronic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175837608 20:62006237-62006259 ACCAGTAACATCCCCAGACAAGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1178292584 21:31381674-31381696 AACAAAAAAATAGCCAGACATGG + Intronic
1178491214 21:33053243-33053265 ACCTAATATATCTCCAGTCTGGG - Intergenic
1178497976 21:33102923-33102945 ACCAATAATTTCACCAGCCAGGG - Intergenic
1178896072 21:36558860-36558882 TCAAAATATAACTCCAGACAAGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180589416 22:16923719-16923741 ACTAAAAAAATCTGCAGCCATGG - Intergenic
1180603992 22:17041738-17041760 ACAAAAAAAATAGCCAGACATGG + Intergenic
1180896366 22:19336596-19336618 ACTAAACATATCTACAAACAAGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182125425 22:27812210-27812232 ATTAAAAATATAGCCAGACATGG + Intergenic
1183173756 22:36206797-36206819 AGCAAAAGAATCTCCAGTCACGG + Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184588132 22:45461552-45461574 ACCAAAAAATTATCCAGGCATGG + Intergenic
1184751920 22:46491168-46491190 AACCGAAACATCTCCAGACATGG + Intronic
1184965869 22:47971790-47971812 ACAAAAAATAAATCCAGACTTGG + Intergenic
950828314 3:15848911-15848933 AGCAAAATTATCTCTAGTCACGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953762212 3:45697751-45697773 ACCAAATATCTGTCAAGACAAGG - Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955506065 3:59634433-59634455 ATTTAAAATCTCTCCAGACATGG - Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
956280426 3:67550500-67550522 ACAAAAAAAATTTCCAGGCATGG - Intronic
956661135 3:71599028-71599050 TCCATAAATAACTACAGACATGG - Intergenic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
959780089 3:110220960-110220982 AACCAAAATATATCCAAACATGG + Intergenic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961587643 3:127947154-127947176 AAGAAAAAAATCACCAGACATGG - Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962461367 3:135616445-135616467 ACTAAAACTTTCTCCAGACCAGG + Intergenic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
966464436 3:180214300-180214322 ACCAAAAATAGTACCAGGCAGGG + Intergenic
967018584 3:185503204-185503226 ACCAAAAATAGCTCCATCAAAGG - Intergenic
967039197 3:185673969-185673991 TCCACAAATATATCCAAACATGG + Intronic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967949136 3:194827175-194827197 ACAAAAAAAATAGCCAGACATGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969030767 4:4211305-4211327 TCCAAAAATATTTCCAGCAATGG + Intronic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
971630378 4:28985350-28985372 ACGAAAAGCATCTCCAGACATGG - Intergenic
973200702 4:47498537-47498559 ACCAAGTATATCTCCAGCAAAGG + Intronic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976116377 4:81732647-81732669 ACCAAAGAGAACTCCAGATATGG - Intronic
976180229 4:82391917-82391939 ACCAGAAAGCTCTCCAGTCATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977335386 4:95691911-95691933 AGAGAAAATATCTCCAAACACGG - Intergenic
978262511 4:106777734-106777756 ACAAAAAATAAATCCAAACATGG + Intergenic
978314715 4:107422871-107422893 ACCTAAAATTTCTCCACACCAGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979945051 4:126818931-126818953 ACCAAAAATATAATCAGAAATGG + Intergenic
980254368 4:130358550-130358572 AATAAAAATATTTCCAGACTGGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985172129 4:187162706-187162728 ACCAATAACATTTCCAGAGAAGG + Intergenic
986596636 5:9429607-9429629 ATCAGGAATATCTCCTGACAAGG + Intronic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988302984 5:29457012-29457034 ACCAAGAATATCTGCACACTTGG - Intergenic
988575598 5:32420658-32420680 ATCAAAAATATATGCAGATATGG - Intronic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989250018 5:39302307-39302329 ACCATAAATATATCAACACATGG - Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989388143 5:40873360-40873382 ACCAAAAAATTAGCCAGACATGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
992145133 5:73839264-73839286 GCTTAAAATATCTCCTGACATGG - Intronic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
993682744 5:90899701-90899723 ACTAAAAATATATTCAAACAAGG - Intronic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998422780 5:142002888-142002910 AGCAAACAGATCTCCAGAAATGG + Intronic
998438868 5:142139062-142139084 ACAAAAAAAATAGCCAGACATGG + Intronic
1000135732 5:158348662-158348684 AACAAATATATCTCCAGTTAGGG + Intergenic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004767654 6:18748615-18748637 ACCAGAAATACCTGCAGCCAGGG - Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007438652 6:41838328-41838350 ACCAAACATATCTGCAACCAAGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008059102 6:46978074-46978096 ACAAAAAATTTAGCCAGACATGG + Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1011282258 6:85688870-85688892 ACCAAAAGAATACCCAGACATGG - Intergenic
1011749366 6:90439790-90439812 ACCAAAGATATCTACAGAAGAGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013654974 6:112237156-112237178 GCCAAAAATACCGTCAGACAGGG + Intronic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014204158 6:118637760-118637782 ACTAAAAATATTTGCAGATATGG + Intronic
1014497559 6:122144768-122144790 ACCAAAAATATTTTCAGAAGGGG - Intergenic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1014990621 6:128070902-128070924 AGCAAAAATATCAACAGAAAAGG - Intronic
1016047688 6:139497368-139497390 AAGAAAAATATAGCCAGACAAGG - Intergenic
1019794678 7:3041069-3041091 ACCAAAAAATTAGCCAGACATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023528882 7:41133232-41133254 ACCAAGAATATCCAGAGACAAGG + Intergenic
1023901403 7:44483362-44483384 AGCAAAAATATCCTCAGAAATGG + Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025292806 7:57746064-57746086 ACCAAACATATATCTTGACAGGG + Intergenic
1026310430 7:69178965-69178987 ACAAAAAATTTAGCCAGACATGG - Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027915040 7:84306931-84306953 AAAAAAAAAATCTCCAGACTTGG - Intronic
1028898204 7:96065531-96065553 ACCAAAAATTTAGCCAGGCATGG - Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030264497 7:107605375-107605397 ACCAAACATATGTCCATAAAGGG + Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031670245 7:124533916-124533938 ACCAAAACAATATCCAGAGAAGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032829915 7:135612142-135612164 ACAGAATATATTTCCAGACAAGG + Intronic
1034134955 7:148758461-148758483 ACAAAAAAAATATCCAGGCATGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036510431 8:9395012-9395034 AAAAAAAAAATGTCCAGACAAGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038131314 8:24734620-24734642 ACCAATAAAATTTCAAGACAAGG + Intergenic
1039622197 8:39008324-39008346 ACCAAAAAATTAGCCAGACATGG - Intronic
1040994836 8:53391044-53391066 ACCAAAAATATCTGCATCCTAGG - Intergenic
1041030633 8:53732498-53732520 AACAGAAATAACTACAGACAGGG + Intronic
1042073628 8:64963995-64964017 AACAAAAATAATTCCAGAGATGG + Intergenic
1043234736 8:77848954-77848976 ACCAAAACTAACTCAAAACAGGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043977947 8:86604354-86604376 ACCTAAAGTATTTACAGACATGG + Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045807891 8:106186746-106186768 ATGAAAAACATCTCCAGGCAAGG - Intergenic
1045909994 8:107396402-107396424 ACCAAAATTATCTTTAGAAATGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047567680 8:126063320-126063342 ACCAAAAAAATTGCCAGGCATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051229527 9:14941059-14941081 TGCAAAAATATCTCCAGTCTGGG - Intergenic
1051514816 9:17917648-17917670 ACCAAAGATATTTCAAGAAAAGG - Intergenic
1051838392 9:21366103-21366125 ACCAAAAATTTGGCCAGGCATGG - Intergenic
1053043009 9:34890678-34890700 CCAAAGAATATCTCCACACAGGG - Intergenic
1054722034 9:68613921-68613943 ACCAAAAATATATCCAAGAAAGG + Intergenic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055216309 9:73867154-73867176 ATCAAAAATATCTCCAATGATGG - Intergenic
1055330714 9:75180365-75180387 ACAAAAAAAATCTCCATAAATGG - Intergenic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1059948032 9:119432728-119432750 AAAAAAAAAATCTCCAAACAGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060070990 9:120547306-120547328 AACAAAAATATTTCCAGGCCGGG + Intronic
1060322698 9:122579392-122579414 TCCAAAGCAATCTCCAGACAAGG - Intergenic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185796459 X:2969436-2969458 ACCGGAAATATCTCCAGCCGTGG + Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186132884 X:6487802-6487824 TCCAAGCATATTTCCAGACATGG + Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1186639564 X:11441049-11441071 ACAAACCATATCTCCAGAAAAGG + Intronic
1186714545 X:12236889-12236911 TCCAAAAGTATCTCCAGAACTGG - Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187834411 X:23416614-23416636 ACCAACAATATCTCTCTACATGG + Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1189030015 X:37440939-37440961 AACAAAATTATGTGCAGACAAGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190452477 X:50595491-50595513 ACCAAAGAAATCTCCTGAAATGG - Exonic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1191589331 X:62863724-62863746 ACCAAAAATATTTAAAGAGAGGG - Intergenic
1191820030 X:65295923-65295945 AGCAAAAATATATCCAGAAAGGG + Intergenic
1193103705 X:77644093-77644115 ACAAAAAATTTAGCCAGACATGG - Intronic
1194040221 X:88931959-88931981 ATCAAAAATATCACCATATATGG - Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196048451 X:111280552-111280574 ACCAAAGATTTCTACATACATGG + Intergenic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1196219416 X:113094833-113094855 ACAAAAAACATAGCCAGACATGG + Intergenic
1198330082 X:135614402-135614424 ACCACAAATATCTCCTGCCATGG + Intergenic
1198362754 X:135911868-135911890 ACCACAAATATCTCCTGCCATGG + Exonic
1198393893 X:136204205-136204227 ACCAAATAAATCTCCAGTAACGG - Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199749778 X:150804454-150804476 AACAAAGATCTCTCCAGGCACGG + Intronic
1200750686 Y:6941693-6941715 ACCAAGAAATACTCCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic