ID: 1189098900

View in Genome Browser
Species Human (GRCh38)
Location X:38168745-38168767
Sequence CTGTGGATGGCTCTGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 456}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189098892_1189098900 -3 Left 1189098892 X:38168725-38168747 CCCCAGCCAGAGCGTAATCTCTG 0: 1
1: 0
2: 0
3: 18
4: 124
Right 1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG 0: 1
1: 0
2: 1
3: 66
4: 456
1189098894_1189098900 -5 Left 1189098894 X:38168727-38168749 CCAGCCAGAGCGTAATCTCTGTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG 0: 1
1: 0
2: 1
3: 66
4: 456
1189098893_1189098900 -4 Left 1189098893 X:38168726-38168748 CCCAGCCAGAGCGTAATCTCTGT 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG 0: 1
1: 0
2: 1
3: 66
4: 456
1189098891_1189098900 -2 Left 1189098891 X:38168724-38168746 CCCCCAGCCAGAGCGTAATCTCT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG 0: 1
1: 0
2: 1
3: 66
4: 456
1189098896_1189098900 -9 Left 1189098896 X:38168731-38168753 CCAGAGCGTAATCTCTGTGGATG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG 0: 1
1: 0
2: 1
3: 66
4: 456
1189098890_1189098900 12 Left 1189098890 X:38168710-38168732 CCAGTTGTTTGCTTCCCCCAGCC 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG 0: 1
1: 0
2: 1
3: 66
4: 456
1189098889_1189098900 27 Left 1189098889 X:38168695-38168717 CCATTGAAAACTCATCCAGTTGT 0: 1
1: 0
2: 0
3: 27
4: 197
Right 1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG 0: 1
1: 0
2: 1
3: 66
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189098900 Original CRISPR CTGTGGATGGCTCTGGGAAG TGG Intronic
900300199 1:1973300-1973322 CTGGGCAGGGGTCTGGGAAGAGG + Intronic
901438694 1:9264596-9264618 CAGTGGGTGACTGTGGGAAGAGG - Exonic
902127014 1:14223154-14223176 CTCTGGATTGCCCAGGGAAGAGG + Intergenic
902182810 1:14702362-14702384 GTGTGGATTTCTCTGTGAAGAGG + Intronic
902332992 1:15739655-15739677 CTGAGCAAGGCTCTGGGATGTGG - Exonic
903374257 1:22855991-22856013 CTGTCTGTGGCTCTGGGTAGAGG - Intronic
903926424 1:26833946-26833968 CTGAGGATGGGGCTGGGCAGAGG - Intronic
904094582 1:27966964-27966986 CTGTGGCTGCCTGTGGGATGCGG + Exonic
904313569 1:29645308-29645330 CTGTGGAGGCATCTGGGCAGGGG - Intergenic
904536568 1:31203311-31203333 CTGTGGATGTCCCTCAGAAGGGG + Intronic
905794611 1:40808567-40808589 CTGGGGACTGCTCTGGGAAGAGG - Intronic
906087409 1:43147909-43147931 CTGTGGAAGGCCCAGGCAAGAGG + Intronic
906302339 1:44692097-44692119 CTGTGCATGGGTCAAGGAAGGGG - Intronic
906891891 1:49725519-49725541 CTGTGGTTGGCTCTAGGATGAGG + Intronic
907578064 1:55546444-55546466 CTGGGGATAGCCCTGGGAATTGG + Intergenic
908078146 1:60543596-60543618 ATGTGGATGAGTCTGGGAAGGGG - Intergenic
909647533 1:77934386-77934408 CTGTGGAAGGCTCAGGTCAGAGG - Intronic
910267384 1:85352201-85352223 CTGTGCACAGCTCTGGGATGTGG - Intronic
910274020 1:85428976-85428998 CTGGGGATGGCTGTGGGGATAGG + Intronic
912242433 1:107925660-107925682 CTGTCAATGGCTAGGGGAAGGGG + Intronic
912489057 1:110051354-110051376 CTGTGGATGCCTTTGGGGTGGGG + Intronic
912504173 1:110144314-110144336 CTTATGATGGCTATGGGAAGAGG + Intergenic
912747602 1:112258348-112258370 GTGTTGATAGCTCTTGGAAGGGG + Intergenic
913290872 1:117270370-117270392 ATGTGCAGGGCTCTGGCAAGAGG + Intergenic
914209926 1:145568038-145568060 CTTTGGAAGGCTGTGGCAAGAGG + Intergenic
915109594 1:153554558-153554580 TTGGAGATGGCTGTGGGAAGGGG + Intergenic
915147762 1:153805414-153805436 CTGTGGTTGGCTGTGAGATGGGG + Exonic
915468722 1:156113505-156113527 CTGCAGCTGGCTCTGGGGAGGGG - Intronic
915524730 1:156468566-156468588 CTGGGGCTGGCTCTCAGAAGGGG + Intronic
915636284 1:157189371-157189393 CTGTGGTGGGGTCTGGGAACCGG + Intergenic
915852720 1:159343302-159343324 CTTTTGATGTCTCTGTGAAGAGG - Intergenic
915897710 1:159824557-159824579 CTGGGGAGGGCTCTGTGGAGGGG - Intergenic
916202055 1:162281520-162281542 CTGTGGGAGGATATGGGAAGCGG + Intronic
916719585 1:167474206-167474228 CTGGGGGTGGGGCTGGGAAGGGG + Intronic
917615870 1:176743580-176743602 GTGTTGATGGCTTTGGGAAGTGG + Intronic
918164732 1:181934358-181934380 AAGTGGTTGCCTCTGGGAAGTGG + Intergenic
919832505 1:201552067-201552089 TTGGGGGTGGCTGTGGGAAGTGG + Intergenic
919861196 1:201740325-201740347 GTGTGGAGGGCTCTAGGGAGTGG + Intronic
920124278 1:203681265-203681287 CTGTGGAAGCTTCTGGGAAGAGG + Intronic
921293894 1:213683952-213683974 CTTTAGATGGTGCTGGGAAGAGG - Intergenic
921598349 1:217079771-217079793 CTGTGCCTGGCTCTGAGAGGAGG - Intronic
921687720 1:218109241-218109263 CAGGGGATGGCTCTGGGATGGGG - Intergenic
921897803 1:220419114-220419136 CTGTTGATGGATCAGGGTAGTGG - Intergenic
921925175 1:220705347-220705369 CTGCTGATGGCTCTAGGAAGTGG - Intergenic
922579947 1:226689434-226689456 CTGTGGTAGGCCCAGGGAAGGGG + Intronic
922706851 1:227794747-227794769 CTGTGGCTGGCTCAGGGCTGAGG + Intergenic
922806600 1:228393520-228393542 CTGTGCCTGGGTGTGGGAAGTGG + Intergenic
922998003 1:229982266-229982288 CTGTGGATGGGTCTGGGGCTGGG - Intergenic
923055086 1:230420385-230420407 CTGTGGTTATCTCTGGGAAAAGG + Intronic
924162633 1:241249077-241249099 CTGTGGAAGACCCTGTGAAGAGG - Intronic
1063478513 10:6349817-6349839 TTGGGTGTGGCTCTGGGAAGTGG + Intergenic
1063850765 10:10187459-10187481 CTGTTGATGGTTGGGGGAAGGGG - Intergenic
1064048626 10:12042218-12042240 CCGTGGATACCTGTGGGAAGGGG - Intronic
1064963779 10:20995037-20995059 CTGTGGTTGGCTTTTGGGAGAGG - Intronic
1065959361 10:30721937-30721959 CTGAGGATTGCTCAGGGTAGCGG + Intergenic
1067536785 10:47116577-47116599 GTGTGGATGTTTATGGGAAGAGG + Intergenic
1069627356 10:69876541-69876563 CTGTGCTCTGCTCTGGGAAGTGG - Intronic
1070250378 10:74767786-74767808 CTGTGTATAGTTATGGGAAGTGG + Intergenic
1070743743 10:78920029-78920051 TTAGGGATAGCTCTGGGAAGAGG + Intergenic
1070775812 10:79109156-79109178 CTGTTCGTGGCTCTGGGAGGTGG + Intronic
1071093236 10:81944941-81944963 CTATGGTTGGTGCTGGGAAGTGG - Intronic
1072495436 10:95953012-95953034 TTGGTGAAGGCTCTGGGAAGTGG - Intronic
1072664885 10:97385577-97385599 CTGTGGATGGATATTGGGAGGGG - Intronic
1073045061 10:100632143-100632165 CTATGGATGGCTCAGGTTAGTGG - Intergenic
1073068077 10:100775702-100775724 CTGTGGGTGGCTCTGGCTTGAGG - Intronic
1073541588 10:104319722-104319744 CTGTGACTGGGTTTGGGAAGGGG - Intronic
1073593283 10:104776689-104776711 CTGTGGGTGGCTCTCGGAGGGGG - Intronic
1075057794 10:119233020-119233042 ATGTGGCTGGCTCTGGGGAAAGG + Intronic
1075222959 10:120600567-120600589 CCGAGGCCGGCTCTGGGAAGAGG + Intergenic
1075244986 10:120813096-120813118 TTATGGCTGGCTTTGGGAAGAGG - Intergenic
1075289232 10:121214078-121214100 TTGTGTACGGCTCTGGGGAGAGG - Intergenic
1075293296 10:121249696-121249718 TTGGGGATAGCTTTGGGAAGGGG + Intergenic
1075688450 10:124379743-124379765 CCGTGCAAGGCTCTGGGAAGTGG - Intergenic
1076738168 10:132467964-132467986 CCGTGGCTGGCCCTGGGAGGGGG - Intergenic
1076916137 10:133423881-133423903 CTGGGGGAGGCGCTGGGAAGTGG + Intronic
1076936241 10:133568667-133568689 CTGGGGGAGGCGCTGGGAAGTGG + Intronic
1077117839 11:893374-893396 CTGTGGAGGGCTCTGGGGTCGGG - Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1080669478 11:34362986-34363008 CTGTTCAAGGCTCAGGGAAGAGG + Intergenic
1081512382 11:43789022-43789044 CTGTGGATGGCACAGAGAAGCGG - Intronic
1081664610 11:44909614-44909636 CTGGGGCTGGCTCAGGGGAGTGG + Intronic
1081863182 11:46345810-46345832 CAGTGGGGGGATCTGGGAAGAGG + Intronic
1082170936 11:49004177-49004199 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1083310763 11:61782510-61782532 CTGTGGCTGGCTCTGTACAGGGG + Intronic
1083590742 11:63892599-63892621 CTCTGGATGGTTCTGGGATGAGG + Intronic
1083735595 11:64678483-64678505 CTGGTGCTGGCTGTGGGAAGTGG - Intronic
1083938911 11:65884740-65884762 AGGTGGATGGATCTGGGGAGGGG - Intronic
1083944193 11:65915083-65915105 CTGTGGTAGGCTCTGGGAACAGG + Intergenic
1084698515 11:70770611-70770633 CAATGGACGGCTCTGGGAAAGGG + Intronic
1084726246 11:70944264-70944286 GGGTGGATGGCTCTGGGAGAGGG - Intronic
1084934001 11:72577332-72577354 CAGTGGAGGGCTGTGGGAGGTGG + Exonic
1085088207 11:73687207-73687229 CTGTCAATGGCTGGGGGAAGGGG + Intronic
1085839291 11:79992657-79992679 CTGTGGCTTGCTCTGGAGAGTGG + Intergenic
1087104301 11:94394883-94394905 CTAAGGATGGGTCTGGGGAGTGG - Intronic
1087129796 11:94658746-94658768 TTGTGGAAGGTTCTGGGAACTGG + Intergenic
1089301757 11:117503151-117503173 TTGAGGCTGGCTCTGGGCAGGGG + Intronic
1089896797 11:121938472-121938494 CTGTGGATGTACCTGGGAACTGG - Intergenic
1090091892 11:123705334-123705356 GTGTAGATGGCTCTAGGGAGTGG - Intergenic
1090299931 11:125626312-125626334 CTGTGGATGGGGATGGGAATTGG + Intronic
1090398731 11:126435230-126435252 ATGAGAATGGCCCTGGGAAGGGG - Intronic
1090470038 11:126972462-126972484 CTGTGGCTGGGCCTGGAAAGTGG - Intronic
1090870491 11:130741813-130741835 CAGTGATTGCCTCTGGGAAGTGG + Intergenic
1091586713 12:1821043-1821065 CTGTGGATTCTGCTGGGAAGTGG + Intronic
1091636345 12:2199767-2199789 CTGTGGATGCCTATGTAAAGTGG + Intronic
1091706306 12:2695638-2695660 CTGGGGAGGGCAGTGGGAAGAGG - Intronic
1091711534 12:2743867-2743889 CTGGGGAGGGCAGTGGGAAGAGG - Intergenic
1092008406 12:5088502-5088524 CTGTGGCTGGATCTGTGATGTGG + Intergenic
1092389099 12:8059738-8059760 CTGTGGATGTATCTGGGTGGTGG - Exonic
1093196215 12:16132338-16132360 CTGTTTATGCCTCTGGGAAGAGG - Intergenic
1093711303 12:22333243-22333265 CTGTGGATGCCTCTGGAAGATGG - Intronic
1094417541 12:30233114-30233136 GTGTGCATTGCTCTGAGAAGAGG - Intergenic
1095478923 12:42613599-42613621 CTGTAGATGGCAGGGGGAAGTGG - Intergenic
1096332126 12:50722716-50722738 CTGAGGAAGACTCTGGGCAGAGG - Intronic
1096375689 12:51108342-51108364 CAGTGGTTTCCTCTGGGAAGAGG + Intronic
1097036950 12:56130335-56130357 CTGTGGATAGCTCAGGGACGTGG - Intronic
1097704612 12:62855015-62855037 CTGTGTTTGACTCTGGAAAGTGG - Intronic
1098760432 12:74418070-74418092 ATGTGGATGGTGCTGGAAAGTGG + Intergenic
1099504096 12:83450645-83450667 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1101858320 12:108462736-108462758 GTGTGGAGGCCTTTGGGAAGTGG - Intergenic
1102024189 12:109704107-109704129 CTGTGCCTGGCCCTGGGGAGTGG - Intergenic
1102662545 12:114542342-114542364 ATGTGGCTGCCTCTGAGAAGGGG + Intergenic
1102665198 12:114565962-114565984 ATGTGGCTGCCTCTGAGAAGGGG - Intergenic
1102691675 12:114766230-114766252 CTGTGCATGGGTCTGGGGGGGGG - Intergenic
1103535029 12:121628071-121628093 CTGCGGATGGGCCTGAGAAGTGG + Intronic
1104568491 12:129904644-129904666 TGGGGGATCGCTCTGGGAAGGGG - Intergenic
1104758631 12:131284104-131284126 CAGTGGCTGCCTCGGGGAAGGGG + Intergenic
1104935193 12:132360762-132360784 GTGTGTCTGGCTCTGGGATGGGG - Intergenic
1105843998 13:24279374-24279396 CTGTGGATGATTCTGAGCAGAGG + Intronic
1106056545 13:26243025-26243047 CTGTAGATTGCTTTGGGTAGTGG + Intergenic
1106577820 13:30992298-30992320 CTGTGGATTCCTCAGGAAAGGGG + Intergenic
1106811643 13:33364173-33364195 CTGTGCCTGGCTGAGGGAAGGGG - Intergenic
1107186328 13:37525761-37525783 CTGTGGATATCTCAGGGCAGTGG - Intergenic
1108701799 13:52950054-52950076 CTGAGGATGGCTCAAGGAGGGGG + Intergenic
1110464795 13:75788870-75788892 CCATGCATTGCTCTGGGAAGTGG + Intronic
1111840075 13:93438938-93438960 CTGCTGATGGATCAGGGAAGTGG - Intronic
1114447004 14:22796370-22796392 CTGAGGGTTGCTGTGGGAAGGGG - Intronic
1114830702 14:26138033-26138055 ATGTGAATTGCTCTGGGAAGGGG + Intergenic
1115192141 14:30757040-30757062 CTTGGGATGGCTTTGGGAATAGG + Intergenic
1115235050 14:31201190-31201212 CAGTGGTTTCCTCTGGGAAGAGG + Intronic
1115497895 14:34025124-34025146 GTGTGGATGGCTTAGAGAAGAGG - Intronic
1117274046 14:54174402-54174424 CTGGGGATGGAAGTGGGAAGAGG - Intergenic
1117396129 14:55312334-55312356 CCGTGAAAGCCTCTGGGAAGGGG - Intronic
1117771254 14:59136441-59136463 CTGTGCATGTTTCTGGGAAGGGG - Intergenic
1118082357 14:62375352-62375374 CTTTGGAAGGCTGAGGGAAGTGG + Intergenic
1118212754 14:63780864-63780886 TTGTGGATGGCATTGGGATGGGG + Intergenic
1118228643 14:63927302-63927324 CTGTGGATGGCTGAGGCAGGAGG + Intronic
1118424200 14:65641172-65641194 CTGTGGATGAAGGTGGGAAGTGG - Intronic
1118546729 14:66898165-66898187 CTGTGAATGACACTGTGAAGAGG - Intronic
1118807690 14:69251912-69251934 CTGGGGATGCCTCTGAGGAGGGG - Intergenic
1118846027 14:69548370-69548392 CTGTGGATGGCTCTGGAGTGAGG - Intergenic
1119729215 14:76940389-76940411 CTGGGGAGGGATCTGGAAAGGGG - Intergenic
1119761733 14:77156538-77156560 CAATGGTTGTCTCTGGGAAGGGG - Intronic
1119899605 14:78248699-78248721 CTCTGAATGGCTTTGAGAAGGGG + Intronic
1120561294 14:85996345-85996367 GTGTGGTTGGCTCTGAGAAGTGG - Intergenic
1120741995 14:88118561-88118583 CTGTGACTTGCTTTGGGAAGAGG - Intergenic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1121177212 14:91899528-91899550 CTGTGGATGTCTCAAGGGAGAGG - Intronic
1121273492 14:92652605-92652627 CTCTGGAGAGCTCTGGGAATGGG - Exonic
1121301671 14:92876688-92876710 CTGTGGATGTCTCATGTAAGTGG + Intergenic
1121324938 14:93014360-93014382 CTGTGTGTGTGTCTGGGAAGTGG + Intronic
1122379086 14:101288678-101288700 CTGTGGGTGGCTGTGGACAGAGG - Intergenic
1122573678 14:102726692-102726714 CAGTGGAGCTCTCTGGGAAGTGG - Exonic
1123113415 14:105883248-105883270 CTGTTGGTGGCGCTGGGAAGAGG + Intergenic
1202934586 14_KI270725v1_random:74556-74578 CTGTGGAAGGCCATGGCAAGAGG - Intergenic
1124588937 15:31036372-31036394 CTGTGGAAGGCTTGGGGGAGGGG + Intronic
1124784244 15:32664496-32664518 CTGTGGATTGCTCTTAAAAGCGG - Intronic
1124913889 15:33949564-33949586 CTGAGGCTGGGTGTGGGAAGGGG + Intronic
1124963134 15:34412958-34412980 CTGTGGGTGCCTCAGAGAAGTGG - Intronic
1124979757 15:34559184-34559206 CTGTGGGTGCCTCAGAGAAGTGG - Intronic
1127370205 15:58332059-58332081 GTGAGGAGGGCTCTGGGAAGAGG - Intronic
1128157899 15:65403351-65403373 CAGTGGTTGTCTCTGGGGAGGGG + Intronic
1128608906 15:69058407-69058429 CTGAGGCAGGCCCTGGGAAGGGG + Intronic
1129177845 15:73852869-73852891 ATGTGGACTGCCCTGGGAAGGGG - Intergenic
1129417198 15:75391987-75392009 CTGTGGACGCACCTGGGAAGGGG - Intronic
1130415035 15:83685621-83685643 TCCTGTATGGCTCTGGGAAGAGG + Intronic
1130559185 15:84945271-84945293 CTGAAGAGGGCTCTGGGAAAGGG - Exonic
1130996462 15:88907166-88907188 CTGGGGATGGCCCTGGGGCGGGG - Intronic
1132114073 15:99123334-99123356 CTAGAGATGGCTCTGGGATGTGG + Intronic
1133336476 16:5009824-5009846 TTGTGGCTGGATCTGGGAGGGGG + Intronic
1134597121 16:15504694-15504716 CTTTGGAAGGCTGAGGGAAGAGG - Intronic
1134892547 16:17853864-17853886 CTGTGCAAGGAGCTGGGAAGTGG - Intergenic
1135379969 16:21987701-21987723 CTATGGGTGGCCCTGGGAAAAGG + Intronic
1135481349 16:22822977-22822999 CTATGGTTGCTTCTGGGAAGAGG - Intronic
1136056672 16:27694959-27694981 CTGTGGAAGGCTGTGGGTAGAGG - Intronic
1136519296 16:30786027-30786049 CTTTGGATGGCTGTGTGAGGTGG + Intronic
1136714441 16:32265647-32265669 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136753448 16:32663770-32663792 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1136814665 16:33206595-33206617 TTGTGGATGGCTCTGGGCTGGGG + Intronic
1136821141 16:33316675-33316697 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136827704 16:33373214-33373236 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136832770 16:33471985-33472007 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1137584920 16:49658608-49658630 CTGGGGAAGGCTCTGGGATATGG + Intronic
1138188781 16:54997631-54997653 CTGTGTATGGCGCTGTGAAGTGG + Intergenic
1138375827 16:56563375-56563397 CTGTGGCAGGCACTGGGGAGGGG - Intergenic
1139741079 16:69035663-69035685 CTCTGGATGGCTTTTAGAAGTGG + Intronic
1140279749 16:73543807-73543829 CAGCAGAAGGCTCTGGGAAGTGG - Intergenic
1141171473 16:81694372-81694394 CTGGGGATGGCTCTATGGAGAGG - Intronic
1141780493 16:86157183-86157205 CTCTGTCTGGCTCTTGGAAGGGG - Intergenic
1141987234 16:87587926-87587948 CCGTGGATGGGGGTGGGAAGAGG - Intergenic
1141988424 16:87594858-87594880 CTGGGCAAGGCTTTGGGAAGGGG - Intergenic
1142009063 16:87704518-87704540 CTGGGGAGGGCCCTGGGGAGGGG + Intronic
1142157258 16:88538234-88538256 TGGTGGATGGGTTTGGGAAGCGG - Intergenic
1142285078 16:89168393-89168415 ATGTGGCTGGCTCTGGGTAGTGG - Intergenic
1202993241 16_KI270728v1_random:29569-29591 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1203055609 16_KI270728v1_random:924122-924144 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1143296371 17:5874851-5874873 CTGGGGAGGTCTCTGGCAAGAGG - Intronic
1143476582 17:7206854-7206876 TTGTGGGATGCTCTGGGAAGGGG - Intronic
1144549957 17:16231481-16231503 CTTTGGAAGGCTGTGGCAAGAGG - Intronic
1144645630 17:16971828-16971850 GTCTGGATGCCTCTGGGATGTGG - Intronic
1145203825 17:20969745-20969767 GTCTGGATGCCTCTGGGATGTGG + Intergenic
1145982936 17:29024792-29024814 GGGTGGTTGGCTCTGGGGAGAGG + Intronic
1147609553 17:41793522-41793544 CTGTGGAGAGCCTTGGGAAGAGG + Intergenic
1147630124 17:41924838-41924860 GTGGGGGTGACTCTGGGAAGGGG - Intronic
1147644936 17:42027858-42027880 CTGGGGTAGGCCCTGGGAAGGGG + Intronic
1147760421 17:42794646-42794668 CATTGGATGGGTCTGGGAGGGGG - Exonic
1148645719 17:49218858-49218880 CTTTGGGTGGCTCAGGCAAGAGG - Intronic
1148732078 17:49843435-49843457 CTCTGGATGACTCTGGGGAGTGG - Intronic
1148844572 17:50521746-50521768 CTGTGAGTGGCTCTGGCAAGAGG + Intronic
1149991195 17:61384561-61384583 CTGTGGATGGCCCAGGGAGGAGG - Intronic
1150733695 17:67717603-67717625 CTGTAGATGGGTCTAGGGAGTGG - Intergenic
1151316376 17:73325101-73325123 CTGTGTCTGGCTCTGGGTACAGG - Intergenic
1151383220 17:73739827-73739849 CAGTGGATGGTTCTGGGGAAAGG - Intergenic
1152110882 17:78357287-78357309 CTGTGCAGGGCTCGGGGCAGTGG + Exonic
1152130034 17:78470845-78470867 CTGTGGATGACTCTGAAAGGGGG - Intronic
1152328284 17:79655361-79655383 CTATAGATGGCTCTGGGGGGTGG - Intergenic
1152467675 17:80475279-80475301 CTGGGGCTGTCTCTGGGAAAGGG - Intronic
1152519608 17:80847557-80847579 CTGTGCATGGCCGTGGGGAGGGG + Intronic
1153737012 18:8081731-8081753 CTGTGGATGGGTCTGAGATGGGG + Intronic
1155112802 18:22733195-22733217 CTGGGGATGCCTCTCTGAAGAGG - Intergenic
1156965370 18:43085000-43085022 CTGTGGATGAAGCTGGGATGAGG + Intronic
1157536192 18:48459510-48459532 CTGTGGATAACTCTGAGAACTGG + Intergenic
1160723438 19:607432-607454 CTGTGCCAGGCTCTGGGGAGGGG - Intronic
1160874916 19:1292444-1292466 CTGTGTAGGGCCCTGGGGAGGGG + Intronic
1160973409 19:1780392-1780414 CTGGGGATGGCTCAGGGACGTGG - Exonic
1161277441 19:3426575-3426597 CCGTGGATGGCTGTGCGCAGAGG - Intronic
1161480112 19:4506160-4506182 CCCTGGAGGGCTCTGGGCAGAGG - Intronic
1161558671 19:4958427-4958449 CTGTGGGGGGCTATTGGAAGAGG + Intronic
1161624680 19:5319542-5319564 CTATGGAGGGCTGTGGGCAGAGG - Intronic
1162271719 19:9621368-9621390 CTGGGGTTGGCTCAGGGAGGGGG + Exonic
1162798802 19:13099886-13099908 GTCTGGATGGCTCTTGGGAGGGG - Intronic
1162958394 19:14112460-14112482 CTGGGGATGGATCTGGGATCAGG - Intronic
1163174193 19:15552677-15552699 AGGTGGTTGGATCTGGGAAGTGG + Intergenic
1163359566 19:16837246-16837268 CACTGGATGGTTCTGGGAGGCGG + Intronic
1163604261 19:18265512-18265534 GGGTGGATGTCTCTGGGATGAGG + Exonic
1163669404 19:18618504-18618526 CTGTGAATGGCGCTGGGCCGAGG + Intronic
1163672659 19:18637638-18637660 CTGTGGGAGGCTCTGGGTGGGGG + Intronic
1164517055 19:28945439-28945461 CTGTGGATGGGCCAGGGAGGAGG - Intergenic
1164518830 19:28961173-28961195 CTGTGTCTGCCTCTGGGTAGGGG - Intergenic
1164815703 19:31200812-31200834 CTGTGCATGTGTGTGGGAAGGGG + Intergenic
1165184670 19:34007454-34007476 CTGTGGGTAGCTCTGGGCTGAGG - Intergenic
1165369857 19:35398373-35398395 CCGCGGCTGTCTCTGGGAAGGGG - Intergenic
1165640453 19:37380834-37380856 AAGTGGATCGCTCTAGGAAGAGG - Intronic
1165718653 19:38063364-38063386 CTGAGGATGGCTCTAGGCTGAGG - Intronic
1165719759 19:38070851-38070873 CTCTGGAGGGCTCAGGGATGTGG - Intronic
1165935345 19:39385362-39385384 CTGTGCCTGGCACTGGGAGGTGG + Intronic
1166887663 19:45971845-45971867 CCGTGGGGGGCTCAGGGAAGAGG - Intronic
1166892459 19:46001740-46001762 CTGTGGATGGGCCTGGGGGGTGG + Intronic
1167100493 19:47401695-47401717 CCAAGGATGGCTCTGGGGAGAGG + Intergenic
1167501614 19:49851513-49851535 CCGTGGAAGGCTCTGGAAAAAGG - Intronic
1167642041 19:50687413-50687435 GTGTGTGTGTCTCTGGGAAGGGG - Intronic
1167713587 19:51126532-51126554 CAGTGGTTGGTTCTGGGGAGGGG - Intronic
1168271232 19:55250866-55250888 CTCTGCATGGCTGTGGGGAGAGG - Intronic
925201422 2:1970163-1970185 CTGAGTCCGGCTCTGGGAAGTGG - Intronic
927416975 2:22890157-22890179 TTGTTGGTGGCTCTGGGCAGTGG - Intergenic
927477656 2:23426130-23426152 TTCTGGAAGGCTGTGGGAAGCGG + Intronic
931438067 2:62266182-62266204 CTGGAGATGGTTCTGGAAAGAGG + Intergenic
932279356 2:70476365-70476387 ATGTGAATGGCTCTGGGAACTGG + Intronic
933465129 2:82641826-82641848 CTGTGCATGCCCCTAGGAAGGGG + Intergenic
933748161 2:85585516-85585538 CTGAGGAAGGCTCTGAGAATAGG + Intronic
936267495 2:111021651-111021673 CTCTGCTTGGCTTTGGGAAGAGG - Intronic
936891739 2:117378563-117378585 CTGTGGAGGGCTTGGGGCAGTGG + Intergenic
936892956 2:117393395-117393417 CTGTGGGTGTCTCTGGAAAGAGG - Intergenic
937527204 2:122786151-122786173 CAGAGGATGGGTCTGGGAAACGG - Intergenic
937821164 2:126312763-126312785 CTGTGGATGGGCCTGGGAATTGG - Intergenic
938050217 2:128162992-128163014 CTGTGGCTGTCACGGGGAAGGGG - Intronic
939045824 2:137248666-137248688 GTGTGGATGGTTCTGTGAAGAGG - Intronic
939911855 2:147992860-147992882 CTGTGGCTGGCTTTGGGGAAAGG - Intronic
940601801 2:155872660-155872682 CTGGGAATGCTTCTGGGAAGAGG + Intergenic
940896963 2:159090102-159090124 CAGTGGCTGCCTCTGGGAATGGG - Intronic
941172435 2:162155844-162155866 CTGTGGTTGTTTCTTGGAAGAGG + Intergenic
942059496 2:172215235-172215257 CTGGTGATGGGTCTGGGCAGAGG + Intergenic
944426925 2:199593282-199593304 ATGTTGATGGATCTGGAAAGAGG - Intergenic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
945178519 2:207067714-207067736 ATGTGGTTGGCTCTTGGAACAGG - Intergenic
945480302 2:210337603-210337625 CTGTGAATGAATCTGGGAAGGGG - Intergenic
945776692 2:214114598-214114620 CTGTGCCTGGCTCGGGGCAGGGG - Intronic
947770485 2:232666448-232666470 CTGTGGTGAGCTCTGGGAACAGG + Intronic
947809987 2:232998133-232998155 CTGCGGTTTCCTCTGGGAAGAGG - Intronic
947855133 2:233318847-233318869 CTCTGGGCGGCTCTGGGAAGGGG + Intronic
948494913 2:238341747-238341769 CTCAGGATGGCTCTGTGAGGCGG + Intronic
1169220363 20:3819008-3819030 TTGTGCATGGCCCTGGGGAGTGG + Intergenic
1170555714 20:17513238-17513260 TAGTGGAGGGCTCTGAGAAGGGG - Intronic
1171413249 20:24960430-24960452 CTCTGGAGGGCTCTGGGGAGCGG - Intergenic
1171420057 20:25011996-25012018 TGGTGGCTGGGTCTGGGAAGGGG - Intronic
1172125359 20:32622328-32622350 CTATGGAGGGCTCTGAGCAGGGG + Intergenic
1172132379 20:32664387-32664409 CTACGGCTGGCTCTGGCAAGCGG - Intergenic
1172761351 20:37325442-37325464 CTGCGGCTGCTTCTGGGAAGTGG + Intergenic
1173801747 20:45898565-45898587 ATGTACAGGGCTCTGGGAAGGGG - Exonic
1174081782 20:47975043-47975065 TTGTGGATGTCTCTGAGAAGAGG - Intergenic
1174754053 20:53140785-53140807 CTGTGCATCACTCTGGGAAGAGG + Intronic
1175053806 20:56179214-56179236 CTGTGGATGACTCTGGGCTTTGG + Intergenic
1175479548 20:59301527-59301549 CTGTGGCTGGCCCTGGCGAGGGG + Exonic
1175918312 20:62437975-62437997 CAGTCGGTGGCTATGGGAAGGGG - Intergenic
1176595996 21:8696761-8696783 CTGTGGAAGGCCATGGCAAGAGG - Intergenic
1177204133 21:17992381-17992403 CTGTAGATTGCTTTGGGCAGTGG + Intronic
1178671137 21:34592582-34592604 ATGTAGACGGCTCCGGGAAGGGG - Intronic
1178672406 21:34603409-34603431 TTTTGGATGGCGCTGGGAAAGGG + Intronic
1179485843 21:41710350-41710372 CTGAAGGAGGCTCTGGGAAGTGG + Intergenic
1179858649 21:44175483-44175505 ATGTGCATGGTTCAGGGAAGAGG + Intergenic
1180002703 21:45002320-45002342 CTGGGGAGGGATCTGGGGAGGGG + Intergenic
1180157265 21:45983673-45983695 CTGTGGATGGCACCGGGGAGGGG + Intronic
1180278911 22:10674217-10674239 CTGTGGAAGGCCATGGCAAGAGG - Intergenic
1180859650 22:19070459-19070481 CTGTGCTTGGCTTGGGGAAGAGG - Intronic
1181135813 22:20765577-20765599 CTGTGGAGGGCTCAGGTAGGGGG - Exonic
1181432491 22:22890234-22890256 CAGTGGCTATCTCTGGGAAGAGG - Intronic
1181933255 22:26419948-26419970 AGGTGGATGGCTTTGGGAAGAGG + Intergenic
1182623960 22:31632565-31632587 ATGTGCATGGCTTTGGGATGTGG - Intronic
1182711640 22:32326910-32326932 ATGTGGGTGCCTCTGGGAACTGG + Intergenic
1182832388 22:33314377-33314399 TTGAGGGTGGCTCAGGGAAGTGG - Intronic
1182897640 22:33872272-33872294 CTGAGAATGACTCTGTGAAGTGG - Intronic
1183057682 22:35317054-35317076 CAGGGGATGCCTCTAGGAAGAGG + Intronic
1183271902 22:36867535-36867557 CTGGGTATGGCTTTGGGAACTGG + Intronic
1183527748 22:38334159-38334181 AAATGGATGGCTCTGGGAAATGG + Intronic
1184094895 22:42311188-42311210 CTGCGGCAGGCTCTGGGCAGGGG + Intronic
1184241209 22:43212166-43212188 CTGGGGAGGGCTCTGGGGACAGG - Intronic
1184590916 22:45482655-45482677 CTTTGGTTGCCTCTGGTAAGGGG - Intergenic
1184876569 22:47279574-47279596 CTGTGGATTGCAGTGGGCAGTGG + Intergenic
1185286293 22:50001286-50001308 TTGTGGGTGGTTCTGGGAAGGGG + Intronic
950366633 3:12490359-12490381 CTGTGGCTACCTCTGGGAACGGG - Intronic
950587363 3:13904156-13904178 CTGTGCATGTCCCTAGGAAGGGG + Intergenic
950765064 3:15267452-15267474 CTGTGAAGGGATCTGGGAAGAGG + Intronic
951867970 3:27328667-27328689 CACTGGAAGGCTCTGGGGAGAGG + Intronic
952512520 3:34071466-34071488 CTGCAGAAGGCTCTGGAAAGAGG + Intergenic
953570209 3:44065445-44065467 CGGTGGCTGGCTCCGGGCAGCGG + Intergenic
953863418 3:46564297-46564319 AAGTGGATGGCTCTGTAAAGTGG - Intronic
953863420 3:46564314-46564336 AAGTGGATGGCTCTGTAAAGTGG - Intronic
953920073 3:46945438-46945460 CTGCTGAAGGCTCTGGGAGGAGG - Intronic
954456397 3:50601956-50601978 CAGTGGATGGCTGTGGGAGGAGG - Intergenic
955681950 3:61511604-61511626 CTGTGGACAGCTCTGGGAGGGGG + Intergenic
955993860 3:64657790-64657812 CAGTGGCTGCCACTGGGAAGGGG + Intronic
956193894 3:66633049-66633071 ATGCGAATGGCTCTGGGAATGGG - Intergenic
956420657 3:69083290-69083312 TTGTGGATGTATCTGGGTAGGGG - Intergenic
957303786 3:78429750-78429772 GAGTGGTTGCCTCTGGGAAGGGG - Intergenic
957935881 3:86941925-86941947 AAGTGAATGGCTCTGGCAAGTGG - Exonic
959000940 3:100963741-100963763 CTGTGGATGGAGCAGGTAAGTGG - Intronic
959469444 3:106731732-106731754 CTGTGGAGGGTTCTGTGAACTGG - Intergenic
960611394 3:119558093-119558115 CTGTGGTTGGTTCTTGGAACTGG - Intronic
961128772 3:124446148-124446170 CTCAGGATGGCTGTGGGCAGAGG - Exonic
961163083 3:124745950-124745972 CTCTGGGTAGCTCTGGGATGGGG + Intergenic
961459693 3:127042626-127042648 CAGTGGAGGGGGCTGGGAAGTGG - Intergenic
961603647 3:128078086-128078108 CTCTGGAGGGCTGTGGGCAGAGG - Intronic
963044538 3:141093027-141093049 TTCAGGGTGGCTCTGGGAAGGGG + Intronic
964642410 3:158923813-158923835 CTGGGGAGGGGTCTGGGGAGAGG + Intergenic
965659652 3:171028210-171028232 CTGTGGACCGCTCTGGCAATGGG - Intergenic
966398818 3:179527016-179527038 CTGTGCATTGTTCTGGGAAAAGG + Intergenic
966776300 3:183545557-183545579 CTGTGGATCTCTCTATGAAGAGG + Intronic
968312691 3:197697139-197697161 CTTGGGAGGGCTTTGGGAAGGGG - Intronic
968568233 4:1326179-1326201 GTGGGGAAAGCTCTGGGAAGCGG + Intronic
968901134 4:3432486-3432508 CTGTGGCTGGCTCTGCGCACAGG + Intronic
969114446 4:4862333-4862355 CTCTGGATGGCCCTGGGAGGAGG + Intronic
973552810 4:52052149-52052171 GTGTGGATTGCGCTGGCAAGGGG - Intronic
973628319 4:52794395-52794417 CTGTGACTGTCTCTGGGCAGTGG + Intergenic
974007457 4:56573076-56573098 GTGTGGATGACTCTGGGAGGAGG + Intronic
974775025 4:66468247-66468269 CTATGGTTTGCTTTGGGAAGAGG + Intergenic
976072674 4:81259673-81259695 CTGAGGATGGCTGTGGTAAAAGG - Intergenic
978498164 4:109382248-109382270 CTGAAGATGGAGCTGGGAAGAGG - Intergenic
978563277 4:110055677-110055699 CTCTAGCTAGCTCTGGGAAGAGG - Intronic
980211355 4:129792314-129792336 GTGTGGCTGGCTCTGGCCAGGGG - Intergenic
981079749 4:140627516-140627538 CAGAGGATGGCTCTAGGGAGGGG + Exonic
981125025 4:141095777-141095799 TAGTGGCTGCCTCTGGGAAGGGG + Intronic
982429598 4:155307401-155307423 CAGTGGTTATCTCTGGGAAGAGG - Intergenic
988276340 5:29085568-29085590 CTGTGTATTTCTCTGGGCAGAGG + Intergenic
988471421 5:31543022-31543044 CAGTGGTTGCCTCTGGGGAGAGG + Intronic
990541397 5:56776456-56776478 CTGTCGAGGGGTGTGGGAAGGGG - Intergenic
992025065 5:72662153-72662175 CTGTGGAGGGCAGTGGGAAGAGG - Intergenic
992212551 5:74495092-74495114 CTGTATAGGGCTCTGGGTAGGGG + Intergenic
992458273 5:76936807-76936829 CTGGGGATGGAGATGGGAAGAGG + Intergenic
992732772 5:79689672-79689694 CGGGGGAGGGCTCAGGGAAGAGG + Intergenic
992979246 5:82150670-82150692 CTGTGGACGACTGTGTGAAGGGG - Intronic
995024466 5:107403145-107403167 CTGTGGATGGTTCTGGAGACTGG - Intronic
995069570 5:107904089-107904111 CAGTGGAGAGCTCTGGAAAGGGG - Intronic
995737429 5:115316666-115316688 CTTTGGATGGCCCTGTGAAATGG + Intergenic
997311830 5:132892302-132892324 CAGAGCATGGCTCTCGGAAGAGG - Exonic
998042963 5:138965002-138965024 CTGAGGGTGACGCTGGGAAGAGG + Intronic
999140725 5:149359722-149359744 CTCTGGATGACTCTTGGATGGGG - Intronic
999264675 5:150258626-150258648 CTGAGGGTGCCTCTGGGGAGGGG + Intronic
999702618 5:154242054-154242076 ATGTGACTGGCTCTGTGAAGTGG + Intronic
1000749398 5:165075065-165075087 CTGTGCAGTGCTCTGGGAAGGGG - Intergenic
1001600040 5:172922777-172922799 CCGTGGAGGGTTCTGGGCAGAGG + Intronic
1001629285 5:173162842-173162864 CAGAGGTTGCCTCTGGGAAGTGG - Intronic
1002922098 6:1580120-1580142 CTTGGGATGGTTGTGGGAAGGGG - Intergenic
1003237238 6:4306556-4306578 CTGTGCATGTGTCAGGGAAGGGG - Intergenic
1003363729 6:5452884-5452906 CTGTGAAGGGCTAAGGGAAGTGG + Intronic
1003371949 6:5537266-5537288 CTGTGGAAGGCACTGGGGAAGGG - Intronic
1003378052 6:5597268-5597290 GTGTGGCTGTCTTTGGGAAGGGG + Intronic
1004649789 6:17598335-17598357 TTGTGGCTGGCTTTGGGAAAGGG - Intergenic
1004785649 6:18964738-18964760 ATGTGGATGTCTCTGGAAACTGG + Intergenic
1005086298 6:22010306-22010328 CTGTGCACAGCTCTGGGATGTGG + Intergenic
1006143922 6:31946994-31947016 CAGTGGATTGCTTTGAGAAGGGG - Exonic
1006298196 6:33179360-33179382 GTGTGGATAGTTCTGGAAAGGGG - Intronic
1006300627 6:33192092-33192114 CTCTGAGTGTCTCTGGGAAGGGG - Intronic
1006473827 6:34242869-34242891 CTGTGGGGAGGTCTGGGAAGGGG + Intronic
1006572529 6:35017614-35017636 GTCTGGATGGCTCTGGCCAGCGG - Exonic
1006664461 6:35681435-35681457 CAGTGGTTGCCTCTGGGTAGGGG - Intronic
1006671282 6:35731415-35731437 CTGCTGGTGGCTCTGGGACGGGG - Intergenic
1007231327 6:40349381-40349403 CTGTGGAGGGCTGTGGGGATGGG - Intergenic
1007255874 6:40528323-40528345 CTGTAGATGCCCATGGGAAGAGG + Intronic
1007953238 6:45891728-45891750 CAGTGGTGAGCTCTGGGAAGGGG + Intergenic
1007966966 6:46012331-46012353 CTGTGGATGGCGCAGGGATTTGG - Intronic
1013696596 6:112709610-112709632 CTGTGGTTGGGTCGGGGGAGGGG + Intergenic
1013712158 6:112914513-112914535 CTGTGGTTGGGTCGGGGGAGGGG - Intergenic
1016995374 6:149958851-149958873 CTGTTGCTGGCTCTGAGATGTGG - Intergenic
1017003237 6:150010653-150010675 CTGTTGCTGGCTCTGAGATGTGG + Intergenic
1017012848 6:150074691-150074713 CTGTTGCTGGCTCTGAGATGTGG + Intergenic
1017818236 6:158030397-158030419 CTGTGGCTGCCTCTGGCAAAGGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1018686835 6:166309732-166309754 CTCTGGATGGGTGTGGGAAGAGG + Intergenic
1018694787 6:166382920-166382942 GTGTCATTGGCTCTGGGAAGCGG - Exonic
1019665968 7:2252538-2252560 CTGGGGTTGGCTCTGTGGAGGGG - Exonic
1020115415 7:5473398-5473420 CTGTCCTGGGCTCTGGGAAGAGG - Intronic
1020878392 7:13727464-13727486 ATGTGGAGGGTTCTGGCAAGAGG - Intergenic
1021102375 7:16598606-16598628 CTGTGGAGGACTCTGGCAAGAGG - Intergenic
1022212568 7:28225791-28225813 CTGGGGAGGGCCCTGGAAAGGGG + Intergenic
1022983701 7:35628688-35628710 CTGGGGTTTGCTCTGGAAAGAGG + Intergenic
1023848272 7:44135553-44135575 CTGGGGAGAGCTCTGGGAGGGGG - Intergenic
1023978142 7:45048153-45048175 GTGTGGCTGCCTCTTGGAAGTGG + Intronic
1024047657 7:45596258-45596280 CTGGAGAAGGCTCTGGGAACAGG - Intronic
1024989798 7:55224239-55224261 CTGTGGTGAGATCTGGGAAGGGG - Intronic
1025113476 7:56238557-56238579 CTGGGGATGGCTTTTGGGAGAGG - Intergenic
1026259120 7:68738790-68738812 CTCTGGTTGGCTCTGGTCAGGGG - Intergenic
1026873333 7:73866441-73866463 CTGTGGATGGCTTTGTGAGTGGG - Intergenic
1028593231 7:92520894-92520916 CTGAGGATGGGACTGGGAAAAGG + Intronic
1028759226 7:94476370-94476392 CTGTGGATGCATCTGGGGATGGG + Intergenic
1029160845 7:98550689-98550711 CTGGGGAAGCTTCTGGGAAGAGG + Intergenic
1029304970 7:99612386-99612408 CTGTGGATGTCTTTTGGGAGAGG + Intergenic
1031973155 7:128078032-128078054 CTGAGGATGGCTGTGGAAAGTGG + Intronic
1033128002 7:138721741-138721763 CTGTGAAGGTCTCAGGGAAGGGG - Intronic
1033280725 7:140004729-140004751 CTGGGGAAGGCTGTGGAAAGGGG - Intronic
1033282210 7:140014350-140014372 CTGTGGACCGCCCAGGGAAGAGG + Intronic
1033498167 7:141920829-141920851 CTGTGGTGGGGTCGGGGAAGGGG - Intronic
1033622033 7:143070205-143070227 CTGAGGATGGTCCTGGGATGTGG - Intergenic
1033671759 7:143499952-143499974 CTGTGGATGTATGTGGGCAGGGG - Intergenic
1034285477 7:149880772-149880794 CAGTGGGTGGGTCTGGGGAGGGG + Intergenic
1034955075 7:155328971-155328993 ATGTGGGTGTCTCTGGGAGGAGG - Intergenic
1035282438 7:157786484-157786506 CTGTGGATGGCACTGGAAACTGG + Intronic
1035360849 7:158313434-158313456 CTGGGGATGGAGCTGGGCAGAGG + Intronic
1035471104 7:159109431-159109453 CTCTGGAAGTTTCTGGGAAGTGG - Intronic
1038596510 8:28890789-28890811 CTGGGGATGGGTCTCGTAAGCGG + Exonic
1039968965 8:42305642-42305664 TTGTGGATGTGGCTGGGAAGAGG + Intronic
1041186566 8:55307170-55307192 CTGTGGAAGACTCTGCTAAGGGG + Intronic
1042618054 8:70671480-70671502 CTGTGGTGGGGTCGGGGAAGGGG - Intronic
1043211312 8:77522024-77522046 CTGTGGAGGGATCTGGTAGGAGG - Intergenic
1043431224 8:80196828-80196850 ATGTCCATGGCTTTGGGAAGGGG + Intronic
1043915719 8:85920221-85920243 CTGTGGATATCTGGGGGAAGAGG - Intergenic
1044634573 8:94309755-94309777 CTCTGGAAGGCTATGGGGAGAGG + Intergenic
1045416054 8:101968700-101968722 ATGTGGAGGGTTTTGGGAAGAGG - Intronic
1045583648 8:103505175-103505197 CAGTAGTTGGCTCTGGGTAGGGG - Intronic
1046404584 8:113756241-113756263 CTGTGGAAGGCTGAGGCAAGGGG + Intergenic
1046642021 8:116742758-116742780 CTATGATTGCCTCTGGGAAGAGG + Intronic
1047049121 8:121090246-121090268 CTGCTGATGGCTCTGGGTGGTGG + Intergenic
1047287222 8:123497551-123497573 CTGTGCAAGGCACTGGGAATAGG - Intergenic
1048387879 8:133930169-133930191 CTGTGGTTGCCTCTGGGAAGAGG - Intergenic
1049357598 8:142196404-142196426 GTGCCGTTGGCTCTGGGAAGAGG - Intergenic
1049399352 8:142417991-142418013 CTGTGGTGAGCTCTGGGAAGTGG + Intergenic
1049487906 8:142876032-142876054 CTGTGGAGGACTCAGGGAAAGGG - Intronic
1049830661 8:144699317-144699339 GTGTGGGGGGCTATGGGAAGGGG + Intergenic
1050405541 9:5304766-5304788 CTGTGGAGGGGTGTGGGAAAGGG - Exonic
1050408840 9:5339927-5339949 CTGTGGAGGGGTGTGGGAAAGGG - Intergenic
1050464795 9:5910782-5910804 GTGTGGGTGCCTCTGTGAAGTGG - Intronic
1052049109 9:23824983-23825005 CTGTGCTGGGCGCTGGGAAGTGG - Intronic
1052815485 9:33099839-33099861 CTCTGGTTGACTCTGGCAAGGGG + Intergenic
1053062875 9:35045232-35045254 CTGTGGCTGAAGCTGGGAAGAGG - Exonic
1053239618 9:36486235-36486257 CTGCGGATGTCCCTTGGAAGGGG - Intronic
1053471225 9:38347183-38347205 GTGTGGATAGCTCAGAGAAGGGG + Intergenic
1055787103 9:79883276-79883298 GTGGGGAAGGCTCTGGGGAGAGG + Intergenic
1055964203 9:81849650-81849672 CTGTGCTGGGCTCTGGGATGCGG + Intergenic
1056856987 9:90140241-90140263 CTGTGCCTGGGTCTGGGCAGAGG + Intergenic
1056970705 9:91199442-91199464 GTGTGTGTGGCTCTGGGAAGAGG - Intergenic
1059106343 9:111515018-111515040 CAGTGGATGGCTATGGGTGGGGG - Intergenic
1059529544 9:115023253-115023275 CTGTGGAGGGACCTGGGCAGGGG + Intronic
1060059636 9:120447568-120447590 CTGTGGATGCCTCTGGCGTGTGG - Intronic
1060754907 9:126205721-126205743 CTGTGTGTGGCTTTGGGGAGAGG + Intergenic
1061313901 9:129782162-129782184 CTGTGCATTCCTCTGGGAAGGGG - Intergenic
1062315046 9:135963003-135963025 CTGTGGAGGGGACAGGGAAGAGG + Intergenic
1062670746 9:137707449-137707471 CTGAGGATGGCCCAGGGCAGAGG - Intronic
1185787611 X:2904056-2904078 CTGTGGACGGCTCTGCGAATAGG - Exonic
1187503136 X:19856657-19856679 CTGTAGTTGCCTCTGGGGAGGGG - Intronic
1187884229 X:23874254-23874276 ATGTGGATTTTTCTGGGAAGAGG - Intronic
1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG + Intronic
1189298466 X:39935642-39935664 CTGGTGATGGCTCAGAGAAGGGG - Intergenic
1190344284 X:49322669-49322691 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190345377 X:49332213-49332235 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190346475 X:49341779-49341801 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190347721 X:49532807-49532829 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190348822 X:49542363-49542385 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190349924 X:49551919-49551941 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190351027 X:49561472-49561494 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190352128 X:49571030-49571052 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190353229 X:49580579-49580601 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190354337 X:49590126-49590148 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1190355434 X:49599650-49599672 GGGTGAATGGCTCTAGGAAGTGG + Intronic
1191098710 X:56701747-56701769 CTGTGGAGGGGTCGGGGGAGGGG + Intergenic
1191270999 X:58469000-58469022 CTGTGGAGGGGTCGGGGGAGGGG + Intergenic
1192668387 X:73112005-73112027 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1192693275 X:73386845-73386867 CTGTGGTGGGGTCGGGGAAGGGG + Intergenic
1195094612 X:101492150-101492172 CAGTGGAGGGCTCTGGGCTGGGG + Exonic
1195742832 X:108082616-108082638 ATGTGAATTTCTCTGGGAAGAGG - Intergenic
1195905013 X:109835990-109836012 CTGATGAAGGCTCTGGGTAGAGG - Intergenic
1195921640 X:109989678-109989700 CTGGGGGAGGCTCTGGAAAGTGG + Intergenic
1196736835 X:118987676-118987698 TTGGGGATGAGTCTGGGAAGAGG + Intronic
1197023234 X:121716501-121716523 CTGTGCATGTCACTAGGAAGAGG - Intergenic
1197107876 X:122737278-122737300 CAGCTGATGGCTCTGGCAAGGGG + Intergenic
1197263799 X:124345067-124345089 TTGGGGATGGCTCTGGGGAATGG - Intronic
1198382988 X:136101553-136101575 CTGTGGATGAGGATGGGAAGAGG + Intergenic
1198664733 X:139008120-139008142 CTGTGGCTGCCTTTGGGAAGGGG - Intronic
1198988557 X:142483704-142483726 CTGTGGTGGGGTCGGGGAAGAGG + Intergenic
1199810870 X:151347214-151347236 CTGTGTCTGGCCCTGGGAATAGG - Intergenic
1199874482 X:151919991-151920013 GTGTGGATGGGAATGGGAAGGGG - Intronic
1200072101 X:153534304-153534326 CTGAGGCTGGCTTGGGGAAGTGG - Intronic
1201613820 Y:15873358-15873380 CTGAGGATGTGACTGGGAAGGGG - Intergenic