ID: 1189099844

View in Genome Browser
Species Human (GRCh38)
Location X:38177413-38177435
Sequence AGGACTGGACAACTTTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189099844_1189099850 20 Left 1189099844 X:38177413-38177435 CCAGTCAAAAGTTGTCCAGTCCT 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1189099850 X:38177456-38177478 GAGACACATCACAACAAACAAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1189099844_1189099851 21 Left 1189099844 X:38177413-38177435 CCAGTCAAAAGTTGTCCAGTCCT 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1189099851 X:38177457-38177479 AGACACATCACAACAAACAAGGG 0: 1
1: 0
2: 1
3: 16
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189099844 Original CRISPR AGGACTGGACAACTTTTGAC TGG (reversed) Intronic
910934044 1:92472499-92472521 AGGACTTCACTACTTTTTACTGG - Intergenic
912503819 1:110141936-110141958 ACAACTGGACAACTCTTCACAGG - Intergenic
912827010 1:112914577-112914599 AGCACTGGACAAGTGTTTACAGG - Intronic
913396776 1:118380163-118380185 AGGACTGAAAAGCATTTGACTGG - Intergenic
920605000 1:207372773-207372795 ATAACTGGACATCTTTTGCCAGG + Intergenic
922030888 1:221796690-221796712 TTGACTGGTCAGCTTTTGACTGG + Intergenic
924870366 1:248036670-248036692 ATCACTGGACAACTTTGCACAGG - Intronic
1065965674 10:30768610-30768632 AGGAATGAACAACTCTGGACGGG - Intergenic
1070618676 10:77989360-77989382 AGGGCTGGAGAACATTTCACGGG + Intronic
1072042278 10:91619455-91619477 AGCACTCGACAACTTTTTGCAGG - Intergenic
1073837329 10:107459607-107459629 AATACTGGACTACTTGTGACAGG + Intergenic
1074563653 10:114556772-114556794 AGGAGTTGACAAATATTGACTGG + Intronic
1079175507 11:18136786-18136808 AGGACTGGTCATCTCTGGACAGG - Intronic
1079803352 11:24897471-24897493 AGGAATGAACAACTCTGGACGGG + Intronic
1083264292 11:61539140-61539162 AGGTCTGGAGAAGTTTTGGCAGG + Intronic
1086001451 11:81990245-81990267 AGGAATGAACAACTCCTGACGGG - Intergenic
1086552672 11:88070214-88070236 AGGAATGAACAACTCTGGACGGG + Intergenic
1087574125 11:99968800-99968822 GGGACTGGGAAAGTTTTGACAGG + Intronic
1090811167 11:130244934-130244956 TGTACTGGAAAACTTGTGACAGG + Intronic
1093443598 12:19229511-19229533 AGGAATGAACAACTCTAGACAGG - Intronic
1093559315 12:20519265-20519287 AGGAGTGGCCAAATTATGACTGG + Intronic
1095585367 12:43843746-43843768 AGGACTGGGCAACTTTGCATTGG - Intronic
1096076680 12:48810383-48810405 GAGACTGGAAGACTTTTGACTGG - Intergenic
1096408447 12:51360445-51360467 AGGACTGGACATCTGGTGACTGG - Intronic
1099191130 12:79562738-79562760 AGGAATGAACAACTCTGGACGGG + Intergenic
1105404254 13:20120269-20120291 TGGACTGGCCCCCTTTTGACTGG - Intergenic
1105682087 13:22738753-22738775 AGGACTTGACTAGATTTGACAGG - Intergenic
1105784975 13:23739570-23739592 AGGACTGGTCATCTGTTGATAGG + Intronic
1107436039 13:40381919-40381941 AGAACTGGACAGCTTGTCACTGG - Intergenic
1108990970 13:56658196-56658218 AGGAATGAACAACTCTGGACGGG - Intergenic
1109608735 13:64734915-64734937 AGGACTGGAAAACTTCTGTTGGG - Intergenic
1109938503 13:69327138-69327160 AGTAATGCACAACTTGTGACAGG - Intergenic
1113793533 13:113043288-113043310 AGGACTTGAAAGCATTTGACTGG + Intronic
1115421197 14:33198070-33198092 AGGAATGAACAACTCTGGACGGG - Intronic
1117666750 14:58063664-58063686 ATGGCTGAACAACTTTTGCCAGG + Intronic
1121128115 14:91421010-91421032 AGGACGGGACAAGTTTGGCCTGG + Intergenic
1121843412 14:97153140-97153162 AGGCCTGGACAACTCTTGAAAGG - Intergenic
1123764180 15:23459362-23459384 CAGACTGGACAACTGTGGACTGG + Intergenic
1123787735 15:23689584-23689606 AGGACTGGATAACTTCTACCTGG + Intergenic
1129429956 15:75492581-75492603 AGGACAGGAGAACTCTTCACTGG + Intronic
1130735438 15:86543680-86543702 AATACTGGACAACTAATGACAGG + Intronic
1132077935 15:98838584-98838606 AGTACTGGAAAAGTCTTGACAGG - Intronic
1137758898 16:50924884-50924906 AGAACTGGACAGGTTTTGAGAGG - Intergenic
1139534751 16:67564383-67564405 TGGACTGGACAACTTTGGTTAGG - Intronic
1147469172 17:40642029-40642051 AGGGCTGGAAAGCTTTTGGCTGG - Intronic
1155274123 18:24169698-24169720 AGGACTGCACCTCTTTGGACAGG - Intronic
1156727838 18:40150492-40150514 AGGTCTGGAAAACTTGTTACAGG + Intergenic
1157009741 18:43632579-43632601 ATTACTGGACAACTTTTTAACGG + Intergenic
1157487198 18:48096506-48096528 AGGATGTGACAACGTTTGACAGG + Intronic
1162263197 19:9548916-9548938 AGGAATGAACAACTCTGGACAGG + Intergenic
1166253231 19:41585538-41585560 AGGAGTGGACAACTTGGGGCTGG - Intronic
924977335 2:190754-190776 AGGAATGAACAACTTCAGACGGG - Intergenic
926732803 2:16049891-16049913 AGGACTGCACAAGTGTGGACTGG - Intergenic
930443333 2:51437214-51437236 AGGAATGAACAACTCTGGACGGG + Intergenic
932403460 2:71498082-71498104 AGGACTAAACAAGTTTTTACTGG - Intronic
937960380 2:127453681-127453703 AGGAGGGGACAACTCTTGCCTGG + Intronic
938655569 2:133429422-133429444 AGGACTGTAAAACTTTTTATTGG - Intronic
943516359 2:188891703-188891725 AGGAATGAACAACTCTGGACAGG + Intergenic
951897272 3:27622111-27622133 AGGTGTGGAGAACTTTTGATGGG - Intergenic
952132158 3:30377100-30377122 AGGACTAAACAACATTTCACTGG - Intergenic
953570424 3:44067244-44067266 AGGACAGGACAACTTTAGTAAGG - Intergenic
955378153 3:58415328-58415350 GGGACTCCAGAACTTTTGACCGG + Intronic
957209262 3:77239326-77239348 AGGAATGAACAACTCTGGACGGG - Intronic
957605575 3:82394660-82394682 AGGACAGGACAATATTTAACAGG - Intergenic
959123048 3:102255727-102255749 AGGACTGGACATCTTTGGGAGGG - Intronic
959819628 3:110717698-110717720 GGTACTTGACAACTTTTGAAGGG - Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
961402758 3:126658540-126658562 AGCACTGGACAGCTGTTGAAGGG + Intergenic
962177086 3:133166637-133166659 AGGAATGAACAACTCTGGACGGG - Intronic
964993349 3:162843850-162843872 AGGAATGAACAACTCTGGACCGG - Intergenic
964993352 3:162843873-162843895 AGGAATGAACAACTCTGGACAGG - Intergenic
965227211 3:166005277-166005299 AGTACTGGAGAACTTTTCTCAGG + Intergenic
967263084 3:187664059-187664081 AGCTCAGGACAACTTTTTACAGG + Intergenic
972358580 4:38305234-38305256 AGGAATGAACAACTCTGGACGGG + Intergenic
972913454 4:43847142-43847164 AGGAATGAACAACTCTGGACGGG + Intergenic
975036445 4:69689787-69689809 AGGAATAGACAACTTTTGCTAGG - Intergenic
975376063 4:73646877-73646899 AGTTATGTACAACTTTTGACTGG + Intergenic
982498164 4:156118373-156118395 AAGCCTGGACAAAATTTGACAGG + Intergenic
983643482 4:169966063-169966085 AGGAGTGGAAAACTTATGGCTGG + Intergenic
985221154 4:187706800-187706822 AGTACTGGAGAACTGTTGAGAGG + Intergenic
985954486 5:3253318-3253340 GGGACTTGACAACTTCTTACAGG + Intergenic
986244943 5:5998629-5998651 GGGTATGGACAACTTTTGGCAGG + Intergenic
988436554 5:31181910-31181932 AGGACTGGATATTCTTTGACAGG - Intergenic
988500340 5:31778482-31778504 AGGAATGAACAACTCTGGACGGG + Intronic
990085185 5:51967957-51967979 AGGTCTGGATAAATTTTGAGTGG + Intergenic
996421406 5:123267018-123267040 AGGCCTGGACAAGTATTGATGGG + Intergenic
996576490 5:124982171-124982193 AGGTTTGGACAAGTTTTGAAGGG - Intergenic
996905499 5:128595300-128595322 AGTAATGCACAACTTTTGAGAGG + Intronic
1000084894 5:157880295-157880317 AGGAATGAACAACTCTGGACAGG + Intergenic
1000086018 5:157887858-157887880 AGGAATGAACAACTCTGGACGGG + Intergenic
1001187877 5:169594014-169594036 TGTACCTGACAACTTTTGACTGG + Intronic
1002780782 6:364179-364201 AGGACTGGGAAACTGTGGACGGG - Intergenic
1003421395 6:5961408-5961430 GGGACTGGACTAATTTAGACTGG - Intergenic
1004483093 6:16039743-16039765 AGGAATGAACAACTCTGGACAGG - Intergenic
1005803735 6:29453429-29453451 AGTACTGGAGCACTTTTCACAGG - Intronic
1009827347 6:68883580-68883602 AGGAGTGAACAACTCTGGACTGG + Intronic
1010875616 6:81101590-81101612 AGGCTTGAACAACTTTTCACTGG + Intergenic
1013819499 6:114137578-114137600 ACAACTTGACAACTTTTGAATGG - Intronic
1017644540 6:156526894-156526916 AGAACTGGAGAAGTTTTGTCTGG - Intergenic
1020892594 7:13897917-13897939 AGTACTGGACTTCCTTTGACGGG + Intronic
1021242552 7:18221659-18221681 GGGAATGCACAACTTTTGGCAGG + Intronic
1023605013 7:41922220-41922242 AGTTCATGACAACTTTTGACAGG + Intergenic
1027825542 7:83110498-83110520 AGGAAAGGACAAATTTTGTCAGG - Intronic
1029592072 7:101513993-101514015 GAGACTGGACATCTTTTCACAGG - Intronic
1030398555 7:109019185-109019207 AGGAGTAGAGAACCTTTGACAGG + Intergenic
1030979163 7:116166158-116166180 ATGACTGAACAACTTGTTACAGG + Intergenic
1031302780 7:120084240-120084262 GGGTCTGGACTGCTTTTGACAGG + Intergenic
1031957684 7:127958790-127958812 ACCACTGGACAACTTTTGGGAGG + Intronic
1040809515 8:51436066-51436088 ATGACTGGAAACCTTTTGAAAGG + Intronic
1040964444 8:53070502-53070524 AGGAATGAACAACTCCTGACAGG - Intergenic
1041623736 8:60001288-60001310 AGGACTGTACCACTTTGGAATGG + Intergenic
1043789807 8:84450271-84450293 AGAACTGGGAAACTTTTGACAGG + Intronic
1044418809 8:91967452-91967474 AGGAGTTGAGAACATTTGACTGG - Intronic
1044939565 8:97326986-97327008 AGAAATGGAGAACTATTGACTGG - Intergenic
1059328249 9:113517808-113517830 AGGATTCGACAGCTTTTGAAAGG - Intronic
1062501270 9:136853001-136853023 AGCACTGGACATCTTTTGTCCGG - Intronic
1186281929 X:8002555-8002577 AGGAATGAACAACTTCGGACAGG - Intergenic
1189099844 X:38177413-38177435 AGGACTGGACAACTTTTGACTGG - Intronic
1189550076 X:42083753-42083775 AGGACGGGGCAATTATTGACTGG - Intergenic
1190005611 X:46734281-46734303 AGGACTGGAAAACATATGCCAGG + Intronic
1190970245 X:55341646-55341668 GTGAATGGACAACTTTTGAATGG + Intergenic
1201260812 Y:12157695-12157717 AGGAATGAACAACTCTAGACAGG - Intergenic
1201705688 Y:16934088-16934110 AGGAATGGATAGCTTTTGAGAGG + Intergenic