ID: 1189100802

View in Genome Browser
Species Human (GRCh38)
Location X:38187531-38187553
Sequence CATAGTTTACACTTTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189100802 Original CRISPR CATAGTTTACACTTTGAGGT AGG Intronic
902366758 1:15980437-15980459 CATAGTTTATTTTTTAAGGTAGG + Intergenic
903053255 1:20617331-20617353 CATAATCTACCCTGTGAGGTAGG - Intronic
909950788 1:81717970-81717992 CATAGTTTTAATTTTGTGGTTGG + Intronic
911089041 1:94002758-94002780 CAGGGTTTGCATTTTGAGGTAGG - Intronic
913069469 1:115285995-115286017 AATAATTTACAGGTTGAGGTAGG + Exonic
917849926 1:179053133-179053155 CATCTTTCAGACTTTGAGGTAGG - Intronic
919601676 1:199630896-199630918 TATAGTTTACAGTTTAAGATAGG - Intergenic
923586583 1:235278319-235278341 CATGGTTAACACATTTAGGTAGG - Intronic
923715315 1:236420366-236420388 CATACTCTAAACTTTAAGGTTGG - Intronic
924544883 1:245017556-245017578 CAGAGTTTACAATTATAGGTTGG - Intronic
924944341 1:248836026-248836048 GATAGTTTTCACTTTGAGAGTGG + Intergenic
1067109447 10:43389877-43389899 CATAGTCAATAATTTGAGGTGGG - Intronic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1071357058 10:84808380-84808402 CATAATTTACAATTTGATTTTGG + Intergenic
1072724103 10:97801063-97801085 GAGAGCTTGCACTTTGAGGTAGG - Intergenic
1073210197 10:101794411-101794433 CACATTTTACATTTTGAGGAAGG + Intronic
1075011522 10:118874433-118874455 CACAGTTTCCTCTTTCAGGTTGG + Intergenic
1075112839 10:119601861-119601883 TATAATTTAGACCTTGAGGTAGG - Intergenic
1075441651 10:122484658-122484680 CATAGAAAACACATTGAGGTAGG + Intronic
1078304021 11:10164540-10164562 CATAAGTTACACTTTGGAGTGGG + Intronic
1078383692 11:10868253-10868275 CATTGTTGAAACTTTGGGGTGGG - Intergenic
1083257698 11:61506725-61506747 CATAGTTGCCTCTGTGAGGTGGG + Intergenic
1083279577 11:61618534-61618556 CAGACTGTGCACTTTGAGGTGGG + Intergenic
1091030525 11:132183366-132183388 CATCGTTTCCACTTTGTGCTTGG + Intronic
1091153106 11:133347570-133347592 CAGAGTTTACAGATTTAGGTTGG + Intronic
1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG + Intergenic
1092968020 12:13663965-13663987 AAAACTTTACAGTTTGAGGTAGG + Intronic
1093101257 12:15032289-15032311 CATAATTTACAATTTGATTTTGG + Intergenic
1093442464 12:19214783-19214805 CATGGTTTTCACTTTCAGATGGG - Intronic
1093562308 12:20555429-20555451 CATAGTTTTAACTTTGTGTTTGG + Intronic
1093644776 12:21572383-21572405 CATAGTTTAATCTTTGATGCAGG - Intronic
1097513675 12:60575782-60575804 CATCGTCTTCACTTTTAGGTAGG + Intergenic
1098670898 12:73229998-73230020 CATATTTTACCTTTTTAGGTGGG - Intergenic
1104952129 12:132445879-132445901 CTTAGTTTACAGTTTAAGTTGGG + Intergenic
1107399875 13:40059183-40059205 CATAGATTACAGTTTCATGTAGG - Intergenic
1107615299 13:42160822-42160844 CATATTTTAAAATTTGAGGCTGG - Intronic
1108235662 13:48402223-48402245 AATAGTGTACACTTTTAGATTGG + Intronic
1108702153 13:52952966-52952988 CATAGTTTGCTCTTTGACTTGGG + Intergenic
1111872384 13:93849060-93849082 ACTAGTTTACAATTTCAGGTTGG - Intronic
1115887898 14:37994172-37994194 CATAGTTTGAACTTTGACTTGGG - Intronic
1117817836 14:59616013-59616035 CATAATTTATAATTTGATGTTGG - Intronic
1120167089 14:81212423-81212445 CACAGTTTACACATTAAAGTAGG + Intronic
1120217185 14:81692813-81692835 CATAATTTATCCTCTGAGGTTGG - Intergenic
1121962249 14:98272162-98272184 AATAGTTTACACTTTGATTTGGG + Intergenic
1124924457 15:34057583-34057605 CAGATTTTAAACTTTGAGGTGGG - Intronic
1126218816 15:46188113-46188135 CATAGTTCGCAGTTTGAGATAGG - Intergenic
1126230150 15:46314510-46314532 TATGGTTTAAACTTTGTGGTAGG - Intergenic
1129854794 15:78815558-78815580 CAAAATGTACACTTTGGGGTAGG - Intronic
1131940559 15:97560209-97560231 CATGGTCGACACTTTGAAGTTGG - Intergenic
1145859307 17:28194203-28194225 TTTACTTTACACTTTGAAGTAGG + Intronic
1156865179 18:41880904-41880926 CACAATTTATAGTTTGAGGTGGG + Intergenic
1157805331 18:50653722-50653744 CATTAGTTACACTGTGAGGTAGG - Intronic
1158217134 18:55111875-55111897 CATAGTTTTCTCTTAGATGTAGG - Intergenic
1158395350 18:57075211-57075233 CATTGTTGACATTTTGAGCTGGG + Intergenic
1158443167 18:57495342-57495364 GTTAGTTGACACTTTCAGGTGGG - Intergenic
1159191718 18:65053980-65054002 AAAAGTTTACAGTTTGAAGTGGG - Intergenic
1164266950 19:23628208-23628230 CATAGTTGACATTATGATGTTGG + Intronic
1164428420 19:28165868-28165890 CATAGTTTAAACTTTTTTGTTGG + Intergenic
1167140411 19:47646703-47646725 CATATTTTACACTTTTCTGTAGG - Intronic
927046869 2:19287818-19287840 CATATTTTACACGTTGACTTCGG - Intergenic
930705668 2:54502515-54502537 CAGAGAATACACTTTGAAGTGGG + Intronic
933444847 2:82366964-82366986 CATAATTTACAATTTGATTTTGG + Intergenic
933733253 2:85474213-85474235 CATGGTTTACACATTGTGCTTGG - Intergenic
935975334 2:108572748-108572770 CAACGATTACACTTTGAAGTCGG + Intronic
936799197 2:116245665-116245687 CAAAGTATACATTTTGAAGTAGG - Intergenic
938660880 2:133485946-133485968 CATAGTTTATCCTTTCAGATGGG - Intronic
939577308 2:143911984-143912006 CAGTGTTTACACTTTGGGTTAGG - Intergenic
940764759 2:157778300-157778322 CAGAATTTCCACTTGGAGGTTGG - Exonic
941486859 2:166092924-166092946 CATAGTTTATACTTTCAGTATGG - Intronic
943709527 2:191075467-191075489 ACTGGTTTACACTGTGAGGTAGG + Intronic
947540826 2:230976610-230976632 AAAAGTTTACACTTTGAGTGAGG + Intergenic
1171845904 20:30274537-30274559 CATTGTTTACACTTTGCAGGAGG + Intergenic
1175649956 20:60711932-60711954 CTTATTTTACAATTTCAGGTAGG + Intergenic
1177997863 21:28124292-28124314 CATAGTTTAAACTATTATGTTGG + Intergenic
950160591 3:10757872-10757894 CATATTTGACACATTGAGGTAGG + Intergenic
951131252 3:19047972-19047994 CTTAGTTTACAATTTGATTTTGG + Intergenic
951629948 3:24708835-24708857 AATAGTTTATAGTTTGAGGGAGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955941774 3:64152748-64152770 CATAGTCCCCACTTGGAGGTGGG + Intronic
962427097 3:135280543-135280565 CATAGCTTCCACTTTTTGGTAGG + Intergenic
963723221 3:148888169-148888191 CAAAGTTTATACTTTCAGCTTGG - Intronic
965985621 3:174749656-174749678 AATATTTTGCATTTTGAGGTGGG + Intronic
968015016 3:195321988-195322010 CTTAGTCTACAGTTTGAAGTGGG + Intronic
968043392 3:195608262-195608284 CATAGTTTATAATTTGACTTTGG - Intergenic
968248842 3:197185814-197185836 TACTGTTTACAGTTTGAGGTAGG - Intronic
970047380 4:11870516-11870538 TGTAGTTTACACTTTGTGCTGGG - Intergenic
970848716 4:20575555-20575577 CAAAGCATGCACTTTGAGGTGGG + Intronic
972695504 4:41441554-41441576 CATATTTTAGACGTTGAGGGTGG - Intronic
975579180 4:75891582-75891604 CATAGATTACACGGTGAGGTGGG - Intronic
977050526 4:92123567-92123589 CATAGTTTAAAAGTAGAGGTGGG - Intergenic
977241277 4:94573016-94573038 TATACTTTACCCTTTTAGGTGGG + Intronic
978975849 4:114870834-114870856 CAGAGTTTGCAATTTCAGGTTGG + Exonic
980494160 4:133570086-133570108 CTTTGTTTAAACTGTGAGGTGGG + Intergenic
980576645 4:134691033-134691055 AAGAGTGTACACTTTGATGTAGG + Intergenic
981739573 4:147988043-147988065 CATAGTTTACTCAGTGAGTTTGG + Intronic
984155114 4:176186985-176187007 CATATTTTAGGCTTTGTGGTAGG + Intronic
984681404 4:182614110-182614132 CATAGTTTACATTGTAATGTTGG + Intronic
985767697 5:1788529-1788551 CAGAGATTACATTTTGTGGTGGG + Intergenic
987494219 5:18622304-18622326 CATATTTTACACATTGAATTTGG + Intergenic
989724136 5:44567606-44567628 TATAGTTTACTATTTCAGGTGGG + Intergenic
992447576 5:76847877-76847899 CTTAGTTTTCACTTTCAGGTGGG + Intergenic
994985300 5:106925732-106925754 CATAGATTACAGCTTGAAGTTGG - Intergenic
995102205 5:108326020-108326042 CTGAGTTTACACTTTAAGGGTGG + Intronic
996987631 5:129585748-129585770 CATAGTATAGAATTAGAGGTTGG + Intronic
998784219 5:145691245-145691267 CATAGTTTCCACTTTCTAGTTGG - Intronic
1000820705 5:165979666-165979688 CATAGTATACACATTGCTGTAGG + Intergenic
1004362858 6:14986510-14986532 CATGGTTTACCCTTTGACTTGGG + Intergenic
1004898729 6:20174084-20174106 TATTGTTTACACTGTGTGGTCGG - Intronic
1007883041 6:45188380-45188402 CATAACTTGCAGTTTGAGGTGGG - Intronic
1007997681 6:46325916-46325938 CAGAGTTTCTTCTTTGAGGTGGG + Intronic
1010404356 6:75486146-75486168 CAAAGTTTACAATATAAGGTGGG + Intronic
1012238872 6:96849924-96849946 CATTGTTTTCACTTTTAAGTGGG + Intergenic
1014302613 6:119701312-119701334 CAGAACTTACACTTGGAGGTAGG + Intergenic
1014609965 6:123530648-123530670 AATAATTTAAACTTTGTGGTAGG - Intronic
1017908691 6:158774189-158774211 CAAAGTTTACAGACTGAGGTGGG + Intronic
1018266624 6:162031061-162031083 CATAAGTAACACTTTGATGTTGG + Intronic
1020580730 7:9996843-9996865 CATATTTTTCATTTTAAGGTAGG - Intergenic
1021321209 7:19214491-19214513 CAAGTTTTACACATTGAGGTAGG + Intergenic
1021714382 7:23448147-23448169 GACAGTTTACATTTTGAGGCTGG - Intronic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1024342334 7:48280031-48280053 CTTTGTTTACACTCTGAAGTTGG + Intronic
1026683730 7:72490503-72490525 CATATCAAACACTTTGAGGTAGG - Intergenic
1026685588 7:72506808-72506830 CATAGTTTTCATTTTGTGCTGGG - Intergenic
1027521776 7:79217765-79217787 CCTAGTGTACCCTCTGAGGTGGG - Intronic
1028171985 7:87609176-87609198 CAAAGTTTACAATTTTAAGTAGG + Intronic
1028233595 7:88333531-88333553 CATACTTTACACTCTGATTTAGG - Intergenic
1030752268 7:113242374-113242396 CATAGATGACACTTTGGGCTTGG + Intergenic
1034074693 7:148220400-148220422 CATAGTTAACATTATGATGTTGG - Intronic
1034525280 7:151655877-151655899 CATAGCCTACACTTTGAGTCAGG + Intronic
1041256779 8:55985715-55985737 CAGAGTTTACTCTTTGATGGGGG - Intronic
1041533523 8:58898913-58898935 TGTAGTTTACTCTCTGAGGTAGG + Intronic
1043406024 8:79933812-79933834 CACAGTTTATATTTTGGGGTGGG - Intronic
1046396560 8:113648222-113648244 ATTAGTATACACTTTGGGGTGGG - Intergenic
1050769882 9:9184677-9184699 CATAGTTTACAATCTAATGTGGG - Intronic
1051432430 9:16993730-16993752 CATAGTTTACCTTTTCAGGTAGG + Intergenic
1052754930 9:32531318-32531340 CATTGTTTACACACTGTGGTAGG + Intergenic
1053075621 9:35131623-35131645 CATAATTTACAATTTGATTTTGG - Intergenic
1054162173 9:61681305-61681327 CATTGTTTACACTTTGCAGGAGG - Intergenic
1054862172 9:69965264-69965286 CATTGTTCACATTTTGGGGTGGG + Intergenic
1054948213 9:70819720-70819742 CATAGATTTCACTTTCAAGTAGG + Intronic
1055684253 9:78753605-78753627 CATTGTTTAGACTCTCAGGTTGG + Intergenic
1056069091 9:82967453-82967475 CCTAGTGGACACTTGGAGGTGGG - Intergenic
1056740221 9:89248072-89248094 AATAGTTTAGCCTGTGAGGTTGG + Intergenic
1059939798 9:119347575-119347597 AATTGTTTACATTTAGAGGTGGG - Intronic
1060436608 9:123598391-123598413 CCTGATTTACACTTTGAGGTTGG + Intronic
1060501766 9:124162901-124162923 CATAGTTTACACATAGAATTTGG + Intergenic
1062058693 9:134482959-134482981 CAAAGGTTACACTTGGTGGTGGG + Intergenic
1185873499 X:3683534-3683556 CCTAGTTTACAATTTGAACTTGG - Intronic
1187139673 X:16581170-16581192 CATAATTTACAATTTGATTTTGG - Intergenic
1188178603 X:27025044-27025066 CATAATTCACAGTTTAAGGTAGG - Intergenic
1189053759 X:37676113-37676135 CATAGTCTACACTTGCAGTTTGG - Exonic
1189100802 X:38187531-38187553 CATAGTTTACACTTTGAGGTAGG + Intronic
1191053068 X:56214847-56214869 AATAGTTTAGACTTTGGAGTTGG - Intergenic
1194258117 X:91659316-91659338 TATAGTTTCCACATTGTGGTAGG - Intergenic
1196929435 X:120666531-120666553 CATGGATCCCACTTTGAGGTAGG + Intergenic
1197568326 X:128116639-128116661 CATAATTTACAATTTGATTTTGG + Intergenic
1198340734 X:135711253-135711275 CATTGTTTTCACTTCGATGTAGG - Intergenic
1198347227 X:135770473-135770495 CATTGTTTTCACTTTGATGTAGG + Intergenic
1198349133 X:135787735-135787757 CATTGTTTTCACTTTGATGTAGG + Intergenic
1198351039 X:135805007-135805029 CATTGTTTTCACTTTGATGTAGG + Intergenic
1198352945 X:135822272-135822294 CATTGTTTTCACTTTGATGTAGG + Intergenic
1198354854 X:135839528-135839550 CATTGTTTTCACTTTGATGTAGG + Intergenic
1198356765 X:135856810-135856832 CATTGTTTTCACTTTGATGTAGG + Intergenic
1198358678 X:135874090-135874112 CATTGTTTTCACTTTGATGTAGG + Intergenic
1200576880 Y:4898819-4898841 TATAGTTTCCACATTGTGGTAGG - Intergenic
1200790805 Y:7297571-7297593 CCTAGTTTACAATTTGAACTTGG + Intergenic