ID: 1189105536

View in Genome Browser
Species Human (GRCh38)
Location X:38231423-38231445
Sequence GCTTCCTATCCCTATGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189105535_1189105536 -7 Left 1189105535 X:38231407-38231429 CCATTAACAAAATGTTGCTTCCT 0: 1
1: 0
2: 1
3: 46
4: 334
Right 1189105536 X:38231423-38231445 GCTTCCTATCCCTATGTTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 94
1189105534_1189105536 4 Left 1189105534 X:38231396-38231418 CCTCTACTAATCCATTAACAAAA 0: 1
1: 0
2: 1
3: 46
4: 470
Right 1189105536 X:38231423-38231445 GCTTCCTATCCCTATGTTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189105536 Original CRISPR GCTTCCTATCCCTATGTTGT AGG Intronic
901661077 1:10798195-10798217 GCTTCCTCTCCCAAATTTGTTGG - Intergenic
904690671 1:32291594-32291616 GCTTTCTTTCCCTTTCTTGTCGG + Intergenic
911547793 1:99241086-99241108 GGTACCTCTCCTTATGTTGTAGG - Intergenic
918112727 1:181471420-181471442 GCTAACCATACCTATGTTGTAGG + Intronic
918230788 1:182529215-182529237 GCTGCCTATCCCTATATTACAGG - Intronic
918272954 1:182920917-182920939 GCTTTCTCTCCCTCTGTTTTAGG - Intronic
919110552 1:193214099-193214121 GTGTCCTTTCCCTATGTAGTTGG + Intronic
923596191 1:235362229-235362251 GCTTTCTCTCCCTATGGCGTGGG - Intergenic
1066476442 10:35751613-35751635 GCTTCCTATTGCTATTTTCTGGG + Intergenic
1072319986 10:94239728-94239750 TTTTCCTATCCCTATGGGGTTGG - Intronic
1075888864 10:125928019-125928041 GTTTCCCATCCTTCTGTTGTAGG + Intronic
1085839648 11:79996737-79996759 ACTTCATCTCCCTATGTTTTTGG - Intergenic
1088792008 11:113234482-113234504 GCTTTCTGTCTCTATGTAGTTGG + Intronic
1090781998 11:130015494-130015516 GCTTGCTATCCCAATTTTGGAGG + Intergenic
1091119713 11:133046713-133046735 CTTTCCTCTGCCTATGTTGTGGG + Intronic
1103877154 12:124137045-124137067 GCTTCCTTTCTCTGTGTTATTGG + Intronic
1108609955 13:52075374-52075396 GTTTTCTATCCCTATGTAATTGG - Intronic
1109830555 13:67781448-67781470 GTATCCAATCCCTATGTCGTGGG - Intergenic
1109868940 13:68305319-68305341 ACTTCCTTTCCCTATTTTGGGGG - Intergenic
1114384289 14:22239927-22239949 TCTTCCTTTCCCTGTGTTATAGG - Intergenic
1115814178 14:37145117-37145139 GCATCCTATCTCTATTTTATGGG + Intronic
1118727985 14:68643977-68643999 CCTGCCTTTCCCTTTGTTGTTGG + Intronic
1119666435 14:76488457-76488479 GCTGCCTTTGCCTATCTTGTAGG - Intronic
1131917570 15:97286838-97286860 TCTTCCTATCCCTTAATTGTGGG + Intergenic
1132609553 16:808450-808472 ACTGCCTCTCCCTGTGTTGTTGG - Intronic
1134014990 16:10881864-10881886 ACTTCCTGTCTCTATGTTTTGGG + Intronic
1137550890 16:49436865-49436887 GCTTCCTCTCCCTTTGTGCTAGG + Intergenic
1140080292 16:71740214-71740236 GCTTCCTAATTCTTTGTTGTAGG + Intronic
1143481505 17:7229940-7229962 GCTTCCTGTCCATATGTAGCTGG - Exonic
1144483693 17:15647691-15647713 GCTTCCTATCGCTAAGTGCTGGG - Intronic
1144914994 17:18717333-18717355 GCTTCCTATCGCTAAGTGCTGGG + Intronic
1156379034 18:36540784-36540806 GCTTCCAGGGCCTATGTTGTGGG + Intronic
1159787677 18:72733667-72733689 GCTTCCTATTCCTATCATGGTGG - Intergenic
1161482888 19:4519552-4519574 GGTTCCTAGCCCTGTGTTATTGG + Intergenic
1168408331 19:56121935-56121957 AGGTCCTATCCCTATGTTGCAGG + Intergenic
927531532 2:23808912-23808934 TCCTCCTATTCCTATGCTGTTGG + Intronic
928358431 2:30642565-30642587 GCTTTCTACCCCAAAGTTGTTGG + Exonic
928476425 2:31631960-31631982 TCTTCCTTTCCCTATGTTATAGG - Intergenic
929066590 2:37982116-37982138 ATTTCCCATCCCTATGATGTAGG + Intronic
929798903 2:45082765-45082787 GCTTCCCTTCCCAATCTTGTGGG - Intergenic
933083889 2:78030071-78030093 TTTTCTTATCCTTATGTTGTGGG + Intergenic
933400028 2:81784123-81784145 GCTTCATATCCTTAGGTTTTAGG - Intergenic
934911243 2:98256407-98256429 GCTTCCTGTCTCTATGATTTTGG + Intronic
941514312 2:166453735-166453757 GCTTCATATCCTCATGTTATAGG - Intronic
941777701 2:169410667-169410689 CCTTCCTATCCCTATTTGTTTGG - Intergenic
948249214 2:236512090-236512112 GCTTCCAATCCCTCTTTTATGGG + Intergenic
1169538130 20:6568660-6568682 GCTTTCTACCCAGATGTTGTGGG + Intergenic
1174194211 20:48761538-48761560 ACTTCCTCTCCCGATGTGGTGGG - Intronic
1174410258 20:50330593-50330615 GCTTCCCATCCCTGTGCTGTGGG + Intergenic
1179041957 21:37811187-37811209 GGTTCCTATCCCCATGGAGTTGG - Intronic
1179228541 21:39478872-39478894 GCTTCCTATTCTTATTATGTAGG + Intronic
1180068416 21:45424248-45424270 GCTTCCTGTGCCTCTGTGGTGGG + Intronic
1183191344 22:36323754-36323776 GCTTCCTAGCCCTGGGTTGGGGG - Intronic
1185120806 22:48968809-48968831 CCATCCTATCCGTATGGTGTTGG + Intergenic
955746629 3:62147123-62147145 GCTTCATAACCCTATGAAGTAGG - Intronic
960322767 3:116256993-116257015 GCTTCCAAACCCTATGCTGGAGG + Intronic
960439641 3:117671085-117671107 GCTTCCCATGGCTATTTTGTCGG + Intergenic
960471072 3:118065763-118065785 GCTATCTATCCCTGTGTTTTTGG - Intergenic
963035813 3:141027793-141027815 GCTTTCTTTACCTTTGTTGTAGG - Intergenic
967652029 3:191997578-191997600 GCTGTCTTTCCCTGTGTTGTTGG - Intergenic
968311754 3:197689408-197689430 GCTTCCTTTCCCCATTTTGGGGG - Intronic
971641509 4:29138988-29139010 ACTTCTTATCTCTATGTTATGGG + Intergenic
972968827 4:44547449-44547471 GAATCCTAACCCTATGCTGTAGG + Intergenic
974134513 4:57798347-57798369 GCTTCTTATCACTAAATTGTAGG + Intergenic
975317704 4:72973905-72973927 GCTTCCAATCCCTCTATTGCAGG + Intergenic
975427248 4:74244856-74244878 GCTTCATATGCATATGTAGTTGG - Intronic
976658322 4:87512388-87512410 GCTTCATTTCCCTATGATGTGGG + Intronic
979494911 4:121372161-121372183 GTTTCTTATCCCTGTCTTGTGGG - Intronic
980637881 4:135533182-135533204 GCTTCCTTTCTATATGTTCTGGG - Intergenic
985220992 4:187705353-187705375 GCTTCCTTTCCTTCTGGTGTGGG + Intergenic
986079406 5:4374622-4374644 GCTTCCTCTCCCTAGGCTGTTGG + Intergenic
990441494 5:55850493-55850515 GCATCCTATTCATATTTTGTGGG + Intergenic
991319425 5:65353348-65353370 ACTTCCCAGCCCTATGCTGTTGG - Intronic
993102249 5:83554940-83554962 GTTTCCTATCCCTTAGGTGTGGG + Exonic
993143660 5:84066853-84066875 GCTTTCTATACTTATGTTTTTGG - Intronic
995132192 5:108642408-108642430 GCTGCCTATTTCTTTGTTGTAGG + Intergenic
995565218 5:113427043-113427065 TTTTTCTATCCCTATGTTGCAGG + Intronic
997591247 5:135073925-135073947 GCTTCCTGTCCCTGGGTTTTTGG + Intronic
1003228104 6:4224569-4224591 TTTTCCTCTCCCTATGTTGAGGG - Intergenic
1004598272 6:17122443-17122465 GTTGTCTATCCCTGTGTTGTAGG + Intronic
1009574952 6:65441687-65441709 GCTTACTTTACCTATTTTGTAGG - Intronic
1025957287 7:66192757-66192779 GCTTCCTATCTATCTGATGTAGG + Intergenic
1026096374 7:67349646-67349668 GCTTCTAATCCCAATGTTTTGGG - Intergenic
1028829286 7:95309614-95309636 GCTTGCTATCCTTATAATGTGGG + Intronic
1032017927 7:128391727-128391749 CCTTCCTGTGCCTCTGTTGTTGG - Intergenic
1034558607 7:151865417-151865439 GCTTTCAGTCCCTATGTTTTTGG + Intronic
1042929973 8:74003668-74003690 TTTTCCTCTCCCTATGTTGAGGG + Intronic
1045665480 8:104479926-104479948 GCTTCCAATCCCAATGATGGAGG + Intergenic
1047144472 8:122181974-122181996 GCTTTCTATACATATGTTTTGGG + Intergenic
1058582135 9:106469828-106469850 GCATCTTTTCCATATGTTGTTGG + Intergenic
1058632039 9:106999152-106999174 GCTCCTTCTCCCTTTGTTGTGGG + Intronic
1059770398 9:117418402-117418424 GCTTTTTATCCCTATTTTATAGG + Intergenic
1062182617 9:135198718-135198740 GCTTGCTCTCCCTTTGGTGTCGG - Intergenic
1189105536 X:38231423-38231445 GCTTCCTATCCCTATGTTGTAGG + Intronic
1189552692 X:42110117-42110139 GCTTGCTATCTATATATTGTGGG + Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1192242935 X:69349153-69349175 GCTTCCTGTCCCTATACTATCGG + Intergenic
1193460118 X:81780895-81780917 TCTTCCTATGTCTATGTAGTGGG + Intergenic
1196586951 X:117440935-117440957 GCTTTCTCTCCCTCTGTTTTAGG - Intergenic