ID: 1189106700

View in Genome Browser
Species Human (GRCh38)
Location X:38244203-38244225
Sequence GTTTTTAAGAGTCTTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189106697_1189106700 -3 Left 1189106697 X:38244183-38244205 CCCATTGTTCAGTCTAACAAGTT 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1189106700 X:38244203-38244225 GTTTTTAAGAGTCTTGTGGCTGG 0: 1
1: 0
2: 2
3: 33
4: 260
1189106698_1189106700 -4 Left 1189106698 X:38244184-38244206 CCATTGTTCAGTCTAACAAGTTT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 1189106700 X:38244203-38244225 GTTTTTAAGAGTCTTGTGGCTGG 0: 1
1: 0
2: 2
3: 33
4: 260
1189106696_1189106700 18 Left 1189106696 X:38244162-38244184 CCATTTTTATTAATCAGTTTACC 0: 1
1: 0
2: 2
3: 38
4: 458
Right 1189106700 X:38244203-38244225 GTTTTTAAGAGTCTTGTGGCTGG 0: 1
1: 0
2: 2
3: 33
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189106700 Original CRISPR GTTTTTAAGAGTCTTGTGGC TGG Intronic
900133415 1:1101773-1101795 GTTTTTAATAGTTTTAGGGCTGG + Intronic
901067900 1:6503114-6503136 GTTTTAAAGAGCTTTGAGGCTGG + Intronic
901519513 1:9772276-9772298 GTATTAAAGAGTGTTCTGGCCGG - Intronic
904648405 1:31986076-31986098 GTTTTTAAGAGTCTCGGGCTGGG - Intergenic
904906419 1:33900478-33900500 TTTTACAAGAGTTTTGTGGCTGG + Intronic
906485054 1:46228240-46228262 ATTTTTAAAAGTTTTGGGGCCGG + Intergenic
907143032 1:52206051-52206073 TTTGTTAAGATTCTTGTTGCAGG + Intronic
908056936 1:60297918-60297940 GTTTTTAAGAGTACTGTGGTCGG - Intergenic
908819493 1:68069238-68069260 GATTTTAAAAGTCATGTGGAAGG - Intergenic
909297719 1:73971693-73971715 GTTTTAAAGAGTTTTGTGCCAGG + Intergenic
910164406 1:84309286-84309308 GTTTTAAGGAGTCTTGAGGCAGG + Intronic
913265100 1:117035845-117035867 CTTTCTAAGAGTCTTCTGCCGGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
913975942 1:143455497-143455519 GTTATCAAGAGTCTGGAGGCAGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915160243 1:153914211-153914233 TTTTTTGAGAGTCTGGGGGCTGG - Intronic
916078469 1:161217411-161217433 ATATTTAAGTGTCTTGTGGTGGG + Intronic
916081871 1:161238577-161238599 GTTTTTAAGAGACTAGGGGCTGG + Intergenic
916139264 1:161679815-161679837 ATTTTTAAGAATTTTTTGGCCGG + Intergenic
917835914 1:178941561-178941583 GTTTTTAACAGGCCCGTGGCAGG - Intergenic
919165194 1:193883877-193883899 GTTTTTAAGTTTCTCGTGGAAGG + Intergenic
921421699 1:214956238-214956260 CTTCTTAAGAATCTTGAGGCTGG - Intergenic
921473794 1:215580963-215580985 TGTTTTAAGAGTGTTTTGGCTGG + Intronic
921522149 1:216168924-216168946 GTTTTTAAGAGTAATTTGGCTGG - Intronic
922659991 1:227421410-227421432 AGTTTTAAGAGCCTTGAGGCCGG - Intergenic
923911962 1:238458735-238458757 ATTTTTAATAGTCTTGTTGGGGG - Intergenic
1062948413 10:1477822-1477844 GTCTTTAACAATCCTGTGGCGGG + Intronic
1065941532 10:30568778-30568800 GTATTTAAGAATATTTTGGCTGG + Intergenic
1065961784 10:30739687-30739709 GCTTTTAAGAGTTCTGTGTCAGG - Intergenic
1066063851 10:31748305-31748327 GTTTTTAAGAACGATGTGGCTGG - Intergenic
1066375147 10:34851323-34851345 TTTTTTAAAAGACTTGTGGCGGG - Intergenic
1066404380 10:35105023-35105045 ATCTTTAAGAGTCTTTGGGCTGG - Intergenic
1067569536 10:47361290-47361312 GTTTTTAGAAGTCATGTGGTAGG - Intergenic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068736254 10:60416318-60416340 GTTTTTAAGAGTCATCTGTGTGG - Intronic
1072132876 10:92513502-92513524 GTTTTTAAAAATTTTGTGGGGGG + Intronic
1074119021 10:110479531-110479553 GTTTTTGAGATTCTAGGGGCTGG + Intergenic
1075162259 10:120034611-120034633 GTTTTTGAGATTCTTGGGGAGGG + Intergenic
1078643499 11:13117224-13117246 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
1078924811 11:15865041-15865063 GTTTTCAAAAATCTTGTAGCTGG + Intergenic
1079017946 11:16885622-16885644 TTTTTTAAGATTTTTGTGACAGG - Intronic
1079674915 11:23214947-23214969 CTCTTTAAGATTCTTTTGGCTGG - Intergenic
1080739711 11:35052406-35052428 GTTTTTAAGAGTTTTCCAGCTGG - Intergenic
1082105764 11:48219694-48219716 GTTTATAAGATTATTCTGGCTGG + Intergenic
1083822069 11:65178201-65178223 AATTTTAAGAGTCTTCTGGTGGG - Intronic
1084622181 11:70280270-70280292 ATTTTTAAGAGACAGGTGGCTGG + Intronic
1084661018 11:70546453-70546475 GGTTTTAAGAGTTCTGTGCCAGG + Intronic
1085992754 11:81870122-81870144 GTTGTTAAGCGTATTGTGGGTGG - Intergenic
1086082087 11:82914229-82914251 ATTATTAAAAGTATTGTGGCCGG - Intronic
1086157532 11:83684056-83684078 GTTTTTATGGGTTTTGTGGTAGG - Intronic
1086188217 11:84045533-84045555 GTTTTTAAGAATCTTTTTGTTGG - Intronic
1086694576 11:89828260-89828282 GTTGTTAAGAGTCTGCAGGCAGG + Intergenic
1086711570 11:90016239-90016261 GTTGTTAAGAGTCTGCAGGCAGG - Intergenic
1088516368 11:110639243-110639265 TTTTTTAAAACTCTTGTGGGGGG - Intronic
1089593819 11:119561942-119561964 TTTTTTAAGAATGTTGAGGCTGG - Intergenic
1091188460 11:133668733-133668755 GATTCTAAAAGTCTTCTGGCTGG + Intergenic
1092773914 12:11924861-11924883 GTTTTTATGAATCTTGTAGTGGG + Intergenic
1092819670 12:12341589-12341611 GTTTTTAGGAGTTCTGTGCCAGG + Intronic
1099375892 12:81896110-81896132 GTTTTTGAGAGTCTGGGGGATGG - Intergenic
1099446689 12:82761334-82761356 GTTCTTAAGAGACTTGTGGCTGG + Intronic
1100865748 12:98854861-98854883 GTTTTTAAAAATCTCTTGGCCGG + Intronic
1100969552 12:100053102-100053124 TTTTTTAAGAGTATTTTGCCTGG + Intronic
1103746565 12:123128837-123128859 GTTTTTAAGATTAATGAGGCTGG + Intronic
1103747288 12:123133981-123134003 GTTTTTCAGAGTAATGAGGCTGG - Intronic
1103825908 12:123738106-123738128 TTGTTTAAGAGCCTTTTGGCTGG + Intronic
1104065931 12:125306013-125306035 ATTTCTTAGAGTCTTGTGCCAGG + Intronic
1104244274 12:127022525-127022547 GTTTATTAGTTTCTTGTGGCTGG - Intergenic
1105829532 13:24151617-24151639 TTTTTTAAGAGTGTTGGGTCTGG + Intronic
1106289629 13:28348611-28348633 GTTTTAAAGAGTTTAGGGGCCGG + Intronic
1106449567 13:29867919-29867941 GTTTTTAAGAGTTTAGGGCCAGG + Intergenic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1106739357 13:32622990-32623012 GTTTTTAAGGGTGGTTTGGCAGG + Intronic
1108618437 13:52158704-52158726 GTTTTTAAAAGTATTGTTGCAGG - Intronic
1110754482 13:79155871-79155893 CTTTTTAAGAGTCTTGTATCTGG - Intergenic
1111639932 13:90955222-90955244 GTAATTTAGTGTCTTGTGGCAGG - Intergenic
1111989995 13:95106958-95106980 GTTTTTAAGAGTATTCAGGCTGG + Intronic
1112330028 13:98470160-98470182 GTTTTTTTGTGTCTTTTGGCAGG + Intronic
1114041105 14:18679215-18679237 ATATTTAAGAGTTTTATGGCTGG + Intergenic
1114046132 14:18877673-18877695 ATATTTAAGAGTTTTATGGCTGG + Intergenic
1114057530 14:18985608-18985630 TTTTTTAAGAATCTTTTGGCTGG + Intronic
1114105014 14:19416137-19416159 TTTTTTAAGAATCTTTTGGCTGG - Intronic
1114118078 14:19641777-19641799 ATATTTAAGAGTTTTATGGCTGG - Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1118286093 14:64475141-64475163 ATTTTTAAAAGTTTTATGGCCGG + Intronic
1119416375 14:74472794-74472816 ATGTGTAAGAGTCCTGTGGCTGG + Intergenic
1121422174 14:93823872-93823894 GTTTTTAAGAGCCTGGGGCCTGG + Intergenic
1121445206 14:93974304-93974326 GTTATTAAGAGCTTTGTGGTTGG - Intronic
1121488437 14:94339966-94339988 GTTTGTAAGAAACTTGTGGCTGG + Intergenic
1122119492 14:99544449-99544471 GTTTTTATGAGTTCTGTGACTGG - Intronic
1124434430 15:29635353-29635375 GATTTCAAGAGTCATGTGCCAGG + Intergenic
1125015476 15:34929704-34929726 GTTTTAAAGAGTCTTTTGTTGGG - Intronic
1126202863 15:46007234-46007256 ATTTTTAAGAGTTCTGTGCCAGG + Intergenic
1128804126 15:70518015-70518037 GTTGTTAAGATGCTTGTGGCTGG - Intergenic
1130415652 15:83692387-83692409 TTGTTTAAGAGTTTTGAGGCTGG + Intronic
1130938060 15:88486809-88486831 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
1131881307 15:96865466-96865488 GTCTTTAGGACTCTTGTGGAAGG + Intergenic
1133713446 16:8424583-8424605 GTTTTTAAAATTTTTTTGGCTGG - Intergenic
1135000945 16:18776166-18776188 GTATTTAAGAACCATGTGGCTGG + Intergenic
1135916188 16:26607633-26607655 GGTTTTAAGAGTTTTGTGCCAGG - Intergenic
1137797165 16:51231445-51231467 TTTTTTAAGTGCCTGGTGGCAGG + Intergenic
1138307936 16:55995265-55995287 GGTTTTAAGAGCCTTGTACCAGG + Intergenic
1138760226 16:59534525-59534547 GTTTTTAAAAATAATGTGGCAGG - Intergenic
1140021625 16:71244504-71244526 TTTATTAAGGGTTTTGTGGCAGG - Intergenic
1140590838 16:76350773-76350795 GCATTTAAGAGTCTTGTGAATGG + Intronic
1142704642 17:1687019-1687041 TTCATTAAGAGTATTGTGGCCGG + Intergenic
1143542180 17:7575698-7575720 GTTTTTAAATGTTCTGTGGCAGG + Intronic
1144256761 17:13476028-13476050 CTTCTCAAGAGTCATGTGGCTGG + Intergenic
1144510804 17:15874389-15874411 TTTTTTAAAAGTGTCGTGGCTGG + Intergenic
1144688884 17:17246067-17246089 GTTTTTAAGAGACAAATGGCAGG - Intergenic
1145174968 17:20692077-20692099 TTTTTTAAAAGTGTCGTGGCTGG + Intergenic
1146232755 17:31128624-31128646 ATCTTTAAGAATGTTGTGGCTGG + Intronic
1146310199 17:31762754-31762776 GTTTTTAAAAGTGGTGTGTCCGG - Intergenic
1147268369 17:39248644-39248666 GGTTTTAAGACACGTGTGGCCGG + Intergenic
1147367271 17:39967257-39967279 GTTTGACTGAGTCTTGTGGCAGG + Intronic
1148571460 17:48672934-48672956 TTTTTCAAGATTGTTGTGGCTGG - Intergenic
1151104502 17:71596817-71596839 GTTGTTAAGAGAATTGTGTCTGG + Intergenic
1153015454 18:578883-578905 GTGTTAAAGAGTTTTATGGCTGG - Intergenic
1153891675 18:9522313-9522335 GATTTGAAGAGGCTTGTGGGAGG + Exonic
1155788589 18:29933867-29933889 GGCTTTAAGAGTCTTCTGCCAGG + Intergenic
1155999566 18:32370004-32370026 CTGTTTAAGAGTCTTGTCTCAGG - Intronic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1158851341 18:61498101-61498123 GTTATTAAAAGTATTCTGGCTGG + Intronic
1162265503 19:9570443-9570465 GTTATTAAGAGAGTAGTGGCGGG + Intronic
1162861462 19:13508418-13508440 GTCTTTAAGATTCATCTGGCAGG + Intronic
1165985862 19:39768339-39768361 GTTTTTAAGCATGTTGTGGGTGG - Intergenic
1166264480 19:41670252-41670274 CTTTTAAAAAGTCTTGTGCCTGG + Intronic
1166812249 19:45521590-45521612 GGTTGAAAGAATCTTGTGGCTGG + Intronic
1167519712 19:49946794-49946816 GTTTCCATGAGTTTTGTGGCAGG - Intronic
1167872505 19:52383876-52383898 ATTTTTAAGAGACTTGTTTCCGG - Exonic
1168050441 19:53825746-53825768 CTTATAAAGACTCTTGTGGCTGG - Intergenic
925908349 2:8553382-8553404 GTTTTGAAAAGTATAGTGGCTGG - Intergenic
926034995 2:9629854-9629876 GTTTTTAAGTTTCTTGTGCGGGG - Intronic
927014359 2:18942085-18942107 GTTTAAAAGAATGTTGTGGCTGG + Intergenic
929260375 2:39860660-39860682 GCTCTTGAGAGTCTTGTGCCCGG - Intergenic
929507942 2:42542989-42543011 GTTTTTAAGAGTTTTGGGGTAGG + Intronic
930821796 2:55653189-55653211 GTTCTTAAGAGTCTTGTTGAGGG + Intronic
931923215 2:67043500-67043522 GTTTTCAATACTCTTGTGTCAGG - Intergenic
932491489 2:72125626-72125648 GTTTTTAAGTGACATGTGACTGG - Intergenic
932549766 2:72756079-72756101 GTTTTTAACTGTGTTGGGGCGGG + Intronic
932793730 2:74677195-74677217 GTTTTTAAGAGTCCTGGGCTGGG - Intronic
933850460 2:86362406-86362428 GTATTTAAAAATCTTTTGGCTGG + Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
937003900 2:118493649-118493671 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
938110535 2:128561372-128561394 CATTGTAAGAGTCTTGCGGCCGG - Intergenic
938269089 2:129953295-129953317 ATATTTAAGAGTTTTATGGCTGG - Intergenic
938395985 2:130948434-130948456 GTTATTTAGAGTCTTGTGGAAGG + Intronic
938668841 2:133567424-133567446 GTTTTAAAGAGCCCTGAGGCAGG + Intronic
939380898 2:141435219-141435241 GTATTTAAGTCTCTTATGGCAGG + Intronic
940325137 2:152417410-152417432 ATTTGTAAGACTCTTGGGGCAGG + Intronic
940948168 2:159642533-159642555 GTTATTAAGAATGTTTTGGCTGG - Intergenic
942841615 2:180368702-180368724 CTTCTTAACAGTCTTGTAGCAGG - Intergenic
943616068 2:190094134-190094156 GTAAATAGGAGTCTTGTGGCTGG + Intronic
944136929 2:196409919-196409941 CTTTTTATGATTCTTGTGCCAGG - Intronic
944479097 2:200136752-200136774 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
945015158 2:205507508-205507530 GTCTATAAGAATATTGTGGCCGG - Intronic
946093023 2:217247819-217247841 GTTATTAACAATCTTCTGGCAGG + Intergenic
947210037 2:227700170-227700192 TTTTTTAAGAATCTTGGGCCGGG - Intronic
948193244 2:236076151-236076173 GTTTTTTAAAGTCTTGAGGCGGG + Intronic
1169712159 20:8577131-8577153 CTTTTTAAGAGTCTTGAGGCCGG + Intronic
1170466026 20:16623201-16623223 GTTTTTAAGAATAATTTGGCGGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171463481 20:25312002-25312024 GTTTTAAAGTGTATTCTGGCTGG - Intronic
1171497699 20:25568705-25568727 GTTTTTAAGAAATTGGTGGCAGG - Intronic
1172401312 20:34654164-34654186 CTTATTAAGAGTCTCTTGGCCGG + Intronic
1173796069 20:45860887-45860909 GTTATTAATCTTCTTGTGGCAGG - Intronic
1175049529 20:56141774-56141796 GTTTTTAAGAATAATTTGGCAGG + Intergenic
1176697392 21:9996381-9996403 GTTTTTAGGAGACTTTTAGCAGG - Intergenic
1178092550 21:29179926-29179948 TTTTTTAAGAGTTTTCTGGCTGG + Intergenic
1180464670 22:15600310-15600332 ATATTTAAGAGTTTTATGGCTGG + Intergenic
1180476019 22:15708218-15708240 TTTTTTAAGAATCTTTTGGCTGG + Intronic
1184085063 22:42256780-42256802 GTTTATAGGAGTCATCTGGCTGG + Intronic
1184280321 22:43433915-43433937 GTTTTTAAGAGTTTTGAGCCTGG + Intronic
949587583 3:5456967-5456989 GCTTTTAAGAAAATTGTGGCTGG - Intergenic
949708757 3:6849956-6849978 TTTTCTAAGAGTCTTGAGGATGG + Intronic
950272827 3:11632711-11632733 GTTATGAAGAGTCTTATGCCAGG - Intronic
950277166 3:11671792-11671814 ATTTTTAAGAGATGTGTGGCTGG - Intronic
950590651 3:13933968-13933990 GTTTTAAAGATTCTGGTGGAGGG + Intergenic
950711832 3:14818785-14818807 GTTTTAAAGATTCTGGTGGAGGG + Intergenic
950839394 3:15952318-15952340 GTTTAAAAGAGTCTATTGGCTGG - Intergenic
951630509 3:24715044-24715066 GTGATTAAGAGTCTTGAGGTGGG - Intergenic
951757058 3:26102550-26102572 GTTTATAATAGACATGTGGCTGG + Intergenic
952290230 3:32007999-32008021 GTGTTTAAGAATTTTGAGGCTGG - Intronic
953453027 3:43019821-43019843 TTTTTTAAGAGTTTTCTGGGTGG - Intronic
953795753 3:45984803-45984825 GGTTTTGAGGGACTTGTGGCAGG - Intronic
954354837 3:50076263-50076285 TTTTTAAAGAATCTTTTGGCCGG - Intronic
954753602 3:52827218-52827240 GTTGTTGAGAGCCTGGTGGCAGG + Intronic
955809677 3:62774219-62774241 CCTTTTAAGAGCTTTGTGGCCGG - Intronic
956374179 3:68596594-68596616 CTTTTGTAGAGTCTTGGGGCAGG - Intergenic
956698230 3:71936605-71936627 GTTTTCAAAAGTCCTGTGGCAGG + Intergenic
959671148 3:108978810-108978832 GGTTTTAAGGGTCTTGTGTGGGG - Intronic
960322177 3:116249678-116249700 GTATTAAAGAGTCTTCTGGCTGG - Intronic
960744357 3:120870251-120870273 TTTTTTAATGGGCTTGTGGCAGG - Intergenic
962814045 3:138982740-138982762 GTCTTTCCCAGTCTTGTGGCAGG - Intergenic
964239936 3:154580511-154580533 GATTTTAGGAGCTTTGTGGCAGG - Intergenic
965514733 3:169608624-169608646 GTTATTAAGAGTCTGGTGTAAGG + Intronic
965882296 3:173400441-173400463 GTAATTAAGAGTCTTGTGAATGG - Intronic
966434710 3:179870408-179870430 GTTTTTAAGGGTCTTGGAGTGGG - Intronic
967166385 3:186783534-186783556 GTTTTTTATAGGCTCGTGGCCGG - Exonic
967276813 3:187784285-187784307 GTTTGAAAAGGTCTTGTGGCTGG + Intergenic
967544012 3:190702305-190702327 GGTTTTAAAAGTCATGAGGCTGG - Intergenic
968423289 4:503306-503328 GTTTTAAAGAGTAGTGTAGCAGG - Intronic
968764479 4:2461169-2461191 GTTTTTTAGCCCCTTGTGGCTGG + Intronic
971311151 4:25526660-25526682 GTTTTTAAGATTTTTCTAGCCGG - Intergenic
972093012 4:35312042-35312064 ATTTTGAAGGGTCTTGGGGCAGG + Intergenic
972484947 4:39532204-39532226 GTTTTTAAAAGAGTTCTGGCTGG + Intergenic
974923756 4:68273146-68273168 GGTTTTAGGAGTTTTGTGCCTGG + Intergenic
976080282 4:81347251-81347273 GTTTTTCTGAGGCTTGTGGCTGG + Intergenic
976367701 4:84248370-84248392 GTTTTTAAAAATTTTGTGCCTGG - Intergenic
978124836 4:105123277-105123299 TTTTTAAAGTGTCTTCTGGCCGG + Intergenic
978480153 4:109179592-109179614 GTGTTTAAGTGTTTTGTGACTGG - Intronic
980369993 4:131856563-131856585 GTTTTTAGGAGACTTTTAGCAGG - Intergenic
981272898 4:142865631-142865653 GATTTTAAGATTTTTCTGGCCGG + Intergenic
981455187 4:144945303-144945325 GTTTTCAAAAGGCTTTTGGCAGG - Intergenic
982143771 4:152359274-152359296 GATTTTAAGTATCTTGTGGGAGG - Intronic
985119916 4:186630215-186630237 GTTTTTAAGAGTCCAGAGACTGG + Intronic
985221200 4:187707278-187707300 ATTTTTAAGAGTCTGATGACAGG + Intergenic
985319008 4:188688217-188688239 GGTTTTAAGAGCCATGTGCCAGG - Intergenic
988289155 5:29262657-29262679 GTTTTTAAGAGTCTGTTGAGAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990387096 5:55276192-55276214 GATTTTGAAACTCTTGTGGCAGG + Intronic
990388158 5:55288836-55288858 GTTTTCAAGAGTAAGGTGGCTGG + Intronic
990698900 5:58454113-58454135 TTTTTGAAGATACTTGTGGCTGG - Exonic
990917685 5:60928946-60928968 ATTTTTAAGAGTTTTGGGACTGG - Exonic
992074422 5:73177600-73177622 GTTCTTAAGAAACTCGTGGCTGG - Intergenic
992394086 5:76356073-76356095 GTTTTTAGGAGCCTTGTGCCAGG - Intergenic
993039762 5:82800761-82800783 ATTTTTCAGAGTCTTTTGGGGGG - Intergenic
994154660 5:96489661-96489683 GTTTTTGATAGTCTTGGGGAGGG - Intergenic
994287558 5:97988410-97988432 GTTTGTTAGAGTCTAGTGACTGG - Intergenic
994664049 5:102687407-102687429 GTCTTTAAGAATGTTGAGGCCGG + Intergenic
997577214 5:134989658-134989680 GTTTTAAGGAATGTTGTGGCTGG + Intronic
1006801594 6:36763304-36763326 GTATTTAAAAATATTGTGGCCGG + Intronic
1011095548 6:83658073-83658095 ATTTTGAAGAATCTTGAGGCTGG - Intronic
1011349417 6:86406165-86406187 GTTTGTATTAGTGTTGTGGCTGG + Intergenic
1012536605 6:100305910-100305932 GTTTTTAAAAGTAATGTGTCAGG - Intergenic
1013375907 6:109514017-109514039 GTTTTTAAGAGTTTTGGAGTGGG - Intronic
1020799871 7:12720244-12720266 TTTTTTTAGGGTCTTGCGGCGGG - Intergenic
1020999214 7:15307168-15307190 GTTGTTAACAGTCTTGTGAGAGG + Intronic
1022338905 7:29450235-29450257 GTTTTTAAGGATTTTGTGGTAGG + Intronic
1023324502 7:39038498-39038520 GTTTGTATGTGTGTTGTGGCGGG - Intronic
1024278358 7:47697550-47697572 GTTTAAAAGAGCCTGGTGGCCGG - Intronic
1024345200 7:48306271-48306293 GTTTTTTAGAGTCTAGTCCCAGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1028519591 7:91715499-91715521 GATTTAATGAGTATTGTGGCAGG - Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1032713530 7:134484181-134484203 GTTTTTAAAAATTTTGTAGCTGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1036509976 8:9391173-9391195 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
1036784255 8:11675258-11675280 GTTTCTACGAGTCATTTGGCAGG + Intergenic
1036969216 8:13335115-13335137 GTTTTTAAGACTATGGGGGCAGG + Intronic
1037540226 8:19863688-19863710 GATTTTAGAAGTCCTGTGGCCGG + Intergenic
1041964962 8:63665921-63665943 TTTTTTAAAAGTCTTTTGTCTGG + Intergenic
1042937753 8:74077349-74077371 GGTTTTAGGAGTTTTGTGCCAGG + Intergenic
1046038054 8:108867856-108867878 CTTTTTAGGAAGCTTGTGGCTGG - Intergenic
1046252053 8:111644122-111644144 GTTTTTAAAAGTGATGTGTCCGG - Intergenic
1047407204 8:124595642-124595664 GTGGTTAAGGGTCTTGAGGCAGG - Intronic
1047601911 8:126433997-126434019 GTTTTTAAAAATGATGTGGCAGG - Intergenic
1048119319 8:131562637-131562659 GTTTAAAAGAGTGATGTGGCCGG + Intergenic
1048910535 8:139130474-139130496 GTATTTAAGGGCCTGGTGGCTGG + Intergenic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1050277095 9:4011268-4011290 GTTTGTAAGAGTCATCTGCCAGG + Intronic
1053040484 9:34866510-34866532 GTTTTTCATAACCTTGTGGCTGG - Intergenic
1053634384 9:39982212-39982234 GTTTTTAGGAGACTTTTAGCAGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053771367 9:41481273-41481295 GTTTTTAGGAGACTTTTAGCAGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054209503 9:62268485-62268507 GTTTTTAGGAGACTTTTAGCAGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054315485 9:63580493-63580515 GTTTTTAGGAGACTTTTAGCAGG - Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1057584630 9:96318147-96318169 GCTTTTAAGAGGCTTCTGGAGGG - Intergenic
1060619032 9:125045885-125045907 GTTTTTAAGATTCTTCAGGAGGG - Intronic
1061233026 9:129325980-129326002 GTTTTTACGTGTCTAGTAGCTGG - Intergenic
1061823241 9:133240093-133240115 GTTTTTAAAAACCTTTTGGCCGG + Intergenic
1061929342 9:133824437-133824459 GGTTTTAAGAGTGTCCTGGCTGG - Intronic
1185654360 X:1672153-1672175 GTTTTTAAAATTTTTTTGGCTGG + Intergenic
1187064908 X:15824089-15824111 ATTTTTTATAGTCTTCTGGCAGG - Intergenic
1187091262 X:16099277-16099299 GTTTTTAAGTGTATTTTGGTGGG - Intergenic
1187701789 X:21970118-21970140 GTTTTTAAGAGTTTTCTACCTGG + Intronic
1188142633 X:26570719-26570741 GTTTTTAAGAGTGTGGTGAGAGG - Intergenic
1189106700 X:38244203-38244225 GTTTTTAAGAGTCTTGTGGCTGG + Intronic
1189419001 X:40839487-40839509 TTTTTAAAAAGTCTTCTGGCTGG + Intergenic
1190282628 X:48940997-48941019 GTTGTTGGGAGTCTTGAGGCAGG - Intronic
1190291509 X:48995889-48995911 CTTTTTAAAAGTTTTATGGCCGG - Intronic
1193102605 X:77632383-77632405 GTGTTTATAAATCTTGTGGCTGG - Intronic
1194620706 X:96167657-96167679 GTTATTAAGTGTCTTGTGATAGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195686825 X:107595018-107595040 TTATTTAAGAGTGTTTTGGCTGG + Intronic
1196245998 X:113401179-113401201 CTTTGTAAGAGTCTTCTAGCTGG + Intergenic
1196826786 X:119747049-119747071 TTTTTTAAAAGTCTCCTGGCTGG - Intergenic
1199082504 X:143592350-143592372 GTTTTTAAGAATATTTTGGTGGG - Intergenic
1200334212 X:155331753-155331775 GTGTTTAAGAGTATGGTGTCTGG - Intronic
1200409755 Y:2849550-2849572 GTCTTTGGGAGTCTTGGGGCTGG + Intronic
1202605068 Y:26632459-26632481 GTTTTCACGAGGCTTCTGGCAGG - Intergenic