ID: 1189111212

View in Genome Browser
Species Human (GRCh38)
Location X:38291800-38291822
Sequence ACCAGGACGTTGTAGGTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189111212_1189111215 17 Left 1189111212 X:38291800-38291822 CCAATGACCTACAACGTCCTGGT 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1189111215 X:38291840-38291862 GTTCCCTTGCCCATTATACCAGG 0: 1
1: 0
2: 1
3: 3
4: 83
1189111212_1189111218 21 Left 1189111212 X:38291800-38291822 CCAATGACCTACAACGTCCTGGT 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1189111218 X:38291844-38291866 CCTTGCCCATTATACCAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189111212 Original CRISPR ACCAGGACGTTGTAGGTCAT TGG (reversed) Intronic
900856465 1:5189179-5189201 ACCATGACCTTGTAGGTCATGGG - Intergenic
902643475 1:17781544-17781566 ACCAGGAACTTCTAAGTCATTGG + Intronic
904298843 1:29541328-29541350 ACCAGGAGAATGTGGGTCATTGG + Intergenic
916301288 1:163277206-163277228 AGCAGGAGGTTCCAGGTCATAGG - Intronic
918605163 1:186416158-186416180 ACCAGCACGTTGCAGTACATGGG - Intronic
918974891 1:191471141-191471163 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
924372240 1:243363145-243363167 ACAAGGAAGCTGCAGGTCATAGG - Intronic
1066054546 10:31668241-31668263 ACCAGGATGTTGAAGGAAATGGG - Intergenic
1072553443 10:96496314-96496336 ACCAGCATGCTGTAGGGCATAGG - Intronic
1089284388 11:117396214-117396236 ACCAGGATGGTGTGGGGCATTGG + Intronic
1098450506 12:70613215-70613237 ACCATGACCTTTTAGGTCATGGG - Intronic
1102352710 12:112206182-112206204 CCCAGGACGTTGTGGGTGAAAGG + Intronic
1108585705 13:51867851-51867873 ACCTGGACGGTGTGGGCCATTGG + Intergenic
1114701740 14:24685643-24685665 ACCAGGACGTTGCAGGGTTTGGG - Intergenic
1116215268 14:42008683-42008705 ACCCGGATGTTGCAGGTCAGAGG - Intergenic
1124478794 15:30059642-30059664 ACCAGGTCATTGTAGGCCACAGG + Intergenic
1126189887 15:45868281-45868303 ACCAGGACCTTATACATCATAGG - Intergenic
1126335391 15:47581718-47581740 AGAAGAACATTGTAGGTCATAGG + Intronic
1128249848 15:66156403-66156425 ACCAGCACCTGGTGGGTCATCGG + Intronic
1131511127 15:93050108-93050130 AGCAGGATGTTGAAGGCCATTGG - Intronic
1140724236 16:77797724-77797746 CCCAGGAGCTTGGAGGTCATCGG - Intronic
1150678915 17:67268607-67268629 GCCAGGACTATGAAGGTCATAGG - Intergenic
1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG + Intronic
1158952774 18:62510791-62510813 ACCAGGACAGAGCAGGTCATGGG + Intergenic
1160888664 19:1365322-1365344 GCCTGGAAGTTGCAGGTCATTGG + Intronic
1162069787 19:8146904-8146926 ACAAGGAGGTTGTAGGGCAAAGG + Intronic
1165541640 19:36496995-36497017 CTCAGGAGGTTGTAAGTCATTGG + Intergenic
941866166 2:170336968-170336990 ACCATGAAGTTGAAGGTCAGGGG + Intronic
945881416 2:215328538-215328560 ACCAGGACGGTGAAGGGCAGAGG - Intronic
947295952 2:228630454-228630476 AACAGGAAGATGTTGGTCATAGG + Intergenic
948648324 2:239423026-239423048 ACCAGGAAGTGGCAGGTCAGGGG + Intergenic
1179022408 21:37652173-37652195 ACCAGGAAGCTTCAGGTCATAGG + Intronic
1179335378 21:40446844-40446866 AACAGGACTTTGAAAGTCATAGG - Intronic
1183551635 22:38490695-38490717 TCCAGGATCTTGTAGGACATTGG + Intronic
951779475 3:26346769-26346791 TCCAGGAGGTGGTAGGTCAGAGG + Intergenic
970123733 4:12786371-12786393 ATCAGGTAGTTGTAGGTCATGGG - Intergenic
974124080 4:57674359-57674381 ATCAGGACTTTTCAGGTCATAGG + Intergenic
976422504 4:84862482-84862504 ACCAGCACATAGTAGGTTATTGG - Intronic
977257291 4:94755326-94755348 ACCAGGACTTGGTTTGTCATAGG + Intergenic
983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG + Intergenic
991021665 5:61985698-61985720 ACCAGGATGTTGTAGGGAAGAGG - Intergenic
991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG + Intergenic
995109846 5:108417101-108417123 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007634036 6:43287410-43287432 ACCAGGGTGTTGTTGGTCCTGGG - Exonic
1013525089 6:110966556-110966578 ACCAGGAAGGTGAAGATCATTGG + Intronic
1013790011 6:113825846-113825868 ACCAGGATGTTGTAGGGGATTGG - Intergenic
1021636493 7:22699240-22699262 AGCAGGACCTTGCAGGACATGGG + Intergenic
1033795919 7:144844442-144844464 ACCAGTAAGTTGTGTGTCATGGG - Intergenic
1042159968 8:65882525-65882547 ACCAGGACTGTGTAGGTAAGGGG + Intergenic
1042590568 8:70393874-70393896 GCCTGGACGTTGAAGGGCATTGG - Intronic
1042675215 8:71313015-71313037 ACCAAGTCCTTGTTGGTCATGGG - Intronic
1045876369 8:106985828-106985850 ATCAGGACTTTGTAGTTCTTTGG - Intergenic
1055450135 9:76423448-76423470 ACTAGGAAGTTCAAGGTCATGGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189465930 X:41277349-41277371 AGAAGGACGTTATAGGTCATGGG - Intergenic
1192183055 X:68928395-68928417 ACCCGGGCCTTGTAGGTCATTGG - Intergenic
1192986419 X:76404414-76404436 ATAAGGAAGTTGTTGGTCATAGG + Intergenic
1199103323 X:143832674-143832696 AACAGGAAATTCTAGGTCATAGG - Intergenic