ID: 1189111218

View in Genome Browser
Species Human (GRCh38)
Location X:38291844-38291866
Sequence CCTTGCCCATTATACCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189111212_1189111218 21 Left 1189111212 X:38291800-38291822 CCAATGACCTACAACGTCCTGGT 0: 1
1: 0
2: 1
3: 5
4: 52
Right 1189111218 X:38291844-38291866 CCTTGCCCATTATACCAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 86
1189111213_1189111218 14 Left 1189111213 X:38291807-38291829 CCTACAACGTCCTGGTGTTCATA 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1189111218 X:38291844-38291866 CCTTGCCCATTATACCAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 86
1189111210_1189111218 22 Left 1189111210 X:38291799-38291821 CCCAATGACCTACAACGTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1189111218 X:38291844-38291866 CCTTGCCCATTATACCAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 86
1189111209_1189111218 23 Left 1189111209 X:38291798-38291820 CCCCAATGACCTACAACGTCCTG 0: 1
1: 0
2: 1
3: 11
4: 65
Right 1189111218 X:38291844-38291866 CCTTGCCCATTATACCAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 86
1189111214_1189111218 4 Left 1189111214 X:38291817-38291839 CCTGGTGTTCATACTCTTGTGTA 0: 1
1: 1
2: 29
3: 140
4: 494
Right 1189111218 X:38291844-38291866 CCTTGCCCATTATACCAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189111218 Original CRISPR CCTTGCCCATTATACCAGGT TGG Intronic
903558878 1:24212840-24212862 CCTTGCCCCTTCCATCAGGTGGG + Intergenic
906207059 1:43992409-43992431 CCTTTCCCTAGATACCAGGTGGG + Intronic
908189772 1:61690017-61690039 CCTTACCCTTTACACCATGTGGG + Intronic
910096318 1:83526139-83526161 CCTTGCCCTTTACCCCAGTTTGG - Intergenic
919176597 1:194027133-194027155 CCTTGCTCATTTTTCCAGGCTGG + Intergenic
921808400 1:219481697-219481719 CCTTCCCCCTTCTTCCAGGTAGG + Intergenic
924272682 1:242350079-242350101 CCTTGCCCCTTCTATCATGTGGG + Intronic
1066712029 10:38246548-38246570 CCTTGCCCCTTCTATCATGTGGG - Intergenic
1070471244 10:76781788-76781810 CCATGCCCATTTTACCAGTGAGG - Intergenic
1070815858 10:79322766-79322788 CCCAGCCCATTAGACCAGGAGGG + Intergenic
1076096569 10:127738104-127738126 TCTTCCCCATTTTACCAGGTAGG - Intronic
1076220261 10:128728144-128728166 CCTTGTGCTTTAGACCAGGTCGG - Intergenic
1080256188 11:30293199-30293221 TCTTGCCAATTATACTAGCTAGG - Intergenic
1082961491 11:58922418-58922440 CCATGCTCATTATAATAGGTGGG + Intronic
1082990226 11:59201150-59201172 CCTTGCCCCTTCTACCATGTGGG - Intronic
1085300873 11:75457588-75457610 CTTTCCCCTTTATACCAGGGTGG + Intronic
1090616401 11:128519527-128519549 CCTTGCCCATCAGACCATATAGG - Intronic
1091186312 11:133650828-133650850 CCTTGGCCATGAAGCCAGGTTGG + Intergenic
1091233113 11:134001071-134001093 CCTTCCCCCTCTTACCAGGTGGG + Intergenic
1091682567 12:2537599-2537621 CCTTTCCAATCATACCACGTGGG + Intronic
1093247944 12:16763071-16763093 ACTTCCCAATTATACCAAGTAGG - Intergenic
1093293926 12:17364517-17364539 CCTTGGACATGATACCAAGTAGG + Intergenic
1094467578 12:30769998-30770020 CCTAGCCCATTAAACCAGTTTGG - Intergenic
1100806304 12:98287498-98287520 CCTTGCCCCTTCTGCCATGTGGG + Intergenic
1104740950 12:131173323-131173345 CATAGCCCCTGATACCAGGTTGG + Intergenic
1106051957 13:26199720-26199742 CCTTGCCCATTTTACCCCATTGG - Intronic
1107033576 13:35878194-35878216 AGTTGTCCATTATACCAGGATGG - Intronic
1107373296 13:39775431-39775453 CTTTTCCCATTATACCAAGTGGG - Intronic
1116578208 14:46603857-46603879 GCTTGCCTATTATATCAGTTGGG + Intergenic
1202895763 14_GL000194v1_random:8682-8704 TCTTTCCCAGTAAACCAGGTTGG + Intergenic
1125873164 15:43120853-43120875 TCTTGCCCTTTCTACCATGTTGG - Intronic
1128388528 15:67167212-67167234 CCTTGCCCACTCTAACAGCTTGG - Intronic
1128407686 15:67359737-67359759 CCTTCCCCATTTTACCCGCTGGG - Intronic
1128613766 15:69093810-69093832 TCTTGCCCCTTCTACCAGGAAGG + Intergenic
1130381551 15:83376373-83376395 CCCTGCCCATTGTATCAGTTAGG + Intergenic
1135086841 16:19481910-19481932 CCTTGCCCCTTCTACCACGTGGG + Intronic
1137635263 16:49980555-49980577 CCCTGCTCATTATACCTGCTTGG + Intergenic
1143216179 17:5226918-5226940 CCTTGGCCATTAAACCAGCCTGG - Intronic
1144017360 17:11208723-11208745 ACTTGCACATTATCCCAGGAAGG + Intergenic
1151059655 17:71077375-71077397 TCTTGTACATTATACCAGGTAGG + Intergenic
1152350230 17:79780114-79780136 CCTGGCCCTTCATGCCAGGTGGG - Intronic
1155353200 18:24926619-24926641 CCTTGCTCAAGATACCAGGGTGG - Intergenic
1160187859 18:76689195-76689217 CCTTGCTCATCATACCAGCCTGG - Intergenic
1166072612 19:40395717-40395739 CCTTGCCCATTTTAGCGGCTGGG + Exonic
930018682 2:46987618-46987640 CCGTGCACATTGAACCAGGTGGG + Intronic
932144328 2:69305382-69305404 CCTTGCCCAGAATACCAGAAGGG + Intergenic
934096957 2:88615504-88615526 CCTTGCCCCTTCCACCATGTAGG + Intronic
934151881 2:89154865-89154887 CCCTGCCCATTATGCCCGGCAGG - Intergenic
939210330 2:139166620-139166642 CCTTACCCATCATTCCTGGTTGG - Intergenic
939826098 2:147017229-147017251 CCTTGCCCCTTCCACCATGTGGG - Intergenic
945932569 2:215870128-215870150 CTTTCCACATTGTACCAGGTTGG + Intergenic
1168863300 20:1061893-1061915 CTTTCCCCATTCTACTAGGTTGG + Intergenic
1169526209 20:6428680-6428702 TTTTGCCCATTATATTAGGTTGG - Intergenic
1171894708 20:30748875-30748897 CTCTCCCCATGATACCAGGTGGG + Intergenic
1175548425 20:59797538-59797560 CATTGCCCTTTGTTCCAGGTGGG + Intronic
1176615454 21:9024744-9024766 TCTTTCCCAGTAAACCAGGTTGG + Intergenic
1177338442 21:19763788-19763810 CCTTGCCCCTTCCACCATGTGGG + Intergenic
1179106953 21:38409556-38409578 CCTTTCCCATTTTTCCTGGTTGG - Intronic
1184696293 22:46140960-46140982 CCTTGCCCATCACACCCGGGAGG + Intergenic
1185111254 22:48901443-48901465 CCTCACCCATTATCCCAGGTGGG + Intergenic
975883012 4:78933170-78933192 GCTTGACCTTTATACCAGGTTGG + Intronic
983573791 4:169238298-169238320 CCATGCCCATGACACCTGGTAGG - Intronic
986395224 5:7322572-7322594 CATTGCCCATTGTACCTGGGTGG - Intergenic
992386551 5:76290247-76290269 CCTTTCAAATTATACCAAGTAGG - Intronic
993003640 5:82407590-82407612 CCTGCCCCAGTCTACCAGGTGGG + Intergenic
997136187 5:131328998-131329020 CCCTGCCCCTTGTACAAGGTGGG + Intronic
999392181 5:151201455-151201477 CCTTACTCATTTTACCAGGAAGG - Intronic
999897852 5:156053892-156053914 CCTTGCCCCTTCCACCATGTGGG - Intronic
1002557970 5:180058854-180058876 CTATACCCATTATACCAGCTGGG - Intronic
1003833370 6:10040102-10040124 CCTTAACCATTATAACAGGGAGG - Intronic
1011574917 6:88786940-88786962 CCTTGCCCCTTCTGCCATGTGGG + Intronic
1013594291 6:111646896-111646918 CCTTGCCCCTTATCCCAGGGAGG - Intergenic
1016244283 6:141964469-141964491 CCTTGCAAATTATACCCAGTGGG + Intergenic
1017329424 6:153178305-153178327 CCTTACCCATTCTGGCAGGTTGG - Intergenic
1018728796 6:166633551-166633573 CCTTGCTCAGTATATCAGTTAGG - Intronic
1019635803 7:2074968-2074990 CCTTGCCCATTGCTCCCGGTTGG - Intronic
1021487966 7:21187707-21187729 CCTTGCCCCTTCTACCATGTAGG + Intergenic
1022767616 7:33431565-33431587 CCTTGCCCCTTTTACCATGTGGG + Intronic
1023747303 7:43333155-43333177 CCTTGCCTATCATACCAGGGAGG - Intronic
1026640780 7:72123446-72123468 CCTTGCCCATGATGACAGGAAGG - Intronic
1033613092 7:142984580-142984602 TCTTGCCCATCAGACCAGGCTGG - Intergenic
1037937096 8:22922208-22922230 CCTTTCCCATCATCCTAGGTGGG - Intronic
1041583048 8:59484585-59484607 CCTTGCTCAGTCTCCCAGGTTGG - Intergenic
1043358597 8:79442498-79442520 TCTTGTCCAGAATACCAGGTGGG - Intergenic
1050759680 9:9052159-9052181 CCTTGCCCCTTCTGCCATGTGGG - Intronic
1056707130 9:88960685-88960707 TCTTCCCCAATATACCAGGCTGG + Intergenic
1057840358 9:98481213-98481235 GCTTGCCCATGAGACCAGGGTGG - Intronic
1059136220 9:111808995-111809017 ACTTGCCAATTACACCTGGTTGG - Intergenic
1059652478 9:116327671-116327693 CCTTGCCCATGATACAAAGTTGG - Intronic
1061108031 9:128547385-128547407 CCTGGCCCATTCTGCCAAGTAGG - Intergenic
1061998724 9:134204954-134204976 CCTGGCCCATCATCCCAGATGGG + Intergenic
1186449575 X:9660953-9660975 CTTTGCCCCTTCTACCATGTGGG + Intronic
1186617586 X:11205388-11205410 CCTTGCCAAATATCCCAGGGAGG + Intronic
1187951967 X:24479906-24479928 CCATGCCCATTTTACCAATTAGG + Intronic
1187971745 X:24665681-24665703 CTTTCTCCATTATACAAGGTAGG - Intronic
1189111218 X:38291844-38291866 CCTTGCCCATTATACCAGGTTGG + Intronic
1189761684 X:44328347-44328369 TCTTGCCCATTATCCCAAGATGG - Intronic
1192032710 X:67531514-67531536 CCTTGGCAATCATACCAGGTGGG + Intergenic
1192795590 X:74422086-74422108 CCTTGCCCAAAATGCCAAGTGGG - Intronic
1196170719 X:112585653-112585675 CCTTGCCTATTACACTAGATAGG - Intergenic
1197306335 X:124846113-124846135 CCTTGCCCATGATACAACGCAGG + Intronic