ID: 1189112771

View in Genome Browser
Species Human (GRCh38)
Location X:38310574-38310596
Sequence GTTCTGTTCCCTGCGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189112771_1189112777 28 Left 1189112771 X:38310574-38310596 CCACAGAACGCAGGGAACAGAAC 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1189112777 X:38310625-38310647 CACAGTATGCTCTCCACCACAGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189112771 Original CRISPR GTTCTGTTCCCTGCGTTCTG TGG (reversed) Intronic