ID: 1189112773 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:38310605-38310627 |
Sequence | GTGGTTCTCACGGGTATGTG TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 101 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 92} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1189112773_1189112778 | 5 | Left | 1189112773 | X:38310605-38310627 | CCACACATACCCGTGAGAACCAC | 0: 1 1: 0 2: 0 3: 8 4: 92 |
||
Right | 1189112778 | X:38310633-38310655 | GCTCTCCACCACAGGCTACTTGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
||||
1189112773_1189112781 | 19 | Left | 1189112773 | X:38310605-38310627 | CCACACATACCCGTGAGAACCAC | 0: 1 1: 0 2: 0 3: 8 4: 92 |
||
Right | 1189112781 | X:38310647-38310669 | GCTACTTGGATCACCTTCTCCGG | 0: 1 1: 0 2: 3 3: 10 4: 103 |
||||
1189112773_1189112777 | -3 | Left | 1189112773 | X:38310605-38310627 | CCACACATACCCGTGAGAACCAC | 0: 1 1: 0 2: 0 3: 8 4: 92 |
||
Right | 1189112777 | X:38310625-38310647 | CACAGTATGCTCTCCACCACAGG | 0: 1 1: 0 2: 1 3: 8 4: 106 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1189112773 | Original CRISPR | GTGGTTCTCACGGGTATGTG TGG (reversed) | Exonic | ||