ID: 1189112773

View in Genome Browser
Species Human (GRCh38)
Location X:38310605-38310627
Sequence GTGGTTCTCACGGGTATGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189112773_1189112778 5 Left 1189112773 X:38310605-38310627 CCACACATACCCGTGAGAACCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1189112778 X:38310633-38310655 GCTCTCCACCACAGGCTACTTGG 0: 1
1: 0
2: 1
3: 9
4: 131
1189112773_1189112781 19 Left 1189112773 X:38310605-38310627 CCACACATACCCGTGAGAACCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1189112781 X:38310647-38310669 GCTACTTGGATCACCTTCTCCGG 0: 1
1: 0
2: 3
3: 10
4: 103
1189112773_1189112777 -3 Left 1189112773 X:38310605-38310627 CCACACATACCCGTGAGAACCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1189112777 X:38310625-38310647 CACAGTATGCTCTCCACCACAGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189112773 Original CRISPR GTGGTTCTCACGGGTATGTG TGG (reversed) Exonic