ID: 1189112777 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:38310625-38310647 |
| Sequence | CACAGTATGCTCTCCACCAC AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 116 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 8, 4: 106} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1189112771_1189112777 | 28 | Left | 1189112771 | X:38310574-38310596 | CCACAGAACGCAGGGAACAGAAC | 0: 1 1: 0 2: 0 3: 13 4: 163 |
||
| Right | 1189112777 | X:38310625-38310647 | CACAGTATGCTCTCCACCACAGG | 0: 1 1: 0 2: 1 3: 8 4: 106 |
||||
| 1189112773_1189112777 | -3 | Left | 1189112773 | X:38310605-38310627 | CCACACATACCCGTGAGAACCAC | 0: 1 1: 0 2: 0 3: 8 4: 92 |
||
| Right | 1189112777 | X:38310625-38310647 | CACAGTATGCTCTCCACCACAGG | 0: 1 1: 0 2: 1 3: 8 4: 106 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1189112777 | Original CRISPR | CACAGTATGCTCTCCACCAC AGG | Exonic | ||