ID: 1189112777

View in Genome Browser
Species Human (GRCh38)
Location X:38310625-38310647
Sequence CACAGTATGCTCTCCACCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189112773_1189112777 -3 Left 1189112773 X:38310605-38310627 CCACACATACCCGTGAGAACCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1189112777 X:38310625-38310647 CACAGTATGCTCTCCACCACAGG 0: 1
1: 0
2: 1
3: 8
4: 106
1189112771_1189112777 28 Left 1189112771 X:38310574-38310596 CCACAGAACGCAGGGAACAGAAC 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1189112777 X:38310625-38310647 CACAGTATGCTCTCCACCACAGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189112777 Original CRISPR CACAGTATGCTCTCCACCAC AGG Exonic