ID: 1189112778 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:38310633-38310655 |
Sequence | GCTCTCCACCACAGGCTACT TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 142 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 9, 4: 131} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1189112775_1189112778 | -5 | Left | 1189112775 | X:38310615-38310637 | CCGTGAGAACCACAGTATGCTCT | 0: 1 1: 0 2: 1 3: 10 4: 170 |
||
Right | 1189112778 | X:38310633-38310655 | GCTCTCCACCACAGGCTACTTGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
||||
1189112774_1189112778 | -4 | Left | 1189112774 | X:38310614-38310636 | CCCGTGAGAACCACAGTATGCTC | 0: 1 1: 0 2: 0 3: 3 4: 108 |
||
Right | 1189112778 | X:38310633-38310655 | GCTCTCCACCACAGGCTACTTGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
||||
1189112773_1189112778 | 5 | Left | 1189112773 | X:38310605-38310627 | CCACACATACCCGTGAGAACCAC | 0: 1 1: 0 2: 0 3: 8 4: 92 |
||
Right | 1189112778 | X:38310633-38310655 | GCTCTCCACCACAGGCTACTTGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1189112778 | Original CRISPR | GCTCTCCACCACAGGCTACT TGG | Exonic | ||