ID: 1189112778

View in Genome Browser
Species Human (GRCh38)
Location X:38310633-38310655
Sequence GCTCTCCACCACAGGCTACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189112775_1189112778 -5 Left 1189112775 X:38310615-38310637 CCGTGAGAACCACAGTATGCTCT 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1189112778 X:38310633-38310655 GCTCTCCACCACAGGCTACTTGG 0: 1
1: 0
2: 1
3: 9
4: 131
1189112774_1189112778 -4 Left 1189112774 X:38310614-38310636 CCCGTGAGAACCACAGTATGCTC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1189112778 X:38310633-38310655 GCTCTCCACCACAGGCTACTTGG 0: 1
1: 0
2: 1
3: 9
4: 131
1189112773_1189112778 5 Left 1189112773 X:38310605-38310627 CCACACATACCCGTGAGAACCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1189112778 X:38310633-38310655 GCTCTCCACCACAGGCTACTTGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189112778 Original CRISPR GCTCTCCACCACAGGCTACT TGG Exonic